ID: 1156272013

View in Genome Browser
Species Human (GRCh38)
Location 18:35544320-35544342
Sequence CTTTATAGAAAGATAGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156272009_1156272013 -2 Left 1156272009 18:35544299-35544321 CCAGTACTATTTTCATCTCCGCT No data
Right 1156272013 18:35544320-35544342 CTTTATAGAAAGATAGAGGAGGG No data
1156272008_1156272013 15 Left 1156272008 18:35544282-35544304 CCTAGAAGAACTATCTACCAGTA No data
Right 1156272013 18:35544320-35544342 CTTTATAGAAAGATAGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156272013 Original CRISPR CTTTATAGAAAGATAGAGGA GGG Intergenic
No off target data available for this crispr