ID: 1156298222

View in Genome Browser
Species Human (GRCh38)
Location 18:35811852-35811874
Sequence ATGGAAGAATGGTGAGAAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156298218_1156298222 13 Left 1156298218 18:35811816-35811838 CCAAACAGATATAAAGTAATTAT No data
Right 1156298222 18:35811852-35811874 ATGGAAGAATGGTGAGAAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156298222 Original CRISPR ATGGAAGAATGGTGAGAAAT GGG Intergenic
No off target data available for this crispr