ID: 1156285690

View in Genome Browser
Species Human (GRCh38)
Location 18:35693327-35693349
Sequence TTCACTCTATTCCAGACAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 163}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156285690_1156285694 21 Left 1156285690 18:35693327-35693349 CCAGTTGTCTGGAATAGAGTGAA 0: 1
1: 0
2: 0
3: 8
4: 163
Right 1156285694 18:35693371-35693393 ATAAGGTCAAAGACAAAGTGAGG 0: 1
1: 0
2: 2
3: 31
4: 363
1156285690_1156285695 22 Left 1156285690 18:35693327-35693349 CCAGTTGTCTGGAATAGAGTGAA 0: 1
1: 0
2: 0
3: 8
4: 163
Right 1156285695 18:35693372-35693394 TAAGGTCAAAGACAAAGTGAGGG 0: 1
1: 0
2: 3
3: 42
4: 395
1156285690_1156285693 4 Left 1156285690 18:35693327-35693349 CCAGTTGTCTGGAATAGAGTGAA 0: 1
1: 0
2: 0
3: 8
4: 163
Right 1156285693 18:35693354-35693376 GTGGAGAGTAGTAGAAGATAAGG 0: 1
1: 0
2: 6
3: 41
4: 300

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156285690 Original CRISPR TTCACTCTATTCCAGACAAC TGG (reversed) Intronic
906874601 1:49523500-49523522 TTCACTTGATTCCAAAAAACTGG + Intronic
909403950 1:75265202-75265224 TTCAAACTATTCCAGAAAATTGG + Intronic
910672506 1:89787136-89787158 TTCAGTCTATTCCAGTCCATTGG + Intronic
912671126 1:111626265-111626287 TTAACTCTATTTTAAACAACTGG - Intronic
914727386 1:150339339-150339361 TGCACTCTATCCTGGACAACAGG + Intronic
915510688 1:156385422-156385444 TTCATTCTCTCCCAGAAAACAGG + Intergenic
920607761 1:207406723-207406745 TTCACTCTATTCCCATCAAAAGG + Intergenic
922083260 1:222318980-222319002 CTCGCTCTATTCCAGACTAAAGG - Intergenic
922777518 1:228222784-228222806 GTCATTCTATTTCAGACAGCAGG + Intronic
1063423468 10:5933080-5933102 TTCACTCTTATGCATACAACTGG - Intronic
1066262677 10:33744432-33744454 GACACTCTGTTACAGACAACAGG - Intergenic
1067444497 10:46332269-46332291 TTCACTGTATTCATGACACCAGG + Intergenic
1067529613 10:47060698-47060720 CTCTCTCTGTTCCAGACAGCTGG - Intergenic
1067737898 10:48873070-48873092 TCCACTCTAGTTCAGGCAACTGG + Intronic
1067985917 10:51144819-51144841 TTCACTTAATTCCAGAAAATTGG - Intronic
1068058901 10:52041521-52041543 TTCAAACCATTCCAGATAACTGG - Intronic
1069134594 10:64748140-64748162 TTCACTCTATTCCATTCCATTGG + Intergenic
1070226976 10:74517651-74517673 TGCACTCTAGTCTAGGCAACTGG + Intronic
1073613107 10:104964281-104964303 TTCATTCTGTTCCAGCCTACTGG + Intronic
1073769480 10:106719855-106719877 CTCTCTCTATTCCAGCCACCTGG + Intronic
1074844520 10:117385486-117385508 CTGACTGTATTCCAGACAGCTGG - Intergenic
1075980012 10:126730231-126730253 CTCATTCTATTCAAGACATCAGG + Intergenic
1079888154 11:26015666-26015688 TTGACTGTATTCCAGACAAAGGG + Intergenic
1080970864 11:37275379-37275401 TTAGCTGTATTCCAGAAAACAGG - Intergenic
1082264875 11:50107662-50107684 TGCACTCCAGCCCAGACAACAGG + Intergenic
1082992175 11:59216650-59216672 TTCACTGTTTCCCAGAGAACTGG - Intergenic
1083176465 11:60952872-60952894 TTCACTCAAGTCCAGCCAGCCGG + Intergenic
1088459635 11:110069101-110069123 GTCACTCTTTTCCAGATAATGGG - Intergenic
1088647456 11:111928148-111928170 TTGAGTCTTTGCCAGACAACGGG - Intronic
1090200056 11:124847546-124847568 TTCACCCTAATACAAACAACTGG + Intergenic
1090382646 11:126337867-126337889 TTCACTCTATTCAGGACTATGGG - Intronic
1090555322 11:127868522-127868544 TTCACTCTATTTCAGAGAAATGG - Intergenic
1094675863 12:32619829-32619851 TTCTCTCTTTCCCAGACACCTGG - Exonic
1097735064 12:63173384-63173406 TTCACTCTTTTCCTGCCCACAGG - Intergenic
1100217301 12:92465433-92465455 TTCTCTGTATTCCAGACTCCTGG + Intergenic
1102931942 12:116869007-116869029 TGCACTCCAGCCCAGACAACAGG - Intronic
1107992046 13:45827247-45827269 TTGACTGTATTCAAGACAAATGG - Intronic
1108022541 13:46143330-46143352 TTTACTCTGTTCCAGTCAACAGG + Exonic
1108443861 13:50486425-50486447 TCCATTATAGTCCAGACAACAGG - Intronic
1108812952 13:54252216-54252238 TTCACTCTAAACCAGAGTACCGG - Intergenic
1109893881 13:68656468-68656490 ATAACTATATTCCAGTCAACTGG + Intergenic
1110856619 13:80303770-80303792 TTCAAACTATTCCAGAACACAGG - Intergenic
1111288210 13:86123643-86123665 TTGACTCTTTTGCAGTCAACTGG - Intergenic
1111311235 13:86489590-86489612 TTCAATATATTCAAGACAGCTGG + Intergenic
1111474346 13:88725582-88725604 TTCACTCCAGTCCACAGAACTGG - Intergenic
1113771701 13:112913808-112913830 TGCACTCCATTTCATACAACAGG + Intronic
1116960467 14:50963246-50963268 TTCAATCTATTCCAGCAAATGGG + Intergenic
1117863721 14:60122402-60122424 CTCACTCTATTCCAGCCTCCTGG + Intronic
1118089023 14:62451711-62451733 TTGTCTCTGTTCCAGGCAACAGG + Intergenic
1118657051 14:67963318-67963340 GTGACATTATTCCAGACAACTGG - Intronic
1120579058 14:86223598-86223620 TTAACTCTACTCCAGCCTACTGG - Intergenic
1122080079 14:99261041-99261063 TTCACCCGATTCCAAAGAACGGG + Intronic
1125297645 15:38220624-38220646 TTCAGCCTTTTCCAGGCAACAGG - Intergenic
1126234855 15:46371823-46371845 TTTACTTTCTTCCAGAAAACTGG - Intergenic
1126283972 15:46989650-46989672 TTCACTTTACTACAGAAAACTGG + Intergenic
1126599738 15:50417074-50417096 TTCACTCTATGCCAGCCATATGG + Intergenic
1130956789 15:88632531-88632553 TGCACTCTAGCCCAGGCAACAGG - Intergenic
1132460245 16:49673-49695 TGCACTCTAGCCCAGGCAACAGG - Intronic
1137265704 16:46867502-46867524 TGCACTCCAGTCCAGGCAACAGG + Intergenic
1137400128 16:48146469-48146491 TTCACTCTATGGCAGAGAAATGG + Exonic
1137689922 16:50417511-50417533 TTCACTATATTCCATACATTTGG + Intergenic
1138163496 16:54777946-54777968 TTCTGTCTATTCTAAACAACTGG - Intergenic
1138512963 16:57519156-57519178 TTCACTGTACTCCAGGCACCAGG + Intronic
1146212092 17:30950670-30950692 GGGACCCTATTCCAGACAACTGG - Intronic
1148922414 17:51050610-51050632 ATCATTTTATTCCAGACATCAGG - Intronic
1149215700 17:54351480-54351502 TTCATCCAAATCCAGACAACAGG + Intergenic
1151195543 17:72428976-72428998 TTCAATCTAATTCAGACACCAGG + Intergenic
1153008985 18:520806-520828 TTCCCTCTATGCCACACAAAGGG - Intergenic
1156285690 18:35693327-35693349 TTCACTCTATTCCAGACAACTGG - Intronic
1156803193 18:41143670-41143692 TTCACTCCATTCTGGACCACAGG - Intergenic
1156882447 18:42096626-42096648 TTCACTCTATTGCTCACACCAGG - Intergenic
1156986353 18:43355306-43355328 CTCAGTCTGTTCCAGACATCAGG + Intergenic
1157953565 18:52068465-52068487 TTCACTCATTGACAGACAACTGG - Intergenic
1159934523 18:74351955-74351977 ATCACTCTTTTACAGACAACAGG + Intronic
1161503812 19:4633198-4633220 CTCACTCTATTCCAGCCACATGG - Intergenic
1164960049 19:32420230-32420252 TTGACTCTATTGCAGAAGACTGG - Intronic
928607233 2:32954069-32954091 TTAACCCTATTCCAGACAGTGGG + Intronic
935797707 2:106661383-106661405 TTCATTCTACTCCAAACAAGAGG + Intergenic
935957148 2:108388524-108388546 TTCTCTCTATTTCAGACAGATGG + Intergenic
937044145 2:118842185-118842207 TACACTTTATTTCAGACTACAGG + Exonic
938208914 2:129448280-129448302 ATCACTTTATTCCTTACAACAGG + Intergenic
938572962 2:132578410-132578432 TACAATCTATTCCAGAAAAGAGG - Intronic
940392345 2:153146971-153146993 TTCACTTTATTCCAGAAGCCAGG + Intergenic
941432037 2:165424734-165424756 TCTACTCTATTCCAAAAAACAGG - Intergenic
941733267 2:168943984-168944006 TTCACTTTAATCCAAACACCTGG + Intronic
942350403 2:175046591-175046613 TTCAAACTATTCCAGAAAATGGG - Intergenic
943740682 2:191404622-191404644 TTCACTTTATTGCAGAGATCTGG - Intronic
1170460045 20:16568782-16568804 TGCACTCTAGCCTAGACAACAGG + Intronic
1172975900 20:38905846-38905868 TTCATTCTATTCCATTCTACTGG + Intronic
1173012987 20:39199441-39199463 TTCACTCTCTTACAGTCCACTGG - Intergenic
1177482735 21:21712697-21712719 ATCACACAATTCCAGAAAACTGG + Intergenic
1177577670 21:22979533-22979555 TTTACTCTATAACACACAACTGG + Intergenic
1185363589 22:50423875-50423897 GTCACTCTATTCCATCAAACCGG - Intronic
953408251 3:42671090-42671112 TACACCCTCTTCCATACAACAGG + Intergenic
956523485 3:70131465-70131487 TTCACCCTGCCCCAGACAACTGG - Intergenic
957269811 3:78015042-78015064 TTCACTTTATTACAGACTTCAGG + Intergenic
957273368 3:78059563-78059585 ATCATTATATTCCAGACACCTGG + Intergenic
960710828 3:120526303-120526325 TTTATTCTTTTACAGACAACAGG + Intergenic
962779957 3:138703963-138703985 TTTACTATATTCCAGCCAGCAGG - Intronic
963311230 3:143712439-143712461 TTCATTCTATGCCAAGCAACTGG - Intronic
963345664 3:144094321-144094343 TTCTCTATGTTCCAAACAACAGG + Intergenic
964479924 3:157130242-157130264 TTCGCTCTCTTCCTGACCACAGG - Intergenic
969129474 4:4981072-4981094 TTCTCCCTCTTCCAGAAAACTGG + Intergenic
969204634 4:5634235-5634257 GTCACTCTATTACAGAGAAATGG + Intronic
972003836 4:34073112-34073134 TTCACTCTGTTGCAGTCATCAGG + Intergenic
973663004 4:53127172-53127194 TTCACTATATTTCAAACAATGGG + Intronic
973675767 4:53260772-53260794 TTGACACTATTCCACACAATAGG - Intronic
974100284 4:57408950-57408972 TTCAGTCTATCCCAGGCAATGGG - Intergenic
974591878 4:63960924-63960946 TTCACTCTATGACAGGTAACTGG - Intergenic
974928898 4:68337823-68337845 TTCTGTCCATTCTAGACAACTGG - Exonic
975822464 4:78285831-78285853 TTCACTGTATCCTAGACATCAGG - Intronic
976922664 4:90457742-90457764 TTCACTCTGCTCCAAGCAACTGG + Intronic
979410695 4:120375312-120375334 TTCTCTCTACTCCAAACATCTGG + Intergenic
979878712 4:125927995-125928017 GTCACTCAATTTCAGACAGCTGG - Intergenic
980163613 4:129197838-129197860 TTCACTCTTCTCAAGACCACTGG - Intergenic
980397372 4:132232031-132232053 ATGACTCCATTCCAGACAATGGG + Intergenic
980893522 4:138839339-138839361 ATCATTCTATTCCATAAAACCGG + Intergenic
981889208 4:149716009-149716031 CTCACTCTAGTCCACAGAACTGG + Intergenic
982412082 4:155089829-155089851 TCCTCTCTGTTCCAAACAACAGG - Intergenic
982717006 4:158819464-158819486 TTCACTATACTCCTGACCACAGG + Intronic
982746285 4:159106076-159106098 TTTACTCTATTCTACACAACTGG - Intronic
983858566 4:172675748-172675770 TTCACTATATACAAGACACCGGG + Intronic
985589976 5:759548-759570 TCCAATCCATTCCACACAACAGG + Intronic
988339547 5:29952223-29952245 TTCACATTACTACAGACAACAGG - Intergenic
988699343 5:33657913-33657935 TCCATTCTAATCCAGAGAACTGG + Intronic
990144321 5:52741886-52741908 TTCACTCTATGCTAGACATTTGG + Intergenic
994406558 5:99352637-99352659 TTCACTCCAGTCCACAGAACTGG + Intergenic
996498160 5:124186010-124186032 GCCATTCTATTCCTGACAACAGG + Intergenic
997993197 5:138563573-138563595 TCCACTCTACTCCAGCCAAAGGG + Intronic
999588348 5:153116484-153116506 TTAAGTCTATTCCAGACCAGAGG + Intergenic
1000415052 5:160975688-160975710 TTCACTCTTTTCTAGCCACCTGG + Intergenic
1003394017 6:5737573-5737595 CTCACACTATTCCAGAAAGCAGG - Intronic
1008339774 6:50350384-50350406 TTCATTCTATTGGAGAAAACTGG - Intergenic
1009715339 6:67385595-67385617 TTCATTCTAATCCAGAAAATAGG - Intergenic
1010562723 6:77370329-77370351 TTCTCTCCATTCCAGAAAATGGG - Intergenic
1011248889 6:85349352-85349374 ATAACTCTATTCCAGAAATCAGG + Intergenic
1011848649 6:91598744-91598766 TTCACTCTAATTAAGACAGCTGG - Intergenic
1014200036 6:118598949-118598971 TTGACTCTAATCCAGACAGCAGG - Intronic
1016761017 6:147737702-147737724 TCCACTCTATTCCAGCCCAGGGG - Intergenic
1018057746 6:160067149-160067171 TTCACTCTGTTCCAGCCACACGG + Intronic
1018582724 6:165321407-165321429 CTCACTCTATCCCAGCCACCAGG - Intergenic
1019832060 7:3340957-3340979 TTCAGTCTCTTCTAGAAAACAGG + Intronic
1020234624 7:6346239-6346261 TTCACTCAATTCAAGCCACCTGG + Intronic
1021350257 7:19584476-19584498 TTCACTCATTAACAGACAACTGG - Intergenic
1024464454 7:49696931-49696953 TTCACCCCCTTCCAGACAAATGG - Intergenic
1024621864 7:51166551-51166573 TTCAAACTATTCCAAAAAACAGG + Intronic
1024895695 7:54259362-54259384 TTCACCCCATTCAGGACAACTGG - Intergenic
1025228034 7:57180465-57180487 CTCACTCTATTGCATCCAACAGG - Intergenic
1027747483 7:82095423-82095445 TTCACTATATTCTAGGCATCAGG - Intronic
1040465318 8:47689519-47689541 TTTACTCTATGCCATACAACTGG + Intronic
1043997185 8:86832573-86832595 TTCACTCTGTCCCACACCACAGG + Intergenic
1044011741 8:87002495-87002517 TTCATTCTATTCCAGGCATGTGG + Intronic
1046700704 8:117397472-117397494 TTCAGTCTACCCCAGACACCAGG + Intergenic
1047653475 8:126949544-126949566 TTCCCTCATTTCCAGGCAACAGG - Intergenic
1048226487 8:132592104-132592126 TTCACTCAATTTCAATCAACAGG + Intronic
1048261058 8:132945383-132945405 TTCATTCTTTGCCACACAACAGG - Intronic
1051250047 9:15150444-15150466 TTCTCCCTATTCCTGCCAACTGG - Intergenic
1051277227 9:15408139-15408161 TTTACCCTATTTAAGACAACAGG - Intergenic
1051875582 9:21790026-21790048 TACACTCTATTTGAGATAACTGG + Intergenic
1057785701 9:98086055-98086077 GTCACTTCATTCCAGACAGCTGG + Exonic
1187351984 X:18527286-18527308 TACAATCTCTTCCAGACAACAGG - Intronic
1187781679 X:22833523-22833545 TCCACTATATGCCAGACACCAGG + Intergenic
1188034447 X:25301304-25301326 CTCACTCTATTCAAGAACACTGG - Intergenic
1192087125 X:68111473-68111495 TTCATCCTAATCCACACAACTGG + Intronic
1194827243 X:98578344-98578366 TTGCCTCTATTCCAGGCAAGGGG + Intergenic
1194947146 X:100082770-100082792 CTCACTCCATTCCAAAGAACTGG + Intergenic
1196137104 X:112221928-112221950 TTCACTGTGTTGTAGACAACAGG + Intergenic
1196716969 X:118821693-118821715 TTCACTCACTTCCAAACATCAGG + Intergenic
1196814665 X:119655305-119655327 TTTACTATGTTCCAGACAGCAGG - Intronic
1198068356 X:133122567-133122589 CTCACTCCATTCCAGACACAGGG + Intergenic
1201216855 Y:11730410-11730432 TTCATTCTATTCCATTCCACTGG - Intergenic
1202085673 Y:21134209-21134231 TTCACTCTATTCAGGAAAAGTGG - Intergenic