ID: 1156294687

View in Genome Browser
Species Human (GRCh38)
Location 18:35778769-35778791
Sequence TCCCTGGGTCTCCGTTTCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156294681_1156294687 19 Left 1156294681 18:35778727-35778749 CCTGTTCTGGAGATACACCCCTT No data
Right 1156294687 18:35778769-35778791 TCCCTGGGTCTCCGTTTCCCAGG No data
1156294680_1156294687 20 Left 1156294680 18:35778726-35778748 CCCTGTTCTGGAGATACACCCCT No data
Right 1156294687 18:35778769-35778791 TCCCTGGGTCTCCGTTTCCCAGG No data
1156294682_1156294687 2 Left 1156294682 18:35778744-35778766 CCCCTTCTTCAGCAGTCTCAGCT No data
Right 1156294687 18:35778769-35778791 TCCCTGGGTCTCCGTTTCCCAGG No data
1156294683_1156294687 1 Left 1156294683 18:35778745-35778767 CCCTTCTTCAGCAGTCTCAGCTG No data
Right 1156294687 18:35778769-35778791 TCCCTGGGTCTCCGTTTCCCAGG No data
1156294679_1156294687 21 Left 1156294679 18:35778725-35778747 CCCCTGTTCTGGAGATACACCCC No data
Right 1156294687 18:35778769-35778791 TCCCTGGGTCTCCGTTTCCCAGG No data
1156294684_1156294687 0 Left 1156294684 18:35778746-35778768 CCTTCTTCAGCAGTCTCAGCTGC No data
Right 1156294687 18:35778769-35778791 TCCCTGGGTCTCCGTTTCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156294687 Original CRISPR TCCCTGGGTCTCCGTTTCCC AGG Intergenic
No off target data available for this crispr