ID: 1156272013 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 18:35544320-35544342 |
Sequence | CTTTATAGAAAGATAGAGGA GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1156272009_1156272013 | -2 | Left | 1156272009 | 18:35544299-35544321 | CCAGTACTATTTTCATCTCCGCT | No data | ||
Right | 1156272013 | 18:35544320-35544342 | CTTTATAGAAAGATAGAGGAGGG | No data | ||||
1156272008_1156272013 | 15 | Left | 1156272008 | 18:35544282-35544304 | CCTAGAAGAACTATCTACCAGTA | No data | ||
Right | 1156272013 | 18:35544320-35544342 | CTTTATAGAAAGATAGAGGAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1156272013 | Original CRISPR | CTTTATAGAAAGATAGAGGA GGG | Intergenic | ||
No off target data available for this crispr |