ID: 1156285430

View in Genome Browser
Species Human (GRCh38)
Location 18:35689977-35689999
Sequence GGTTGGACTCAATATCACCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 85
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 78}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156285428_1156285430 -5 Left 1156285428 18:35689959-35689981 CCTTCTTGTCAAAGAGAGGGTTG 0: 1
1: 0
2: 1
3: 16
4: 112
Right 1156285430 18:35689977-35689999 GGTTGGACTCAATATCACCTTGG 0: 1
1: 0
2: 0
3: 6
4: 78
1156285425_1156285430 11 Left 1156285425 18:35689943-35689965 CCAGTGAATCGCTTTGCCTTCTT 0: 1
1: 0
2: 1
3: 13
4: 167
Right 1156285430 18:35689977-35689999 GGTTGGACTCAATATCACCTTGG 0: 1
1: 0
2: 0
3: 6
4: 78
1156285424_1156285430 12 Left 1156285424 18:35689942-35689964 CCCAGTGAATCGCTTTGCCTTCT 0: 1
1: 0
2: 2
3: 10
4: 108
Right 1156285430 18:35689977-35689999 GGTTGGACTCAATATCACCTTGG 0: 1
1: 0
2: 0
3: 6
4: 78

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156285430 Original CRISPR GGTTGGACTCAATATCACCT TGG Intronic
900231349 1:1560067-1560089 GGTTGGTCTCAAACTCAACTCGG + Intronic
913282565 1:117200189-117200211 GGTTGGTCTCAAAAACTCCTGGG - Intronic
919137463 1:193528741-193528763 GGTTGGACTAAATAGTACTTAGG + Intergenic
919719648 1:200819472-200819494 TGTTGGACTTAATGTCATCTTGG - Intronic
921973870 1:221179732-221179754 TGTTTGAATCAATATCAGCTGGG - Intergenic
924301590 1:242644767-242644789 GATTTGCCTCAATGTCACCTGGG - Intergenic
1066443628 10:35461860-35461882 GGCTGGACTCAATAACATCAGGG - Intronic
1071372233 10:84963718-84963740 GGGTGGCCTCAATGACACCTAGG + Intergenic
1072328114 10:94318592-94318614 GGATGGACACAATTTCAGCTTGG - Intronic
1074848717 10:117421448-117421470 GGTGGGAGGCAATATGACCTAGG - Intergenic
1078348973 11:10576796-10576818 TGGTGGAATCAAAATCACCTGGG - Intronic
1087058067 11:93952773-93952795 CCTTGGACTCCACATCACCTAGG - Intergenic
1089004729 11:115081932-115081954 GGTTGGACTAAATGTCCCTTTGG + Intergenic
1093433618 12:19110903-19110925 GGCTGGTCTCAAACTCACCTCGG - Intergenic
1095364349 12:41384777-41384799 GGTGAGACTCAATTTCACCCAGG + Intronic
1096688459 12:53304804-53304826 GGCTGGACTCAAAAACTCCTGGG + Intronic
1099664102 12:85604352-85604374 GGGAGGATTCAATATCACCCTGG + Intergenic
1101696499 12:107132321-107132343 TGAAGGACTCAAAATCACCTAGG + Intergenic
1103022442 12:117546738-117546760 GGATGGACTCAATAACAAGTTGG - Intronic
1104205296 12:126632883-126632905 ATTTGGACTCATTATAACCTCGG + Intergenic
1107782097 13:43914714-43914736 CGTTGGCATCAGTATCACCTGGG + Intergenic
1116997824 14:51342278-51342300 GATTGGAGTCAATATTACCTGGG - Intergenic
1119363909 14:74074988-74075010 GGTGGGACTGGATTTCACCTTGG + Exonic
1120671633 14:87368881-87368903 GTTTGGAGTTAATATCATCTTGG - Intergenic
1202844718 14_GL000009v2_random:158077-158099 GGCTGGCATCAAAATCACCTGGG - Intergenic
1202914115 14_GL000194v1_random:148322-148344 GGCTGGCATCAAAATCACCTGGG - Intergenic
1127226012 15:56930085-56930107 GGTTGGACTTAATATAATCATGG + Intronic
1130973284 15:88752511-88752533 GCTTTGAATCAATATAACCTTGG + Intergenic
1131134600 15:89924200-89924222 GGTTCACCTCTATATCACCTAGG - Intergenic
1156285430 18:35689977-35689999 GGTTGGACTCAATATCACCTTGG + Intronic
1164082749 19:21874878-21874900 GGTTGGCCTCAATACCAAGTTGG + Intergenic
1165608306 19:37126652-37126674 GGTGGGGATCAAAATCACCTGGG - Intronic
1166012323 19:39951633-39951655 GCTTGGCCTCAGTATCCCCTGGG - Intergenic
1166075484 19:40411618-40411640 AGTTGGGCTAAATATAACCTGGG - Intronic
929627253 2:43422044-43422066 GGTTGGACTGGATATCATCAAGG - Intronic
947408542 2:229808224-229808246 GATTGGGCTAAATATCACTTTGG - Intronic
1176633469 21:9162996-9163018 GGCTGGCATCAAAATCACCTGGG - Intergenic
950986092 3:17368892-17368914 GGTTTGAGTAAATATCACCAAGG - Intronic
953848732 3:46449355-46449377 GGTTGGGCTCAAGGTCCCCTAGG - Intronic
954902186 3:54029428-54029450 GGCTGGTCTCAAAAACACCTGGG - Intergenic
955629734 3:60960342-60960364 GGTTGGACTCTAAATCACATTGG + Intronic
955815961 3:62843565-62843587 CGTTGGACTCAACCTCATCTGGG + Intronic
957100337 3:75818924-75818946 GGCTGGCATCAAAATCACCTGGG - Intergenic
960479270 3:118169193-118169215 TATTGGACTGAATAGCACCTTGG + Intergenic
963869426 3:150399059-150399081 GTTTGTACTCAAAATCTCCTTGG - Intergenic
964693483 3:159480714-159480736 GGTTTGACTCATGATAACCTAGG + Intronic
965907020 3:173721267-173721289 GATTGGACACAAGGTCACCTCGG - Intronic
966740425 3:183227731-183227753 AATTGGACTCATTCTCACCTTGG + Intronic
969676291 4:8616256-8616278 GGTGGGAGTCTACATCACCTGGG + Intronic
971160095 4:24125155-24125177 TGTTGGACTCTATATAACTTGGG - Intergenic
975319824 4:72997235-72997257 AGTTGGACCAAATATCAGCTTGG - Intergenic
975676742 4:76834723-76834745 GCATGAACTCAATATCATCTAGG - Intergenic
975971284 4:80041203-80041225 GTTTGGACTCAATAAAACCTGGG - Intronic
985948382 5:3204034-3204056 CGTTGGACCCACTATCACCATGG - Intergenic
986158181 5:5197855-5197877 GGTGGGAATCAGAATCACCTGGG + Intronic
988271348 5:29021673-29021695 GGCTGGAATCAATATCACCAGGG - Intergenic
988441513 5:31239207-31239229 GGCTGGACACAATATCCTCTAGG - Intronic
990795863 5:59540107-59540129 GGTTAGCATCAATATCACCTAGG - Intronic
993342320 5:86739850-86739872 GGTAGGATTCAATATCTCTTAGG + Intergenic
998993795 5:147848510-147848532 GGTAGGACTAAATTTCATCTGGG - Intergenic
999104424 5:149058035-149058057 GGTTGGACTCAATGTCAGGTGGG - Intronic
1000056985 5:157615706-157615728 GGTGGGTTTCAAAATCACCTCGG + Intergenic
1004406073 6:15335059-15335081 GTGTGGACTGAATATCCCCTGGG - Intronic
1014611597 6:123554265-123554287 GGTAGTACTCAATATGAGCTTGG + Intronic
1020498124 7:8882223-8882245 GGTTCCACTCAGTATCAGCTGGG - Intergenic
1026252906 7:68686185-68686207 GTTTAGACTCACAATCACCTGGG + Intergenic
1028163549 7:87512361-87512383 GGTTGGCATCAGAATCACCTCGG + Intronic
1030399122 7:109026568-109026590 GTTTGAACTCAATATCAGTTAGG + Intergenic
1031771416 7:125848733-125848755 GGTTGCAATCAGAATCACCTGGG + Intergenic
1034091805 7:148370697-148370719 GATTGAACTCAATAGCCCCTTGG + Intronic
1036228505 8:6980570-6980592 GGTAGCACTCAGTCTCACCTGGG - Intergenic
1036230957 8:6999680-6999702 GGTAGCACTCATTCTCACCTGGG - Intronic
1036233400 8:7018779-7018801 GGTAGCACTCAGTCTCACCTGGG - Intergenic
1037624902 8:20598120-20598142 GGTTGGACTCCATAACCTCTAGG + Intergenic
1042810251 8:72817470-72817492 TGTTTGACTCAATATTATCTCGG + Intronic
1045559820 8:103250250-103250272 ACTTGGACTAAATATCATCTAGG - Intergenic
1049931639 9:463061-463083 GGTTGGCTTCAGTATCCCCTGGG + Intronic
1050452505 9:5798129-5798151 TGGTGGAATCAAGATCACCTAGG - Intronic
1052840226 9:33286757-33286779 GGTTGGGCTTGAAATCACCTGGG + Intergenic
1060415218 9:123425259-123425281 TGTTGGGCTCAATATCTCCCCGG + Intronic
1060716768 9:125938523-125938545 GATTGGAATCAACATCACCAAGG + Intronic
1203756309 Un_GL000218v1:130622-130644 GGCTGGCATCAAAATCACCTGGG - Intergenic
1198618406 X:138481914-138481936 GGCTGGACTTAATATGTCCTTGG - Intergenic
1202337469 Y:23826802-23826824 GGTTGGGCTCAACAGGACCTTGG - Intergenic
1202533297 Y:25843269-25843291 GGTTGGGCTCAACAGGACCTTGG + Intergenic