ID: 1156294683

View in Genome Browser
Species Human (GRCh38)
Location 18:35778745-35778767
Sequence CAGCTGAGACTGCTGAAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156294683_1156294687 1 Left 1156294683 18:35778745-35778767 CCCTTCTTCAGCAGTCTCAGCTG No data
Right 1156294687 18:35778769-35778791 TCCCTGGGTCTCCGTTTCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156294683 Original CRISPR CAGCTGAGACTGCTGAAGAA GGG (reversed) Intergenic
No off target data available for this crispr