ID: 1156281823

View in Genome Browser
Species Human (GRCh38)
Location 18:35646558-35646580
Sequence GCATCCTTCTGACATGGCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156281821_1156281823 -2 Left 1156281821 18:35646537-35646559 CCTCTGCATAGGAATGCTTAAGC No data
Right 1156281823 18:35646558-35646580 GCATCCTTCTGACATGGCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156281823 Original CRISPR GCATCCTTCTGACATGGCAC TGG Intronic