ID: 1156327114

View in Genome Browser
Species Human (GRCh38)
Location 18:36084971-36084993
Sequence ACAGCAGCGGCCACTCTAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156327114_1156327122 -2 Left 1156327114 18:36084971-36084993 CCATCTAGAGTGGCCGCTGCTGT No data
Right 1156327122 18:36084992-36085014 GTCACATGGGCTACAGAGGGGGG No data
1156327114_1156327126 8 Left 1156327114 18:36084971-36084993 CCATCTAGAGTGGCCGCTGCTGT No data
Right 1156327126 18:36085002-36085024 CTACAGAGGGGGGGCGCGGGTGG No data
1156327114_1156327127 14 Left 1156327114 18:36084971-36084993 CCATCTAGAGTGGCCGCTGCTGT No data
Right 1156327127 18:36085008-36085030 AGGGGGGGCGCGGGTGGTAGCGG No data
1156327114_1156327120 -4 Left 1156327114 18:36084971-36084993 CCATCTAGAGTGGCCGCTGCTGT No data
Right 1156327120 18:36084990-36085012 CTGTCACATGGGCTACAGAGGGG No data
1156327114_1156327124 4 Left 1156327114 18:36084971-36084993 CCATCTAGAGTGGCCGCTGCTGT No data
Right 1156327124 18:36084998-36085020 TGGGCTACAGAGGGGGGGCGCGG No data
1156327114_1156327128 18 Left 1156327114 18:36084971-36084993 CCATCTAGAGTGGCCGCTGCTGT No data
Right 1156327128 18:36085012-36085034 GGGGCGCGGGTGGTAGCGGCAGG No data
1156327114_1156327119 -5 Left 1156327114 18:36084971-36084993 CCATCTAGAGTGGCCGCTGCTGT No data
Right 1156327119 18:36084989-36085011 GCTGTCACATGGGCTACAGAGGG No data
1156327114_1156327123 -1 Left 1156327114 18:36084971-36084993 CCATCTAGAGTGGCCGCTGCTGT No data
Right 1156327123 18:36084993-36085015 TCACATGGGCTACAGAGGGGGGG No data
1156327114_1156327125 5 Left 1156327114 18:36084971-36084993 CCATCTAGAGTGGCCGCTGCTGT No data
Right 1156327125 18:36084999-36085021 GGGCTACAGAGGGGGGGCGCGGG No data
1156327114_1156327121 -3 Left 1156327114 18:36084971-36084993 CCATCTAGAGTGGCCGCTGCTGT No data
Right 1156327121 18:36084991-36085013 TGTCACATGGGCTACAGAGGGGG No data
1156327114_1156327118 -6 Left 1156327114 18:36084971-36084993 CCATCTAGAGTGGCCGCTGCTGT No data
Right 1156327118 18:36084988-36085010 TGCTGTCACATGGGCTACAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156327114 Original CRISPR ACAGCAGCGGCCACTCTAGA TGG (reversed) Intergenic
No off target data available for this crispr