ID: 1156317318

View in Genome Browser
Species Human (GRCh38)
Location 18:35982263-35982285
Sequence GTTAAAAAAAATCTCAAGTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156317318_1156317322 -3 Left 1156317318 18:35982263-35982285 CCCAACTTGAGATTTTTTTTAAC No data
Right 1156317322 18:35982283-35982305 AACATTATGATGGGTTTACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156317318 Original CRISPR GTTAAAAAAAATCTCAAGTT GGG (reversed) Intergenic
No off target data available for this crispr