ID: 1156317322

View in Genome Browser
Species Human (GRCh38)
Location 18:35982283-35982305
Sequence AACATTATGATGGGTTTACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156317317_1156317322 -2 Left 1156317317 18:35982262-35982284 CCCCAACTTGAGATTTTTTTTAA No data
Right 1156317322 18:35982283-35982305 AACATTATGATGGGTTTACCAGG No data
1156317319_1156317322 -4 Left 1156317319 18:35982264-35982286 CCAACTTGAGATTTTTTTTAACA No data
Right 1156317322 18:35982283-35982305 AACATTATGATGGGTTTACCAGG No data
1156317313_1156317322 13 Left 1156317313 18:35982247-35982269 CCACACCGTGCCCGGCCCCAACT No data
Right 1156317322 18:35982283-35982305 AACATTATGATGGGTTTACCAGG No data
1156317315_1156317322 3 Left 1156317315 18:35982257-35982279 CCCGGCCCCAACTTGAGATTTTT No data
Right 1156317322 18:35982283-35982305 AACATTATGATGGGTTTACCAGG No data
1156317316_1156317322 2 Left 1156317316 18:35982258-35982280 CCGGCCCCAACTTGAGATTTTTT No data
Right 1156317322 18:35982283-35982305 AACATTATGATGGGTTTACCAGG No data
1156317314_1156317322 8 Left 1156317314 18:35982252-35982274 CCGTGCCCGGCCCCAACTTGAGA No data
Right 1156317322 18:35982283-35982305 AACATTATGATGGGTTTACCAGG No data
1156317318_1156317322 -3 Left 1156317318 18:35982263-35982285 CCCAACTTGAGATTTTTTTTAAC No data
Right 1156317322 18:35982283-35982305 AACATTATGATGGGTTTACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156317322 Original CRISPR AACATTATGATGGGTTTACC AGG Intergenic
No off target data available for this crispr