ID: 1156332616

View in Genome Browser
Species Human (GRCh38)
Location 18:36138332-36138354
Sequence CAGGATCTGATGTCCTCCTC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 167}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156332616_1156332618 30 Left 1156332616 18:36138332-36138354 CCAGAGGAGGACATCAGATCCTG 0: 1
1: 0
2: 0
3: 20
4: 167
Right 1156332618 18:36138385-36138407 CAGATTCTGCTGTTCGACTCTGG 0: 1
1: 0
2: 0
3: 4
4: 77

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156332616 Original CRISPR CAGGATCTGATGTCCTCCTC TGG (reversed) Exonic
904208781 1:28872158-28872180 CAGGCTCTGGTGGCCTCCTAAGG - Intergenic
904603941 1:31688910-31688932 CAGCATCTTGTGTCCTCCACAGG - Exonic
904758198 1:32781088-32781110 CGGGATGGGATGACCTCCTCTGG + Exonic
905319764 1:37107549-37107571 CAGTAGCTGGTGGCCTCCTCTGG - Intergenic
905394458 1:37658030-37658052 AGGGATCTGCTGTCATCCTCAGG - Intergenic
905938094 1:41840711-41840733 CAGGATCTGATGGGCTCCGTGGG - Intronic
907247409 1:53116879-53116901 CAGGTTCTGATTTCTTCCTGTGG - Intronic
907659579 1:56379498-56379520 CAGAATCTGGTGTTCTCCTCTGG - Intergenic
909163157 1:72180856-72180878 CAGATTCTGACTTCCTCCTCTGG + Intronic
912144346 1:106773575-106773597 CAGGAGGTGATGTCCACCACTGG - Intergenic
915527747 1:156486467-156486489 CAGGAACTGCTGAGCTCCTCTGG + Intronic
916723148 1:167500365-167500387 CAAGATCTGATGTCCTGTTAAGG - Intronic
920123169 1:203673826-203673848 CAGGATCTGGTGGAGTCCTCAGG - Intronic
920225081 1:204432595-204432617 CAGGGTCTTATCTCCTCCCCTGG + Intronic
920678763 1:208057176-208057198 CAGGATCTCATGCCATCCTCAGG + Intronic
921281452 1:213571887-213571909 CAGAATCTCAGGCCCTCCTCCGG - Intergenic
924325516 1:242890746-242890768 CAGGACGTGGTCTCCTCCTCCGG + Intergenic
924756952 1:246950086-246950108 CAGGAACTCATGACCTCCTTTGG - Intronic
1067355398 10:45519968-45519990 CAGGTGCTGTTGTCCTCCTCAGG - Intronic
1070790926 10:79188881-79188903 CTGCATCTTCTGTCCTCCTCTGG - Intronic
1072705550 10:97678374-97678396 CAGGACCTGATGACCTCCAAAGG + Intronic
1073931548 10:108582615-108582637 CAGGATCTGACTCACTCCTCAGG + Intergenic
1075001010 10:118797697-118797719 CAGGTTCTGAAGTTGTCCTCAGG - Intergenic
1076297655 10:129399428-129399450 TAGGATCTAATTTTCTCCTCTGG + Intergenic
1076502630 10:130949352-130949374 CAGAACCTCATGTGCTCCTCTGG + Intergenic
1076828996 10:132985003-132985025 CAGGATCTGCTGACCCCCACAGG - Intergenic
1079138182 11:17788305-17788327 CAGGCTCTGCTGTCATCGTCAGG - Exonic
1083788784 11:64970960-64970982 CAGGAACTAAAGTGCTCCTCTGG - Intronic
1083795564 11:65014599-65014621 CCGGCTCTGATCTCCTCCCCCGG + Intronic
1083961419 11:66016867-66016889 CTGTATCTGGTGTCCTCCTGGGG + Exonic
1084589273 11:70080695-70080717 CAGGAGCTGATGGTCTCATCTGG - Intronic
1087266402 11:96066344-96066366 CAGGAGCTTCTGTCCTCCCCTGG - Intronic
1089812921 11:121146343-121146365 CATGATCTTATTTCATCCTCAGG - Intronic
1092722034 12:11450858-11450880 CAGAATCTGATGTCATTCTCTGG - Intronic
1092852847 12:12646662-12646684 CAGGCACTGCTGTCCTTCTCAGG - Intergenic
1093863846 12:24200948-24200970 TTGGATCTGACGTCCTCCACTGG + Intergenic
1094063358 12:26338745-26338767 CAGGATGTGATTGCCTTCTCTGG - Exonic
1096871702 12:54596625-54596647 CAGGATCTGCTGCCCTCTGCTGG - Intergenic
1097333335 12:58355808-58355830 CAGGATCTGATTTCCTCGACAGG + Intergenic
1099175796 12:79420347-79420369 CAGGATATGCTGCCCTCTTCAGG - Intronic
1099514493 12:83580450-83580472 CAGGATATCATGTCTTCCTCTGG + Intergenic
1101002114 12:100366983-100367005 CAGAAGCTGCTGTCCTCTTCTGG - Intronic
1101439170 12:104690475-104690497 CAACATCTGAGGTCTTCCTCTGG + Intronic
1101663421 12:106787680-106787702 CAGGATCTGATGGGCTTATCGGG - Intronic
1103290392 12:119841036-119841058 CTGGATCTGATGCCCTGCTTGGG - Intronic
1107737270 13:43412969-43412991 CAGAATCTGATGACCTCCGAGGG - Exonic
1111143146 13:84148706-84148728 AAGAATCTGTTTTCCTCCTCTGG + Intergenic
1112430123 13:99343575-99343597 CAGGGGCTGGTGTCCTGCTCTGG - Intronic
1113294804 13:108947276-108947298 CAGGTGCTGAAGTCCTCCTCAGG - Intronic
1113938686 13:114007581-114007603 TTGGATCTGATTTCGTCCTCGGG - Exonic
1118642440 14:67805279-67805301 CAGGCTGTGATGAGCTCCTCAGG - Exonic
1119542715 14:75451242-75451264 CAGGATCTGGAGGCCTCCTGGGG + Intronic
1119724376 14:76913399-76913421 CAGATTCTGCTGCCCTCCTCAGG - Intergenic
1121777949 14:96603130-96603152 CAGGAGCTGCTGTCCCTCTCTGG + Intergenic
1122069726 14:99197852-99197874 CAGAGTCTGCTGTCCTCTTCTGG - Intronic
1122126632 14:99581957-99581979 CATGCTCTGATGTCCTTCACAGG - Intronic
1122819208 14:104332832-104332854 CAGGATGTGGAGTCCTCCACAGG - Intergenic
1128799248 15:70487078-70487100 CAGGACATGCTGTCCTCCTGCGG + Intergenic
1129869669 15:78932324-78932346 CAGGATGGGGTGTCCTCCGCAGG + Intronic
1134209905 16:12267479-12267501 CAGGCTGTGATGTGCTCCTGGGG + Intronic
1134629009 16:15743533-15743555 CAGCATCTGCTGTCCTTCCCTGG + Intronic
1140122248 16:72093807-72093829 CAGGCTCTCAAGGCCTCCTCTGG - Exonic
1141454523 16:84131404-84131426 CAAGATCTGATGCCCTCAGCTGG - Intronic
1143003392 17:3810317-3810339 CAGGATGTAGTCTCCTCCTCTGG - Intergenic
1144419505 17:15083429-15083451 CAGGATGGAATGTCCTCCCCTGG + Intergenic
1146135254 17:30314482-30314504 TAGAATTTCATGTCCTCCTCAGG + Intergenic
1148385731 17:47233332-47233354 CAGGTTCTGATGGCCTCCACTGG + Intergenic
1150570769 17:66385069-66385091 CAGGATTAGGTGTGCTCCTCTGG + Intronic
1150728030 17:67667188-67667210 CAGGATCTGCTGTCCAGCTGTGG - Intronic
1151755420 17:76072776-76072798 CAGGACCTGGGGTCCACCTCCGG - Intronic
1152008974 17:77699103-77699125 CAGGCTCTGAGGTCCTCTTCTGG + Intergenic
1155902603 18:31409787-31409809 CAGGATCGGATGGATTCCTCTGG + Intronic
1156332616 18:36138332-36138354 CAGGATCTGATGTCCTCCTCTGG - Exonic
1157580667 18:48772109-48772131 CGTTATCTGAGGTCCTCCTCTGG + Intronic
1157819233 18:50753368-50753390 CAGGCTCTGAAGTCCTCAACAGG - Intergenic
1160656617 19:275397-275419 CAGGCACTGGTGTCCTTCTCTGG + Intergenic
1161115603 19:2495005-2495027 CAGGGGCTGATGTCATCCCCAGG - Intergenic
926429738 2:12773729-12773751 CAGGCTTTCATGTTCTCCTCTGG - Intergenic
926558399 2:14387627-14387649 CAGGAAATGTTGTCCTCCTGAGG - Intergenic
927243108 2:20935834-20935856 CAGGATCCCTTGTCCTCCCCAGG + Intergenic
927798713 2:26076480-26076502 CAGTATCTTATGTCCTTATCAGG - Intronic
929483650 2:42336377-42336399 CAGGAGTTGATGTCGGCCTCTGG - Intronic
932363468 2:71130065-71130087 CTTGATCTAATGTCCTCCCCCGG - Intronic
932515283 2:72340892-72340914 CAGGAGTTGATGTACTCCACAGG + Intronic
934054773 2:88242307-88242329 CATGAGCTCATGTCCTGCTCTGG + Intergenic
938092148 2:128441018-128441040 CAGCATCTGATGGGCTCCCCTGG - Intergenic
939495080 2:142918460-142918482 GAGGACCTGATGTCATCCTTGGG + Intronic
939734612 2:145828447-145828469 CAGGATCACATTTTCTCCTCAGG + Intergenic
940259775 2:151767458-151767480 CAGAATCTGAGGGCCTCCACAGG + Intergenic
944866923 2:203871393-203871415 CAGATTCTGACTTCCTCCTCTGG + Exonic
946333077 2:219021367-219021389 CAGGGCCTGCTGTCCTCCCCTGG - Intronic
1169027702 20:2384364-2384386 GAGGATCCGATTTCCTTCTCTGG - Intronic
1172395981 20:34605675-34605697 CAGGCTCTGATGTCTTCATTTGG - Intronic
1174217927 20:48931609-48931631 TCTGCTCTGATGTCCTCCTCAGG - Intronic
1174794699 20:53512278-53512300 CAGGATCTGAGGTTCGGCTCGGG - Intergenic
1176094016 20:63331342-63331364 CAGGATCTGAACTCCTTCTTGGG - Intronic
1176273515 20:64248768-64248790 CAGGAGCGGAGCTCCTCCTCAGG + Intergenic
1178277061 21:31248723-31248745 CAGGATTTGTTGACATCCTCAGG - Intronic
1179483303 21:41692353-41692375 CAGGAACTGCTGTCCTGCTTCGG - Intergenic
1179709351 21:43204031-43204053 TAGGATCTCCTGTCCTCCGCTGG + Intergenic
952445555 3:33377698-33377720 CAGGAACCCATGTCCTCCTGGGG + Intronic
954290896 3:49649478-49649500 CAGGATTTGAAGTCCTTCTCTGG - Intronic
954326376 3:49866442-49866464 CAGGATCTGAGCTCTTCCTCAGG + Intronic
954914583 3:54138092-54138114 CATGAACTCATGTCTTCCTCTGG - Intronic
961269940 3:125680988-125681010 CGGGCCCTGATGTCCACCTCGGG - Intergenic
961958168 3:130825828-130825850 CAGTGGCTGCTGTCCTCCTCTGG + Intergenic
962937964 3:140099044-140099066 CAGATTCTCATGTCCTTCTCTGG - Intronic
963704207 3:148665561-148665583 CAAGATCTGATATCATCCTGGGG + Intergenic
964745767 3:160011075-160011097 CAGGTCATGAGGTCCTCCTCTGG - Intergenic
964903757 3:161692989-161693011 TAGGATCTGATGTTCTCTCCAGG + Intergenic
966608009 3:181841428-181841450 CATCATCATATGTCCTCCTCAGG + Intergenic
969232577 4:5841866-5841888 CATTTTCTGATGTCCTCATCAGG - Intronic
970583030 4:17490686-17490708 CAGGAGCTGAAGTCAGCCTCAGG + Exonic
972533230 4:39978250-39978272 AATGAACTGATTTCCTCCTCAGG + Intergenic
972618368 4:40722284-40722306 CTGGATCTGATCTCCTCCCATGG + Intergenic
974291973 4:59944656-59944678 TGGGTTCTGATTTCCTCCTCTGG + Intergenic
975031079 4:69617272-69617294 TAGGATCTGCTGCCCTCCTATGG + Intronic
975370047 4:73574424-73574446 CAGTATCTGTGGTCCTGCTCTGG + Exonic
979717123 4:123853411-123853433 CTGGAACTGAAGTCCACCTCAGG + Intergenic
980220032 4:129902154-129902176 CAGGAACTGCTGTTCTCCCCAGG - Intergenic
980862148 4:138512231-138512253 CAGGATCTTGTGTCTTTCTCAGG - Intergenic
983889294 4:173014418-173014440 CAGGCTCTGATGTCATGCTGGGG + Intronic
990652812 5:57921883-57921905 CAGGCCCTGGTGTCCTCTTCTGG + Intergenic
994285956 5:97967562-97967584 CAGAATCTGATTTTCTCCTGGGG + Intergenic
994459531 5:100054533-100054555 CAGGATAGGGTCTCCTCCTCCGG + Intergenic
1000157533 5:158566417-158566439 CAGGCTCTCAGCTCCTCCTCTGG + Intergenic
1001339770 5:170832411-170832433 CTGGATCAGCTGCCCTCCTCTGG - Intergenic
1001982628 5:176047169-176047191 CTGGGTCTGATGTCCGCCTGGGG + Intergenic
1002234835 5:177796888-177796910 CTGGGTCTGATGTCCGCCTGGGG - Intergenic
1002371318 5:178757338-178757360 CTGGATCAGCTGCCCTCCTCTGG + Intergenic
1004564383 6:16781793-16781815 CAGGATGTGATTTCCTACTCTGG + Intergenic
1006419411 6:33923994-33924016 CAGCATCTGGTGTGCTCCTCGGG + Intergenic
1007255463 6:40525143-40525165 CTGGCTCTGCTGTCCCCCTCTGG + Intronic
1008634102 6:53392395-53392417 CAGGATCTGATGTTATCTCCAGG - Intergenic
1009851194 6:69201299-69201321 CTGGATGTGACTTCCTCCTCTGG + Intronic
1011364922 6:86570926-86570948 CAGGAGCTGATGTCATCAACTGG + Intergenic
1017941442 6:159056757-159056779 CAGGATCTGATGTTTTCATCTGG - Intergenic
1017973733 6:159336068-159336090 CAGGATCTGACCTCCGCCCCAGG - Intergenic
1022505324 7:30905927-30905949 CCGGATCTGACGCCCTCCTCTGG - Intergenic
1026519813 7:71106848-71106870 AAGGCTCTGATGTTCTACTCTGG - Intergenic
1030131692 7:106207074-106207096 CAGGACCTGCTGTCCTGCTGGGG + Intergenic
1031973273 7:128078648-128078670 CAGCATCAGGTGTCCTCCTTGGG - Intronic
1032299763 7:130675913-130675935 TTGGGTCTGATATCCTCCTCTGG + Intronic
1034048821 7:147959821-147959843 CAGGATCTGAGCCCCACCTCTGG + Intronic
1035101890 7:156404517-156404539 CAGGATATGATGTCCTCATGAGG - Intergenic
1035245523 7:157560136-157560158 CTGGGTCTGATGTCCTCACCTGG - Intronic
1038210875 8:25518202-25518224 CAGGGTCTGGTGTCCTGCCCCGG - Intergenic
1039595651 8:38787902-38787924 CAGGATCTTCTGTCCTCCCGTGG + Intronic
1039716052 8:40110332-40110354 CAGGCTGTGCTGTGCTCCTCAGG - Intergenic
1041463049 8:58132517-58132539 AAGGAGCTGCTGTCCACCTCGGG - Intronic
1041591487 8:59590542-59590564 CAGGATCTGCTGTCTTCCCAAGG - Intergenic
1041953540 8:63532238-63532260 CACAATCTGATGCCCTTCTCTGG - Intergenic
1043889863 8:85643473-85643495 GAGTACCTGGTGTCCTCCTCGGG - Intergenic
1043891401 8:85655381-85655403 GAGTACCTGGTGTCCTCCTCGGG - Intergenic
1043892474 8:85662218-85662240 GAGTACCTGGTGTCCTCCTCGGG - Intergenic
1043893083 8:85715117-85715139 GAGTACCTGGTGTCCTCCTCGGG + Intergenic
1043895770 8:85736571-85736593 GAGTACCTGGTGTCCTCCTCGGG + Intergenic
1043896909 8:85745237-85745259 GAGTACCTGGTGTCCTCCTCGGG - Intergenic
1043899233 8:85763604-85763626 GAGTACCTGGTGTCCTCCTCGGG - Intergenic
1043900843 8:85775798-85775820 GAGTACCTGGTGTCCTCCTCGGG - Intergenic
1043902807 8:85791073-85791095 GAGTACCTGGTGTCCTCCTCGGG - Intergenic
1043904417 8:85803266-85803288 GAGTACCTGGTGTCCTCCTCGGG - Intergenic
1043906029 8:85815457-85815479 GAGTACCTGGTGTCCTCCTCGGG - Intergenic
1043907637 8:85827647-85827669 GAGTACCTGGTGTCCTCCTCGGG - Intergenic
1045568271 8:103343469-103343491 CTGTATCTGATGTTCTCCTGAGG - Intergenic
1047085098 8:121507173-121507195 CAGGATGTTATGTGCTCCTGGGG + Intergenic
1047225436 8:122952414-122952436 CAGATTCTGATGTGCTCCTCTGG - Exonic
1047459216 8:125046220-125046242 CAGGTTCTCATGTCCACCCCTGG - Intronic
1048142685 8:131810041-131810063 CAGGTACTGAGGTCCTGCTCAGG + Intergenic
1049359623 8:142206128-142206150 CAGGGTCTGCCGTCTTCCTCTGG + Intergenic
1050933309 9:11359688-11359710 CAGAATATGATGACCTCCACAGG - Intergenic
1055772533 9:79732729-79732751 CAGTATGTGCTGTCATCCTCAGG + Intergenic
1056690511 9:88804332-88804354 CAGCAAGTGATGTCTTCCTCTGG + Intergenic
1057030275 9:91769777-91769799 CATGATCTGAGGTCCTCCTGTGG + Intronic
1057311203 9:93944351-93944373 CATGATCTCATGTCCTCATTAGG - Intergenic
1057397486 9:94692821-94692843 CAGGGTCTGATACCCTCCTGAGG + Intergenic
1058562420 9:106244048-106244070 AAGGATCTGATGATCTCCTCAGG - Intergenic
1061134557 9:128725880-128725902 CAGGATCTGATGTGCTCAGTGGG + Intergenic
1061856216 9:133443287-133443309 CAGGTGCTGATGTACTCCCCCGG - Intronic
1062195766 9:135273137-135273159 CAGGCTCTGATGGCCTGGTCTGG - Intergenic
1062202956 9:135316942-135316964 CATGTTCTGATGACCTCCTTTGG + Intergenic
1062228194 9:135465703-135465725 CAGTAGCTGATGTCCGCCCCTGG - Intergenic
1186148305 X:6647613-6647635 CAGGACCAGAGTTCCTCCTCAGG - Intergenic
1186253672 X:7697187-7697209 CAGAAACTGGTGTCCCCCTCAGG - Intergenic
1188173879 X:26964034-26964056 CAGGAACTGATGTCTTGCACTGG + Intergenic
1197343157 X:125298541-125298563 AACGATCTGAGGTCTTCCTCGGG - Intergenic
1200902275 Y:8444812-8444834 CATGATATAATGTCCTCCTCTGG + Intergenic
1201223027 Y:11789739-11789761 CAGGACGTGGTCTCCTCCTCCGG + Intergenic