ID: 1156331700

View in Genome Browser
Species Human (GRCh38)
Location 18:36129461-36129483
Sequence GCGCCACGCCCCCGCGGCGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 98
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 89}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156331700_1156331707 5 Left 1156331700 18:36129461-36129483 CCGACGCCGCGGGGGCGTGGCGC 0: 1
1: 0
2: 0
3: 8
4: 89
Right 1156331707 18:36129489-36129511 TAGCGCATTGTAAGCAGTTGGGG 0: 1
1: 0
2: 0
3: 5
4: 45
1156331700_1156331705 3 Left 1156331700 18:36129461-36129483 CCGACGCCGCGGGGGCGTGGCGC 0: 1
1: 0
2: 0
3: 8
4: 89
Right 1156331705 18:36129487-36129509 CCTAGCGCATTGTAAGCAGTTGG 0: 1
1: 0
2: 1
3: 4
4: 64
1156331700_1156331709 20 Left 1156331700 18:36129461-36129483 CCGACGCCGCGGGGGCGTGGCGC 0: 1
1: 0
2: 0
3: 8
4: 89
Right 1156331709 18:36129504-36129526 AGTTGGGGGTCATTTCCTCGAGG 0: 1
1: 0
2: 2
3: 4
4: 80
1156331700_1156331708 6 Left 1156331700 18:36129461-36129483 CCGACGCCGCGGGGGCGTGGCGC 0: 1
1: 0
2: 0
3: 8
4: 89
Right 1156331708 18:36129490-36129512 AGCGCATTGTAAGCAGTTGGGGG 0: 1
1: 0
2: 0
3: 2
4: 89
1156331700_1156331706 4 Left 1156331700 18:36129461-36129483 CCGACGCCGCGGGGGCGTGGCGC 0: 1
1: 0
2: 0
3: 8
4: 89
Right 1156331706 18:36129488-36129510 CTAGCGCATTGTAAGCAGTTGGG 0: 1
1: 0
2: 0
3: 3
4: 49

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156331700 Original CRISPR GCGCCACGCCCCCGCGGCGT CGG (reversed) Intronic
900113550 1:1019604-1019626 GCGCCCCTCCCCCGCGGGGCCGG - Intergenic
900349195 1:2227073-2227095 GCTCCACGGCCCCGGGGCGGAGG + Intergenic
900527067 1:3134553-3134575 GCTCCACGCGCCCTCGGAGTAGG - Intronic
901086176 1:6613657-6613679 GCGCCACGCCCCCTCGCCGCTGG + Intronic
901797938 1:11691490-11691512 GCCCCGCGCCCTCGCGGCGGCGG + Exonic
903233870 1:21937346-21937368 CCGCCCCGCCCCCGCAGCGCCGG + Intergenic
903324776 1:22563587-22563609 GCGCCACGCACCCTCGGGCTTGG - Exonic
916792449 1:168136482-168136504 GCGCCCCTCCCCTGCGGCCTGGG - Intronic
920528376 1:206684992-206685014 GCGCCAGGCCCCCGGGGGGAGGG + Intronic
1065239858 10:23694677-23694699 GCGCCGCTCCTCCGCGGGGTGGG + Intergenic
1070800840 10:79243568-79243590 GCTCCGCGCCCCGGCGGCGGCGG - Intronic
1073812374 10:107164734-107164756 GCTCCACCCCCGCGCGGCGGCGG - Intergenic
1077134909 11:993681-993703 GCAGCACGCCCCCGCGGGGGGGG - Intronic
1077837716 11:5938781-5938803 TCACCAGGGCCCCGCGGCGTAGG - Intergenic
1083680817 11:64351162-64351184 GCGCCAGGGCCCCGCGGGGCTGG + Exonic
1083936517 11:65872565-65872587 GCCCCGCGCCCCTGCGGCGAAGG + Intronic
1084212207 11:67629496-67629518 GCGCCACGTCCTCGCCGCGTGGG - Intronic
1090013260 11:123062917-123062939 CCGCCAGGCCGCCGCGGGGTGGG + Intronic
1091207928 11:133833599-133833621 GCGCCGCGCGGCCGCGGAGTGGG - Intergenic
1102519840 12:113471500-113471522 GCCCCGCGCCCCGGCGGCTTCGG + Exonic
1103604879 12:122079017-122079039 GCGCCGCGCCACCGCCGCCTCGG + Exonic
1103935014 12:124471012-124471034 GGGCCGGGCCCCAGCGGCGTGGG - Intronic
1106720084 13:32427781-32427803 GCGGCAGGCACCCGCGGCGGGGG + Intronic
1109616611 13:64842310-64842332 GCGCCACGGCCCTGCAGCCTGGG - Intergenic
1110219526 13:73058952-73058974 GGGCCCCGCCCCCCCGGAGTTGG + Exonic
1111672625 13:91348577-91348599 GCGCCACCCCCGCTCCGCGTGGG + Intergenic
1113254842 13:108495695-108495717 GCGACCCGCAGCCGCGGCGTCGG - Intergenic
1117803046 14:59464684-59464706 GCGCCAGGGCCCCGCGGCGGCGG + Exonic
1122635387 14:103127305-103127327 CGGCCACGCGCCCGCGGCGCTGG + Exonic
1122689044 14:103522918-103522940 GCGGCACCACCCCGCGGCGCGGG - Exonic
1125594233 15:40874063-40874085 GCGCTACGCCGCCGCGGGGGAGG + Exonic
1129189248 15:73927793-73927815 CCGACACGCCCCCGCCGGGTGGG + Exonic
1132734718 16:1379692-1379714 GCGCCCCGCCCCCTCCGCGCTGG + Intronic
1132889546 16:2196913-2196935 GCCCCGCGCCGCCGCCGCGTCGG - Intergenic
1137618154 16:49858724-49858746 CCCCCACGCCCCCGCGGCCCAGG + Intergenic
1145210687 17:21011114-21011136 GAGACACGCCCCCGCCGTGTGGG + Intronic
1145815738 17:27793772-27793794 TCGCCCCGCCCCCGGGGCGGGGG - Intronic
1146654429 17:34626764-34626786 GCTCCACGCCCCTGATGCGTCGG + Intronic
1152468242 17:80477290-80477312 GCGCCCCGCCCGCACGGGGTGGG - Intronic
1153805559 18:8706162-8706184 GCGCCACCCGCCCGCACCGTCGG + Intronic
1156331700 18:36129461-36129483 GCGCCACGCCCCCGCGGCGTCGG - Intronic
1157529531 18:48409493-48409515 GCGCCCCGCGCCCGCGCCGCCGG + Intronic
1157761515 18:50268691-50268713 ACCCCCCGCCCCCGCGGCCTAGG + Intronic
1160548617 18:79679259-79679281 CCCCCAAGCTCCCGCGGCGTGGG + Intergenic
1160813780 19:1026346-1026368 GTGCCACGTCCCGGCGGCCTCGG + Intergenic
1160969837 19:1762652-1762674 GGACCACGCGCCCGCGGCCTTGG + Intronic
1161573406 19:5042455-5042477 GCGCCACTGCCCCGCAGCCTGGG + Intronic
1161698468 19:5783005-5783027 GCGCCACTCCCCCGGGGCCCAGG - Exonic
1161851762 19:6740863-6740885 GCGCCACGCCGGGGCGGCGCCGG + Intronic
1162464280 19:10831076-10831098 GCCTCACGCACCCGCGGCGCAGG + Exonic
1165886715 19:39084167-39084189 GCGCCACGCCCTGGTGGGGTGGG + Intronic
924962368 2:46287-46309 GCGCGCCGGCCGCGCGGCGTCGG + Exonic
927168581 2:20350322-20350344 GCCCCACGCCCCCGAGGCGGCGG + Intronic
928511775 2:32010094-32010116 GCGGCCCGGCCCCGCGGCGGCGG - Intronic
930011450 2:46941145-46941167 TCCCCACGCCCCCGCGGGGGTGG + Intronic
934754623 2:96816549-96816571 GCGCCACTCGCCCGCGGGGGAGG - Exonic
944692606 2:202171425-202171447 GCTCCGGGTCCCCGCGGCGTCGG + Intronic
947874695 2:233460409-233460431 GCTCCACGCCCCAGGGGCCTTGG - Intronic
1168814557 20:728079-728101 GGGACACACCCCCGCCGCGTGGG + Intergenic
1173626334 20:44475806-44475828 GCGACGCCTCCCCGCGGCGTTGG - Intergenic
1174002501 20:47385181-47385203 GAGCAAAGCCCCCGGGGCGTGGG + Intergenic
1175877759 20:62238537-62238559 CCGCCCCGCCCCCGCCCCGTAGG - Exonic
1177011120 21:15730572-15730594 GCGCGACGCCCCCGAGGCGATGG - Intronic
1180791411 22:18577491-18577513 GCGCCAGGCCCAGGCGGCGCGGG - Intergenic
1181230328 22:21417820-21417842 GCGCCAGGCCCAGGCGGCGCGGG + Intronic
1181248322 22:21517043-21517065 GCGCCAGGCCCAGGCGGCGCGGG - Intergenic
1183665529 22:39244010-39244032 GCGCGCCGCCCCCGCGGCCAGGG + Exonic
1183809140 22:40239158-40239180 GCGCCACGGCACTGCAGCGTGGG + Intronic
1184802238 22:46768440-46768462 GCGCCACCGCCCCGCAGCCTGGG + Intronic
1184831877 22:46993931-46993953 GCGCCTCGCCCTCGGGGGGTGGG + Intronic
950912162 3:16605551-16605573 ACCCTACGCCCCCGCCGCGTGGG - Intronic
952867235 3:37862132-37862154 GCGCCGCGCCCCCGCGCGCTTGG + Intronic
953646640 3:44761682-44761704 GGGCCACGCCCCCGATGCGTAGG + Intergenic
955916388 3:63912317-63912339 GCGGCCCGCCACCGCGGCGCTGG - Intronic
969285433 4:6199729-6199751 GGGCCGCGCCCCGGCGGCGCGGG - Intronic
969788240 4:9474616-9474638 GCGCCCCGCCCCCGTGCCATGGG - Intergenic
969912131 4:10456968-10456990 GCGCCGCGACCCCGCGGACTCGG - Intronic
971230842 4:24799481-24799503 GCGGGACGCCCCCGCGGAGGTGG - Intronic
972607737 4:40629809-40629831 GCGCCGCGTCCCGGCTGCGTGGG + Intronic
980053644 4:128060995-128061017 GCGGCCTGCCCCCGCGGCGACGG - Intergenic
991054385 5:62306155-62306177 GCGCCCCGCCTCCCCAGCGTCGG + Intronic
991435851 5:66596609-66596631 GCGCCGCGCCCCCGCCGCTCGGG + Exonic
999768180 5:154756074-154756096 GCGCCCCGCGCCCGCGGCTCCGG - Intronic
1002059845 5:176619889-176619911 GCCCCATGCCGCCGCAGCGTTGG - Intergenic
1004660579 6:17706244-17706266 CCGCCAGGCCACCGCGGCGTCGG + Intronic
1011281147 6:85678992-85679014 GCGCCACACCCGCGCCACGTAGG - Intergenic
1011640327 6:89411819-89411841 GCGCCCGGCCCCCGCGTCCTCGG - Intronic
1021689053 7:23214504-23214526 GGGCCTCACCCCCGCGGCGATGG - Intergenic
1034446088 7:151115019-151115041 GCGCCAGGCCCCGGCGGCCGAGG - Intronic
1035266309 7:157691941-157691963 GCGCGGCGCCCCCGCGGAGCTGG + Intronic
1036658089 8:10690659-10690681 GCGCCACACCCCTGCGGGGCTGG - Intronic
1044306401 8:90645749-90645771 TCGCCCCGCCCCCGCGGGGAAGG + Exonic
1048981129 8:139703808-139703830 GCGCCCCGCTCCCGCGCCTTGGG - Intergenic
1055315180 9:75027899-75027921 CCGCCACGCCTCCGAGGCGTCGG - Intronic
1061073008 9:128323160-128323182 GCGCCTCGCCCCCGTGGGGGCGG + Intronic
1061472037 9:130834948-130834970 GCGCAACTCCACCGCGGCCTGGG - Intronic
1186410754 X:9342756-9342778 GCGCCCCGCCCCCACGCCGCCGG + Intergenic
1200279362 X:154763256-154763278 GTCCCACGCCACCGCGGGGTGGG - Intronic