ID: 1156268062

View in Genome Browser
Species Human (GRCh38)
Location 18:35506032-35506054
Sequence AGGCCTTGGTGGGGACAGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156268052_1156268062 26 Left 1156268052 18:35505983-35506005 CCACAGGTGTTAGAAATATGTCT No data
Right 1156268062 18:35506032-35506054 AGGCCTTGGTGGGGACAGGGTGG No data
1156268051_1156268062 29 Left 1156268051 18:35505980-35506002 CCACCACAGGTGTTAGAAATATG No data
Right 1156268062 18:35506032-35506054 AGGCCTTGGTGGGGACAGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156268062 Original CRISPR AGGCCTTGGTGGGGACAGGG TGG Intergenic
No off target data available for this crispr