ID: 1156317319

View in Genome Browser
Species Human (GRCh38)
Location 18:35982264-35982286
Sequence TGTTAAAAAAAATCTCAAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156317319_1156317322 -4 Left 1156317319 18:35982264-35982286 CCAACTTGAGATTTTTTTTAACA No data
Right 1156317322 18:35982283-35982305 AACATTATGATGGGTTTACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156317319 Original CRISPR TGTTAAAAAAAATCTCAAGT TGG (reversed) Intergenic
No off target data available for this crispr