ID: 1156269561

View in Genome Browser
Species Human (GRCh38)
Location 18:35518275-35518297
Sequence TTGAACTCATTGGGAAACAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156269554_1156269561 13 Left 1156269554 18:35518239-35518261 CCTGCCTTGAGCTGAGATATGAC No data
Right 1156269561 18:35518275-35518297 TTGAACTCATTGGGAAACATTGG No data
1156269552_1156269561 23 Left 1156269552 18:35518229-35518251 CCTCCTGCTGCCTGCCTTGAGCT No data
Right 1156269561 18:35518275-35518297 TTGAACTCATTGGGAAACATTGG No data
1156269553_1156269561 20 Left 1156269553 18:35518232-35518254 CCTGCTGCCTGCCTTGAGCTGAG No data
Right 1156269561 18:35518275-35518297 TTGAACTCATTGGGAAACATTGG No data
1156269555_1156269561 9 Left 1156269555 18:35518243-35518265 CCTTGAGCTGAGATATGACTCTT No data
Right 1156269561 18:35518275-35518297 TTGAACTCATTGGGAAACATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156269561 Original CRISPR TTGAACTCATTGGGAAACAT TGG Intergenic
No off target data available for this crispr