ID: 1156281823

View in Genome Browser
Species Human (GRCh38)
Location 18:35646558-35646580
Sequence GCATCCTTCTGACATGGCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 2, 3: 6, 4: 115}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156281821_1156281823 -2 Left 1156281821 18:35646537-35646559 CCTCTGCATAGGAATGCTTAAGC 0: 1
1: 0
2: 1
3: 10
4: 97
Right 1156281823 18:35646558-35646580 GCATCCTTCTGACATGGCACTGG 0: 1
1: 0
2: 2
3: 6
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156281823 Original CRISPR GCATCCTTCTGACATGGCAC TGG Intronic
900870727 1:5300774-5300796 GCATTCTTCAGTCATGGCTCTGG - Intergenic
901157118 1:7148515-7148537 CCATCCTGCTGACTTGCCACCGG + Intronic
901195021 1:7435651-7435673 GCCTCCTTCTGACCAGGCAAGGG + Intronic
903817761 1:26077376-26077398 GCATCCTTATAACATGGCACTGG + Intergenic
904054688 1:27662423-27662445 GCCAGCTTCTGACTTGGCACTGG + Intergenic
908734059 1:67257346-67257368 GCTGCCTTCTCACATGGCAGAGG + Intronic
908834162 1:68211791-68211813 GCTTCTTGCAGACATGGCACTGG - Intronic
910761120 1:90732327-90732349 GCCTCCTTCTGTCATCACACAGG - Intergenic
912321776 1:108720363-108720385 GCAGCCTTCTGCCAAAGCACTGG - Intronic
920301722 1:204992964-204992986 GCTTCCGTGTGACATGGCAGTGG + Intronic
921599538 1:217091669-217091691 TCATCCTTCTGGCATGCCAAAGG - Intronic
1065716135 10:28570639-28570661 GGATCTTCCTGACATGCCACTGG - Intronic
1065969736 10:30796877-30796899 CCATCTTTCTGACACAGCACTGG + Intergenic
1068939819 10:62669853-62669875 GCTTCCTTAAGACAGGGCACTGG - Intronic
1069880931 10:71592716-71592738 GCATGCTACTTACATGGCAAAGG - Intronic
1070157164 10:73842376-73842398 GCTTCCTTCTGAAATGGGGCAGG + Intronic
1070782876 10:79147690-79147712 GCATCCTCCTGGAATGGCAGTGG - Intronic
1074470483 10:113722154-113722176 GCATCCTTCTGAGATGGGCCTGG - Intronic
1075522578 10:123151933-123151955 ACATCCTTCTGACATCACCCTGG - Intergenic
1075627687 10:123974289-123974311 CCATCCTGCTGGGATGGCACAGG + Intergenic
1076789242 10:132768005-132768027 GGATCTTTCTGAAATGCCACTGG - Intronic
1078351539 11:10599175-10599197 GCTTTCTTCTGTCATAGCACTGG + Intronic
1079567713 11:21903099-21903121 GCATCCTGCTGAGCTGGTACAGG - Intergenic
1083246009 11:61429221-61429243 CACTCCTTCTGACATGGCTCCGG + Exonic
1093460354 12:19402310-19402332 GCTTCCTGCTGACCTGGCAAGGG - Intergenic
1094797703 12:33995072-33995094 ACATCCTGCTGACATGGCATTGG + Intergenic
1095110429 12:38289001-38289023 ACATCCTGCTGACATGGCACTGG + Intergenic
1095136619 12:38612871-38612893 GAATCCTTCTGAGATGGAAGAGG - Intergenic
1095240689 12:39855431-39855453 GAAGCCTTCTGTCATGGCCCTGG + Intronic
1096476829 12:51913662-51913684 GCCTCCGTCGGACATGCCACAGG - Exonic
1098711522 12:73768684-73768706 GCATCCTTCTGGCATTTAACTGG + Intergenic
1102599565 12:114019125-114019147 CAAGCCTTCTGACATGGCTCTGG + Intergenic
1112084514 13:96016430-96016452 GCAACCTGCTGGCATGGCACAGG - Intronic
1112473485 13:99710309-99710331 GCATCCTTGCGACATTGCTCTGG - Intronic
1117209585 14:53481620-53481642 ACAGCCTTCTGAAGTGGCACAGG + Intergenic
1117612760 14:57501671-57501693 GCATACTTCAGAAATGGCATGGG - Intergenic
1118996357 14:70840215-70840237 GCTTCCATCTGACATGGCAGGGG - Intergenic
1120166414 14:81206310-81206332 GCATCTCTATGACATGGCCCTGG + Intronic
1120747307 14:88164056-88164078 GCATCCCTCTCTCATTGCACTGG + Intergenic
1121862861 14:97336005-97336027 GCATCCTTCTGTCCTGGTCCTGG - Intergenic
1123876404 15:24627967-24627989 GCAGCATCCTGACTTGGCACAGG + Intergenic
1130115851 15:81003260-81003282 GCAGCCTTCAGACACGGCGCAGG - Exonic
1131079949 15:89526477-89526499 GCTTCCTCCTGAAATGGCAAGGG + Intergenic
1131820321 15:96266090-96266112 GCAGCCTTCTGACATGCCTGAGG - Intergenic
1135825996 16:25729392-25729414 ACATCCTTCTGATTTGGGACAGG + Intronic
1139312473 16:66039421-66039443 GCTTCCTGCTGCCATGGCCCTGG + Intergenic
1139436729 16:66940853-66940875 ACATCCTTCTGCCATTGCAGAGG + Intronic
1143563292 17:7707636-7707658 GCATCCTGTTGCCATGGCAACGG + Intronic
1144232925 17:13227329-13227351 TCATCCATCTGACATTTCACTGG + Intergenic
1148388673 17:47254341-47254363 GCATCCCTCTGCCAAGGCGCGGG - Intronic
1153025452 18:668401-668423 CCTTCCTTCTGAGATGGAACTGG - Intronic
1156281823 18:35646558-35646580 GCATCCTTCTGACATGGCACTGG + Intronic
1156468454 18:37362555-37362577 GCACCCTTCTGCCAGGACACAGG + Intronic
1158427012 18:57349301-57349323 GCATCCTTATTACATGTGACAGG - Intergenic
1163650361 19:18514115-18514137 GCCTCCATCTGACCTGGCAGTGG - Intronic
1164987348 19:32658245-32658267 GCATCCTACTTAGACGGCACTGG - Intronic
1165256514 19:34579849-34579871 GCATCCCTCAGCCAAGGCACAGG + Intergenic
1165542694 19:36505454-36505476 GCAGCCTTCTGAGGTGGCAAGGG + Intergenic
1166448713 19:42880113-42880135 GCATCATTCTGACAGGGACCTGG - Intronic
925745604 2:7040954-7040976 GCATCCTGCTGCCATGGAAATGG - Exonic
930992960 2:57682753-57682775 GCTGCCTTCTCACATGGCAGAGG - Intergenic
931947318 2:67324675-67324697 GCATCCTTCTGCCACGGGGCTGG - Intergenic
932122349 2:69113310-69113332 TCATCCTACTGAAATGGCAGAGG - Intronic
934652038 2:96098339-96098361 GCATCTTTCTGGTAGGGCACAGG + Intergenic
935172951 2:100624849-100624871 ACATCCTTCTGCAATGGCAAGGG + Intergenic
935605738 2:104970596-104970618 GCAGCCTAGAGACATGGCACAGG + Intergenic
937982760 2:127624847-127624869 GCATCTGCCTGACTTGGCACAGG - Intronic
938343802 2:130552373-130552395 GCCTCCTGCTGAGATGGCAGCGG + Intergenic
938346031 2:130568349-130568371 GCCTCCTGCTGAGATGGCAGCGG - Intergenic
948535710 2:238645003-238645025 GCTTCCTGCTGACATGGCCCGGG + Intergenic
948687479 2:239677989-239678011 GCACCCTTCTGACCTGAGACGGG + Intergenic
1173223868 20:41150415-41150437 GCATCCCTGAGACATGGCCCTGG + Intronic
1179376263 21:40852384-40852406 GCATCCTTCTCACATTCCTCAGG - Intergenic
1181142564 22:20817354-20817376 ACATGTGTCTGACATGGCACAGG + Intronic
1183294414 22:37021153-37021175 GTATCCTTCTGACATGAGCCTGG + Intronic
1184313234 22:43662363-43662385 GCCACCCTCTGCCATGGCACAGG + Intronic
959068365 3:101679803-101679825 GCATCCTTGCAACTTGGCACAGG + Intergenic
965351889 3:167622743-167622765 GCATCCTGCTGACGTTGGACTGG - Intronic
968611728 4:1560216-1560238 GCAGCCTTAGGACATGGCAGCGG + Intergenic
970142098 4:12994048-12994070 GCATCATTCCCAGATGGCACAGG + Intergenic
974874494 4:67686547-67686569 GAATCCCTGTGACATGGTACTGG + Intronic
975045143 4:69793988-69794010 GCATTCTTCTGACATAGAAATGG + Intergenic
977504183 4:97880850-97880872 GCATCCTTCTGAACTGGTATTGG - Intronic
978564953 4:110071686-110071708 GCATCCTTCTGAGCAGGCAGTGG - Intronic
979693388 4:123584374-123584396 GCTTCTTCCCGACATGGCACTGG + Intergenic
984325312 4:178242861-178242883 GCTGGCTACTGACATGGCACAGG - Intergenic
986044675 5:4025494-4025516 GCAGCCTGCAGACATGGCACTGG - Intergenic
989095468 5:37777535-37777557 GAATCTTTCAGACATTGCACTGG - Intergenic
992601512 5:78405377-78405399 GCATTCTCCTGACTTTGCACTGG + Intronic
995114825 5:108467925-108467947 GCATACTTCAGAGATGTCACGGG + Intergenic
997388952 5:133497621-133497643 GAAACCCTCTGACCTGGCACTGG + Intronic
1002569680 5:180133091-180133113 GCCTCCTTCAGCCTTGGCACTGG + Intronic
1007124330 6:39412373-39412395 GCATCTTTCTGAGATGACTCAGG - Intronic
1007580434 6:42955961-42955983 GCATCCTTGCAACTTGGCACAGG + Intergenic
1010180770 6:73084561-73084583 GCATCCTGATGGCATGGCATGGG - Intronic
1010867045 6:80989560-80989582 TCATCTTTCTGCCATAGCACTGG - Intergenic
1011530950 6:88320546-88320568 TGATCCTTCTGCCTTGGCACTGG - Intergenic
1013189244 6:107788311-107788333 GCAGCCTGGTGACATGGCTCTGG - Intronic
1018637327 6:165874487-165874509 TCATCCTTCTTATATTGCACAGG - Intronic
1020418083 7:7969024-7969046 GCATCGTGCTGACAGGGCAACGG - Exonic
1021325844 7:19266461-19266483 GCATCCTTCAGACATGAATCTGG + Intergenic
1022257096 7:28669834-28669856 ACATCCTTATGGCAGGGCACAGG - Intronic
1024009818 7:45258180-45258202 GGACTCTTCTGACATGCCACAGG + Intergenic
1026469157 7:70680065-70680087 GCATACTTCTGACATTTCATTGG + Intronic
1028063508 7:86351239-86351261 GCATCCTTCTGAAAGGCCAGTGG - Intergenic
1028781198 7:94738690-94738712 GCATTCTTCAGAGAGGGCACTGG - Intergenic
1033616563 7:143022256-143022278 GCAGGCTTCTTACATGGCAGGGG + Intergenic
1034785805 7:153925024-153925046 GCAGGCTTCTGACCTGGCCCTGG - Intronic
1035448239 7:158957554-158957576 GCATCCTTCCCACGTGCCACGGG + Intergenic
1037556085 8:20023889-20023911 GCATCCTTCCTACAAGACACTGG - Intergenic
1039073778 8:33670523-33670545 GCATCCGTCTGAGATGGAAAGGG - Intergenic
1040902160 8:52428236-52428258 GAATCCTTCTGGCATGACAGGGG - Intronic
1042050775 8:64703519-64703541 TCATCCTTCAGACAAGGAACTGG - Intronic
1051258959 9:15243141-15243163 TCCTCCTTCTGACATGGCGTTGG - Intronic
1053218648 9:36293464-36293486 GCATCATTCTCACCTGGCCCAGG - Intronic
1056410979 9:86326712-86326734 GCAACCTTCTGACAAGCCATGGG - Intronic
1057151301 9:92798460-92798482 GCATCCCTCTGCCCTGGCGCTGG - Intergenic
1058790131 9:108436213-108436235 CCATCCTTTAGACAGGGCACAGG + Intergenic
1059500164 9:114745746-114745768 GAATCCTCTTTACATGGCACAGG - Intergenic
1062031140 9:134362535-134362557 GCATGGTGCTGGCATGGCACAGG + Intronic
1186344879 X:8681749-8681771 GCATCTTTCTGAGATGGGAATGG - Intronic
1196704474 X:118704911-118704933 GAATCCTAAAGACATGGCACAGG - Intergenic
1198236178 X:134737676-134737698 CCTTCCTTCTGACATTGCATGGG + Intronic
1201422470 Y:13814728-13814750 GCATCTTTCTGAGATGGGAATGG + Intergenic