ID: 1156317315

View in Genome Browser
Species Human (GRCh38)
Location 18:35982257-35982279
Sequence AAAAATCTCAAGTTGGGGCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156317315_1156317321 -6 Left 1156317315 18:35982257-35982279 CCCGGCCCCAACTTGAGATTTTT No data
Right 1156317321 18:35982274-35982296 ATTTTTTTTAACATTATGATGGG No data
1156317315_1156317322 3 Left 1156317315 18:35982257-35982279 CCCGGCCCCAACTTGAGATTTTT No data
Right 1156317322 18:35982283-35982305 AACATTATGATGGGTTTACCAGG No data
1156317315_1156317320 -7 Left 1156317315 18:35982257-35982279 CCCGGCCCCAACTTGAGATTTTT No data
Right 1156317320 18:35982273-35982295 GATTTTTTTTAACATTATGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156317315 Original CRISPR AAAAATCTCAAGTTGGGGCC GGG (reversed) Intergenic
No off target data available for this crispr