ID: 1156275740

View in Genome Browser
Species Human (GRCh38)
Location 18:35581565-35581587
Sequence GCCCCAAGTGAGCGGGCAGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156275727_1156275740 25 Left 1156275727 18:35581517-35581539 CCGCGCCCGAGCGCCTGCGGGCG No data
Right 1156275740 18:35581565-35581587 GCCCCAAGTGAGCGGGCAGGCGG No data
1156275731_1156275740 12 Left 1156275731 18:35581530-35581552 CCTGCGGGCGCCCTGCGGCGCCC No data
Right 1156275740 18:35581565-35581587 GCCCCAAGTGAGCGGGCAGGCGG No data
1156275733_1156275740 1 Left 1156275733 18:35581541-35581563 CCTGCGGCGCCCGCCGCGCGACG No data
Right 1156275740 18:35581565-35581587 GCCCCAAGTGAGCGGGCAGGCGG No data
1156275729_1156275740 19 Left 1156275729 18:35581523-35581545 CCGAGCGCCTGCGGGCGCCCTGC No data
Right 1156275740 18:35581565-35581587 GCCCCAAGTGAGCGGGCAGGCGG No data
1156275732_1156275740 2 Left 1156275732 18:35581540-35581562 CCCTGCGGCGCCCGCCGCGCGAC No data
Right 1156275740 18:35581565-35581587 GCCCCAAGTGAGCGGGCAGGCGG No data
1156275728_1156275740 20 Left 1156275728 18:35581522-35581544 CCCGAGCGCCTGCGGGCGCCCTG No data
Right 1156275740 18:35581565-35581587 GCCCCAAGTGAGCGGGCAGGCGG No data
1156275735_1156275740 -9 Left 1156275735 18:35581551-35581573 CCGCCGCGCGACGAGCCCCAAGT No data
Right 1156275740 18:35581565-35581587 GCCCCAAGTGAGCGGGCAGGCGG No data
1156275734_1156275740 -8 Left 1156275734 18:35581550-35581572 CCCGCCGCGCGACGAGCCCCAAG No data
Right 1156275740 18:35581565-35581587 GCCCCAAGTGAGCGGGCAGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156275740 Original CRISPR GCCCCAAGTGAGCGGGCAGG CGG Intronic