ID: 1156276533

View in Genome Browser
Species Human (GRCh38)
Location 18:35589041-35589063
Sequence GCTTTGTTTTGATACCACCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 2, 3: 4, 4: 103}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156276532_1156276533 -7 Left 1156276532 18:35589025-35589047 CCTTCTGTTTTAGCTCGCTTTGT 0: 1
1: 2
2: 4
3: 46
4: 208
Right 1156276533 18:35589041-35589063 GCTTTGTTTTGATACCACCCTGG 0: 1
1: 0
2: 2
3: 4
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156276533 Original CRISPR GCTTTGTTTTGATACCACCC TGG Intronic
904918523 1:33987552-33987574 TATTTGTTTAGATACCTCCCAGG + Intronic
904979404 1:34484302-34484324 ATTTTGTTTTGATACCAACTAGG - Intergenic
912549078 1:110472893-110472915 GCTTTGTGTTGTCACCATCCAGG + Intergenic
912905147 1:113697658-113697680 GGTAAGTTTTGATACCAGCCAGG + Exonic
915382785 1:155458146-155458168 GCTTTGTTTTTATACTACCATGG - Intronic
918618173 1:186572259-186572281 GACATGTTTTGAGACCACCCAGG + Intergenic
918636610 1:186782184-186782206 GTTTTGTTTTTTTACCTCCCAGG + Intergenic
920284658 1:204870852-204870874 GAATTATTTTGATTCCACCCAGG + Intronic
923110006 1:230882888-230882910 GCCTTGTTATTATGCCACCCAGG - Intergenic
1065282144 10:24150489-24150511 GGTTTGTTTTGAAGCCATCCTGG + Intronic
1072956122 10:99889639-99889661 GCTTTCTTTCGAGACCAGCCTGG + Intronic
1077459155 11:2700160-2700182 GTCTCGTTTTGATGCCACCCGGG + Intronic
1080305468 11:30830187-30830209 GCTTTGTTATTTTACCAACCTGG - Intergenic
1086176360 11:83895749-83895771 GCTTTGTTTCCACAGCACCCAGG + Intronic
1086731670 11:90257453-90257475 ACTTTGGTTTTATCCCACCCAGG - Intergenic
1088803101 11:113325135-113325157 ACTTTTATTTTATACCACCCAGG + Intronic
1089950491 11:122521132-122521154 CCTTTGTGTTGATACTTCCCAGG - Intergenic
1094480458 12:30877204-30877226 GCTTTGTTCTGCTACCTGCCAGG - Intergenic
1100509289 12:95253637-95253659 GTTTTGTTTTGATACAAACTTGG + Intronic
1108780652 13:53827078-53827100 ACTTTGTTTTTTTATCACCCAGG - Intergenic
1113960690 13:114124131-114124153 GCTGTGTTGTGATACCAGCAGGG + Intronic
1117539734 14:56735194-56735216 TTTTTTTTTTGAGACCACCCAGG + Intergenic
1119748365 14:77060313-77060335 GCTTTATTTTAATAAGACCCTGG - Intergenic
1122016087 14:98797873-98797895 TTTTTGTTTTGAGACCAGCCAGG - Intergenic
1124113917 15:26821819-26821841 GCTTTGTTTTAATACCGACAGGG + Intronic
1125325333 15:38530756-38530778 ACTTAGTTTTGATCTCACCCAGG - Intronic
1126933020 15:53676008-53676030 GATTTGTTTTGAAACCACCAAGG + Intronic
1128649713 15:69401577-69401599 GCCTTCTTTTGCTACCACTCAGG + Intronic
1130297209 15:82655867-82655889 GCATTGTTTTGAAGCCATCCTGG + Intergenic
1130642364 15:85690171-85690193 GTTTTGTTTTGTTTCCATCCTGG + Intronic
1130873657 15:87993275-87993297 GCTTAAAATTGATACCACCCTGG - Intronic
1131205758 15:90444911-90444933 GCTTAGGTTTGAGACCAGCCTGG + Intronic
1132479805 16:161245-161267 CCTTTGTTTTGAAAACTCCCTGG - Intronic
1134534504 16:15014904-15014926 AATTTGTTTTGTTTCCACCCAGG - Intronic
1139861541 16:70025873-70025895 AATTTGTTTTGTTTCCACCCAGG + Intergenic
1143539938 17:7562749-7562771 TCTTTATTTTAATACCACCAGGG - Intronic
1154978719 18:21484382-21484404 ACTTTTTTTTGAGACCAGCCTGG - Intronic
1156190277 18:34711212-34711234 GCGTTGTTTACATATCACCCTGG + Intronic
1156276533 18:35589041-35589063 GCTTTGTTTTGATACCACCCTGG + Intronic
1156825040 18:41420579-41420601 TCTTTGTGTTCATTCCACCCTGG + Intergenic
1159597023 18:70392243-70392265 GCTCTTTTTTGGTACCACCCTGG + Intergenic
1163788175 19:19288543-19288565 GCTCAGTTTTGAAACCAGCCTGG + Intronic
925961965 2:9026153-9026175 GCCTTGTCTTGCTGCCACCCTGG + Intergenic
928889735 2:36189639-36189661 GGCTTGTTTTGATACCACAAAGG - Intergenic
932086938 2:68770913-68770935 GCTTTGTAATGATAGCACTCAGG + Intronic
932842181 2:75093829-75093851 GCTTTGTCTTGTTACCCCACAGG - Intronic
934538313 2:95155220-95155242 CCTTCGTTTTGATACCTCCTTGG - Intronic
942885636 2:180919885-180919907 GGTATCTGTTGATACCACCCTGG - Intergenic
944830586 2:203530399-203530421 GCTTTGTTTTGATTTCACCCAGG + Intronic
1171938710 20:31302950-31302972 GTTCTGTTTTGATACCATTCTGG - Intergenic
1173687740 20:44935996-44936018 TCTTTTTTTTGACAGCACCCAGG + Intronic
1175426935 20:58873791-58873813 GGTTTGTTTTGATTCCATCAAGG - Intronic
1176918626 21:14658376-14658398 GCTTTGCTTTGAGACATCCCAGG - Intronic
1176962503 21:15175237-15175259 GCATTTTTCTGATACCACTCAGG - Intergenic
1180002111 21:44999901-44999923 GCTTTGCTTTGAGATCAGCCAGG + Intergenic
1184712297 22:46259305-46259327 GCTTTCTGTTGATACCACTTTGG - Exonic
1203289903 22_KI270735v1_random:26224-26246 ACTTTATTTTTATACCAACCAGG + Intergenic
949963491 3:9334984-9335006 GCTCAGTTTTGTTACCTCCCTGG - Intronic
950380881 3:12613783-12613805 GCTTTATTTTGCTATCACCAGGG + Intronic
951508960 3:23480257-23480279 GCTGGGTTGTGATAGCACCCAGG + Intronic
951776076 3:26311758-26311780 ACTTTACGTTGATACCACCCTGG + Intergenic
960407387 3:117278309-117278331 TCTTTGCTTTGAAACCACCATGG + Intergenic
960737942 3:120801125-120801147 GCTTTGTTTTCCTAACACCAAGG + Intergenic
961417863 3:126774534-126774556 GCCTTTCTCTGATACCACCCTGG + Intronic
963311079 3:143710639-143710661 CCTTTGTTCTGATACAAACCAGG - Intronic
967486963 3:190043950-190043972 GTTTTGTTTTGACATCTCCCTGG - Intronic
968489675 4:883278-883300 GCTTTGTCTTGGTGCCACTCTGG - Intronic
970708850 4:18838511-18838533 ACTTTGTTTTGATAACACCCTGG - Intergenic
973840063 4:54852278-54852300 GCTTTGTTTTGAAAGAAGCCTGG + Intergenic
978061385 4:104344673-104344695 GCTGGGTTGTGATACCACCTGGG - Intergenic
978331990 4:107623504-107623526 TGTTTGTTTTAATATCACCCAGG + Intronic
978960243 4:114668936-114668958 GCTTTGTTTTAAAACTACACAGG - Intronic
981224243 4:142273689-142273711 TCCTTGCTTTGATTCCACCCAGG - Intronic
981755804 4:148140856-148140878 GCTTTAATTTCATACTACCCTGG + Intronic
982354817 4:154454563-154454585 ATTTTGTTTCGATAGCACCCTGG + Intronic
984484286 4:180347326-180347348 GCTCTGTTCTGATACCAGTCGGG + Intergenic
988659648 5:33251443-33251465 GCGTTATTTTGATAAAACCCAGG + Intergenic
993064791 5:83084137-83084159 GCATAGTTTTGATTCCAACCTGG + Intronic
993575539 5:89595204-89595226 TCTTTGTTTTTAGACCCCCCAGG + Intergenic
993594402 5:89834718-89834740 GCTTTGTTTTGAAGTCACCTAGG - Intergenic
995416114 5:111915190-111915212 TCATTGTTTTAAAACCACCCTGG - Intronic
996165622 5:120219116-120219138 TCTATGTTTAGATACCATCCTGG + Intergenic
997573924 5:134958311-134958333 GCTCTGTCTTTATACCACACGGG - Intronic
1000183891 5:158840268-158840290 CCTTTGTTTTGTTTCCACGCTGG + Intronic
1003834597 6:10057507-10057529 GCTTTGTTTTGAGGACACTCAGG + Intronic
1003950241 6:11109620-11109642 GATTTGTTTTGCTACCACCAGGG - Intronic
1006812420 6:36828498-36828520 GCTTTGTTTAGAGACAACCAGGG - Intronic
1008381963 6:50846429-50846451 GCTTTGTTTTCAAACCAAACAGG + Exonic
1010370360 6:75100124-75100146 GCTTTGTGGTGAGGCCACCCTGG - Intronic
1016065764 6:139681784-139681806 ACTTTCTTTTGAGACCAACCTGG - Intergenic
1017395069 6:153989251-153989273 ACTTTGTTTTCATACAACCATGG + Intergenic
1018083131 6:160276060-160276082 GCTTGATTTTGTTGCCACCCGGG - Intronic
1018083406 6:160278221-160278243 GCTTGATTTTGTTGCCACCCGGG - Intergenic
1021455236 7:20822894-20822916 GCATGGTTTGGATACCACCATGG + Intergenic
1026307108 7:69151804-69151826 GTTTTCTTTTGCTACCAGCCTGG + Intergenic
1026840244 7:73666837-73666859 GCTCAGTTTTGAGACCAGCCTGG - Intergenic
1030332290 7:108284054-108284076 GCTGGGATTTGAGACCACCCTGG - Intronic
1030532530 7:110728914-110728936 GTTTTGTTTTGTTTTCACCCAGG + Intronic
1033284470 7:140028418-140028440 GTTTTGTTTTTTCACCACCCAGG - Intronic
1038112384 8:24513833-24513855 GCTTTGGATTGAGACCATCCTGG + Intronic
1047644202 8:126852505-126852527 GCTTGGTTTTGCTTCAACCCTGG - Intergenic
1049821257 8:144635072-144635094 GCTTGGTCTTCATCCCACCCTGG + Intergenic
1056601627 9:88051442-88051464 TTTTTGTTTTGACAGCACCCAGG - Intergenic
1057451590 9:95167098-95167120 GTTTTGTTTTGTTTCCTCCCTGG + Intronic
1060759570 9:126235945-126235967 GCCTAGTTTTCATACCACGCAGG + Intergenic
1186700771 X:12087433-12087455 GCTCTTTGTTGATATCACCCAGG + Intergenic
1189442232 X:41048005-41048027 GGCTTCCTTTGATACCACCCTGG + Intergenic
1190229778 X:48573467-48573489 GTTTTGTTTTGTTTTCACCCAGG + Intergenic
1199439018 X:147847331-147847353 GCTTTGTGTTGATACAACTTTGG - Intergenic
1202150098 Y:21836639-21836661 GCTTTTTTCTGATACCAGGCCGG - Intergenic