ID: 1156333753

View in Genome Browser
Species Human (GRCh38)
Location 18:36150303-36150325
Sequence CAGTTCCAGTGTCAGTTCTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 214
Summary {0: 1, 1: 1, 2: 9, 3: 26, 4: 177}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156333751_1156333753 -7 Left 1156333751 18:36150287-36150309 CCAGCAGTTTTTCACACAGTTCC 0: 1
1: 3
2: 6
3: 31
4: 205
Right 1156333753 18:36150303-36150325 CAGTTCCAGTGTCAGTTCTAGGG 0: 1
1: 1
2: 9
3: 26
4: 177

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156333753 Original CRISPR CAGTTCCAGTGTCAGTTCTA GGG Intronic
901089534 1:6632231-6632253 CAGTTCCAGGGTGTGTGCTAGGG + Intronic
901502911 1:9664715-9664737 TAGTGCCAGAGTCAGTCCTAGGG + Intronic
902744401 1:18463814-18463836 CAGATCCAGTGACTATTCTAGGG + Intergenic
902783604 1:18719455-18719477 CAGTTCCACTGGCAGTCCTCAGG - Intronic
904073150 1:27817370-27817392 CAGTTCCAGAGTCAATCCCAGGG + Intronic
904400350 1:30252630-30252652 CAGTCCCAGTGTCACTTCTGGGG + Intergenic
905212155 1:36381784-36381806 CAGTCCCAGTTCAAGTTCTAAGG + Intronic
908761705 1:67518684-67518706 CAGTTCCAGTGTCGGTCCTAGGG - Intergenic
909426023 1:75526136-75526158 CTTTTCCAGTTTCACTTCTATGG + Intronic
910349866 1:86282990-86283012 TAGTTCCAGTGTGAGTCCAAAGG - Intergenic
910423916 1:87100347-87100369 CAGTTCCAGCCTCAGCTCAAAGG - Intronic
913176560 1:116278045-116278067 CAGTTCCAGTGTCAAATCCGAGG - Intergenic
913483750 1:119315186-119315208 CAATTCCAGTTTCAGTTCCATGG - Intergenic
914327807 1:146637436-146637458 CATTACCAGTGTCTCTTCTATGG + Intergenic
914456353 1:147840800-147840822 TAGTTCCAGAGTCAGTTTTAGGG - Intergenic
915131470 1:153698176-153698198 TAGTTCCAGTGAAAGTTCTCGGG - Intergenic
916293402 1:163190536-163190558 CAGTTCCATAGTCAGTCCTAAGG - Intronic
916531980 1:165665194-165665216 AAGTTACACTGCCAGTTCTAGGG + Intronic
916973048 1:170044720-170044742 CAGTTTCAGAGTCAGTCCTGGGG - Intronic
917291470 1:173476631-173476653 CCGTACCAATGTCAGTGCTAGGG - Intergenic
919313025 1:195935828-195935850 GATTTCTAGTGTCAGATCTAAGG - Intergenic
921561482 1:216663904-216663926 CATTTCCTGTGTCAGTTCTCTGG - Intronic
1062839184 10:657275-657297 CAGGTCCAGTGGCAGGTCCAGGG - Intronic
1062839235 10:657431-657453 CAGGTCCAGCGTCAGGTCCAGGG - Intronic
1062839255 10:657503-657525 CAGGTCCAGCGTCAGGTCCAGGG - Intronic
1062839263 10:657539-657561 CAGGTCCAGTGTGAGGTCCAGGG - Intronic
1062839411 10:658055-658077 CAGGTCCAGCGTCAGGTCCAGGG - Intronic
1062839433 10:658139-658161 CAGGTCCAGCGTCAGGTCCAGGG - Intronic
1062839442 10:658175-658197 CAGGTCCAGTGTGAGGTCCAGGG - Intronic
1064321318 10:14307852-14307874 CAGGGCTAGAGTCAGTTCTAAGG - Intronic
1068121386 10:52785169-52785191 CAGTTCCTGTATCATTTCTGAGG - Intergenic
1069596982 10:69678516-69678538 TAGTTCCTGTGTCTTTTCTAAGG + Intergenic
1070281754 10:75054255-75054277 CATTTCTAGGGTCAGATCTAAGG + Intronic
1071094106 10:81953037-81953059 AAGATCCAGAGTCAGTGCTATGG - Intronic
1072826529 10:98612183-98612205 CATTTCCAGAGTCAATTCTAAGG + Intronic
1073056706 10:100707787-100707809 CTGTCCCAGTGTCAGTGCCAGGG - Intergenic
1073313315 10:102559874-102559896 AATTTCCAGTGTCAGTTACAAGG - Intronic
1074182162 10:111075238-111075260 CCTTTCCAGTGTTAGTTCTGAGG - Intergenic
1078697257 11:13646993-13647015 CAGTTGCAGAGTTAGTCCTAGGG + Intergenic
1080807793 11:35670929-35670951 CAGCTCTAGTTTCAGTTCTCTGG + Intronic
1084390997 11:68876844-68876866 CAGTTCCAGAGTCAGTCCCAGGG + Intergenic
1084965989 11:72744839-72744861 CTGTTCCAGTTTCTGTTCCACGG - Intronic
1085779932 11:79398876-79398898 CAGTTCCAGTGTCCCCTCGAGGG - Intronic
1087650230 11:100857778-100857800 GAATTCCAGAGACAGTTCTATGG - Intronic
1088193427 11:107251145-107251167 CAGGTCCAGAGTCAACTCTATGG + Intergenic
1088866055 11:113849206-113849228 CAATTCCAGAGTCAGTCCTAGGG - Intronic
1090417986 11:126554052-126554074 CAGTTCCAGAGTCAGTTCTAGGG + Intronic
1092764286 12:11838770-11838792 CAGTTCCAGGGGCTGTTCCAGGG - Intronic
1094553430 12:31473887-31473909 CAGTTCCAAAGTCAGTCCAAGGG - Intronic
1095765699 12:45892663-45892685 CAGTTACAGTGTCAGAAATAGGG + Intronic
1096967723 12:55641761-55641783 CAGCTCCAGTGTCAACTCCACGG + Intergenic
1098184095 12:67878224-67878246 CAGTTCCAGAGTCAGTCCTAGGG - Intergenic
1098768956 12:74528082-74528104 CAGTTCCAGTCCAAGTCCTAAGG + Intergenic
1099301166 12:80896141-80896163 CATTTCCAGTCTCAGTCCAAAGG - Intronic
1099500170 12:83404044-83404066 CTGTTCCAGTGTTGTTTCTATGG + Intergenic
1099871532 12:88355620-88355642 TAGTTCCAGTCTGAGTTCAAAGG + Intergenic
1100031075 12:90191809-90191831 TAGTTCCAATCTGAGTTCTAAGG - Intergenic
1100409245 12:94298337-94298359 CAGTTGAAATGTCAGTTGTAGGG - Intronic
1101572294 12:105965065-105965087 TAGTTCCAGTCCAAGTTCTAAGG + Intergenic
1101701386 12:107177631-107177653 CAGTTCCAGTCTGAGCTCAAAGG + Intergenic
1101855437 12:108438840-108438862 CAGTTCCAGTCTGAGTCCAAAGG + Intergenic
1103155133 12:118678342-118678364 CAGCTCCAGGGTTAGTTCTGGGG + Intergenic
1106143805 13:27034564-27034586 CAGTTCCAGTCTGAGTCCAAAGG + Intergenic
1106612857 13:31300181-31300203 TAGTTCCAGAGTCAGTTTTAGGG + Intronic
1107814080 13:44228674-44228696 CAGTTCCAGAAGCAGGTCTAGGG - Intergenic
1108391884 13:49955080-49955102 CAGTTCCAGAGTCAGTCCTAGGG + Intergenic
1109231591 13:59764342-59764364 CAGTCCCATTTTCAGCTCTATGG + Intronic
1111386850 13:87538893-87538915 CAGTTCCTGAGTCAGTCCTGGGG - Intergenic
1111909751 13:94297697-94297719 CAGCTACTGTGTCAGTTTTAAGG - Intronic
1112507678 13:99984954-99984976 CCGTTCCAGTGTGAGTTTGAGGG + Exonic
1113132341 13:107051873-107051895 CAGCTCCAGAGTCAGTCCTAGGG - Intergenic
1114140211 14:19901240-19901262 CAGTTCCAGCCGCAGTTCAAAGG + Intergenic
1114222370 14:20708300-20708322 CAATTCCTGTTTCATTTCTATGG + Intergenic
1115920686 14:38369675-38369697 CATTTCCAGTGACAATTTTATGG - Intergenic
1117896716 14:60495121-60495143 CTGTTCCAATGTAAGATCTATGG - Intronic
1118895128 14:69939516-69939538 CAGTTCCAGTGTCATCTTTATGG + Intronic
1121771331 14:96544596-96544618 CAGTTTCAGTGTCAGATTTTTGG + Intronic
1122517799 14:102320514-102320536 CAGCTCCAGTGTCTGGCCTACGG - Intronic
1122597142 14:102901608-102901630 CAGTGACAGTGTCAGTTTAAAGG + Intronic
1124918682 15:34002117-34002139 CAGTTTCAGTGTCAGTCTTCTGG - Intronic
1125456984 15:39870043-39870065 CAGTTCCTTTGGCAGCTCTAGGG + Intronic
1126312841 15:47336737-47336759 CTGTTTCAGAGTCAGTTCTAGGG - Intronic
1126596494 15:50388949-50388971 CAGTTCCAGAGTCAGTCCTAGGG - Intergenic
1126972702 15:54135338-54135360 CATTTCCAGTGTCATATCCAAGG + Intronic
1127099434 15:55550274-55550296 CAGTTCCAGTGTCACTAAGAGGG - Intronic
1130693475 15:86106463-86106485 CAATTCCAGTGGCTGTTCCAGGG + Intergenic
1130892188 15:88142543-88142565 CACTTCCAGTGACAGTCCTGGGG + Intronic
1132797323 16:1731531-1731553 CAGTTCTAGGGTTAGTTCCAGGG + Intronic
1134247268 16:12549085-12549107 CTGTTACAGTGTCATTTCTTGGG + Intronic
1137422735 16:48349919-48349941 CACATCCAGTGTCAGTGCTGAGG - Intronic
1137793219 16:51192858-51192880 CAGTTCCAATGTCAGCACTCAGG + Intergenic
1138711314 16:58973452-58973474 CAGTTCCAGAGTCAGTCCTAGGG + Intergenic
1138809044 16:60127448-60127470 CAGTCCCAGAGTCAGCCCTAGGG - Intergenic
1141022618 16:80511802-80511824 TAGTTCCAGTCCCAGTCCTAAGG + Intergenic
1144751819 17:17653978-17654000 CAGCTCCAGCGTCAGTTCAAAGG - Intergenic
1146493461 17:33299458-33299480 CAACTCCAGTGCCAGTTCCATGG - Intronic
1146525512 17:33564006-33564028 TGGTTCCAGTGTCAGGACTATGG - Intronic
1148658702 17:49309605-49309627 TAGTTCTAGTGTCATTTTTAGGG - Intronic
1148894679 17:50832941-50832963 CAGATCCAGAGCCAGTTCCAAGG + Intergenic
1149046888 17:52256210-52256232 CAGTTCCAGAAACAGTCCTAGGG - Intergenic
1149185256 17:53990020-53990042 CAGTTCCAGAATCTGTCCTAGGG + Intergenic
1154413139 18:14153610-14153632 AAATTCCAATTTCAGTTCTATGG - Intergenic
1154491869 18:14928583-14928605 AAGTTCCAGTTCCAGTTCCAAGG - Intergenic
1155652453 18:28158392-28158414 CAGTTCCAGTTTCAACTCAAGGG + Intronic
1156333753 18:36150303-36150325 CAGTTCCAGTGTCAGTTCTAGGG + Intronic
1156736224 18:40263103-40263125 CAGTTCCAGCTGCAGTTCAAAGG + Intergenic
1158025699 18:52894705-52894727 CAGTTCAAGTCTCAGTTCAAAGG + Intronic
1158127173 18:54113785-54113807 AAATTTCAGTGTCAGTTATAGGG - Intergenic
1159506210 18:69339993-69340015 GAGTTACAGTGCCAGTTGTAGGG + Intergenic
1160192776 18:76728135-76728157 CAGTACCAGTGTCAGTTTCCTGG - Intergenic
929005217 2:37387165-37387187 AGGATCCAGTGTCATTTCTATGG + Intergenic
929284527 2:40120251-40120273 CACTGCCAGTGTCAGTTCCTGGG - Intronic
932670257 2:73731335-73731357 CCGTTCCATTTACAGTTCTAGGG - Intronic
937416954 2:121722994-121723016 CACTTCCAGGGTGACTTCTAAGG + Intergenic
937616105 2:123923589-123923611 CAGTTCCAGTCTCCATTCAAAGG - Intergenic
940274281 2:151922661-151922683 CATTTCCAGTATCAGATCTTTGG + Intronic
943404711 2:187465793-187465815 CAATTCCAGTGTCAGATTTGAGG + Exonic
945500938 2:210574098-210574120 AAGTTCTAGTCTCAATTCTAAGG + Intronic
947618468 2:231573865-231573887 CAAATCCAGTGTGTGTTCTAAGG + Intergenic
1169401969 20:5289764-5289786 CAGTCCCAGTTTCAGCTCCAAGG - Intergenic
1171344073 20:24452543-24452565 GAGTTCCAGTGGCTGTTCCATGG - Intergenic
1174545151 20:51319564-51319586 CACTTCCAGGGTCAGATCCAGGG + Intergenic
1174609931 20:51790684-51790706 CCGTTCCAGTGTAAGATCTGTGG - Exonic
1174886902 20:54345770-54345792 TAGTTACAGTGTCAGTTTCACGG + Intergenic
1176859870 21:14004645-14004667 AAATTCCAATTTCAGTTCTATGG + Intergenic
1177772300 21:25530286-25530308 TAGTTCCAGTGTGAGTCCAAAGG - Intergenic
1181953132 22:26569225-26569247 CCGTTCCAGTAACAGTTCCATGG + Intronic
1182671107 22:31996757-31996779 CAGTTAGGGGGTCAGTTCTATGG + Intergenic
949893204 3:8748532-8748554 CAGTTCCAGTCACCGTTCTTGGG + Intronic
952870228 3:37892889-37892911 CATTTTCAGTGGCAGCTCTAAGG + Intronic
952941894 3:38452051-38452073 CAGTTTAAGTGTCTTTTCTAGGG - Intergenic
953229681 3:41053535-41053557 CAGTTCCATTGTGAGTGCTGTGG - Intergenic
953570306 3:44066073-44066095 CAGTTCCAGTGTAAGTTCCAGGG - Intergenic
954008477 3:47613349-47613371 TACTTCCAGTTTCATTTCTATGG - Intronic
961472649 3:127125828-127125850 CAGTTCCAATGTCACCTCTTTGG - Intergenic
961925729 3:130478312-130478334 CAGTGCCAGTTTTAGTTCTGTGG + Intronic
963286022 3:143435481-143435503 CACTTCCAGTTATAGTTCTATGG + Intronic
967193183 3:187003047-187003069 CAGTTCCAGTCTGAGTCCAAAGG + Intronic
969937739 4:10699062-10699084 TAGTTCCAGTGTGTGTTCAAAGG - Intergenic
970257472 4:14183555-14183577 CAGTTCCAGTGTAAGTTTAATGG - Intergenic
970899259 4:21139652-21139674 CAATTCCAGGGGCAGTGCTAAGG - Intronic
972888619 4:43525994-43526016 CATTTCCAGTGACAGTCCCAAGG + Intergenic
973260201 4:48155716-48155738 CAGTTCCAGAGTCAGTCTTTGGG - Intronic
973286211 4:48419654-48419676 TAGTTACAGTGTCAGTAATATGG + Intronic
973590278 4:52433919-52433941 CAGTTCTAGTGTCAGCTCCTGGG - Intergenic
974842025 4:67309795-67309817 CAGTTCCAAAGTCACTTCCATGG - Intergenic
975349246 4:73327705-73327727 CAGTTCCAGATTCAGTCTTAGGG + Intergenic
975811851 4:78177853-78177875 CAGTTTCTGTGTCAGTACAATGG + Intronic
977289435 4:95147851-95147873 CAGTTCCAGCCCCTGTTCTAAGG - Intronic
977559549 4:98518528-98518550 CAGTTCAAGTGTCACTTCCTAGG - Intronic
979120923 4:116899973-116899995 CAGTTCCAGTCTGAGTCCAAAGG - Intergenic
981727889 4:147867033-147867055 CAGTTTCTGGGTCAATTCTAAGG + Intronic
982404789 4:155007657-155007679 CAGGGCCAGAGTCAGTTCTGGGG + Intergenic
982419730 4:155181109-155181131 CATTTCCAGGATCAGTTATAGGG + Intergenic
984693084 4:182751238-182751260 AAGTGCCAGTGTCTGTCCTATGG - Intronic
987969970 5:24930022-24930044 CAGTTAAAATATCAGTTCTAGGG + Intergenic
988701385 5:33678527-33678549 CAGCTCCAGTGTCACTTCCTTGG - Intronic
988847972 5:35148875-35148897 CAGGTACCGTGTAAGTTCTAAGG + Intronic
989186959 5:38635279-38635301 CAGTTCCAGAGTCAGTACTGGGG - Intergenic
989750385 5:44885449-44885471 CATTTCCAGTGAAATTTCTATGG - Intergenic
991281358 5:64917819-64917841 TAGTTCCAGTTTGAGTTCAAAGG - Intronic
992397457 5:76381068-76381090 CAGTGCCAGTCTTAGCTCTAAGG + Intergenic
992506695 5:77394303-77394325 CAGTTTCAGAGTCAGTCCTAGGG + Intronic
995142887 5:108752980-108753002 TAGTTCCAGTTTCTGTTCTGTGG + Intronic
995482585 5:112608000-112608022 CAGTTCCAGTGTCAGTTAGGTGG + Intergenic
999392153 5:151201217-151201239 AAGAACCAGTGTCACTTCTAGGG - Intronic
1001209831 5:169800224-169800246 CAATGGAAGTGTCAGTTCTATGG - Intronic
1004686980 6:17956085-17956107 CAGTGCCAGGCTCCGTTCTAAGG + Intronic
1004931145 6:20464340-20464362 CAGTTCCAGAGTCAGGCCTAAGG + Intronic
1004960104 6:20778619-20778641 TAGTTCCAGTCTGAGTTCAAAGG + Intronic
1007710201 6:43818011-43818033 CAGTTCCACAGTCAGTCCTAGGG - Intergenic
1008880120 6:56373111-56373133 CAGGTTCAGTGTCAGGTCTGTGG + Intronic
1014096860 6:117470627-117470649 CACTTTCAGAGTCAGTCCTAGGG + Intronic
1016438217 6:144059242-144059264 CAGTTCCAGTCTTGGTTCAAAGG - Intronic
1016795344 6:148111280-148111302 CAGTTCCAGTCTGAGTTCAAAGG - Intergenic
1017586549 6:155932168-155932190 CAGTTGCAGTTTGAGTTCAAAGG - Intergenic
1018547601 6:164955090-164955112 CAGTTCCAGATTGCGTTCTAAGG + Intergenic
1022190043 7:28008470-28008492 CAATTCCAGTATAAATTCTAAGG + Intronic
1022715521 7:32894581-32894603 AAGTTCCAGTGTCCATTTTAGGG + Intergenic
1024439266 7:49396877-49396899 CATTTCCACTGTCAGTCATAGGG + Intergenic
1028713297 7:93935756-93935778 CAGTTCCAGTTTGATTTCTAGGG + Intergenic
1029938222 7:104451105-104451127 CCGTTCCATTTTCAGTTCTCTGG - Intronic
1033082390 7:138310540-138310562 CAGTTCCAGAGTTAGTCCTAGGG + Intergenic
1033530427 7:142257402-142257424 CAGGTCCAGAGTCAGGTCTTAGG + Intronic
1036173751 8:6515983-6516005 CTGTTCCAGGGACAGTTCTCTGG - Intronic
1039965057 8:42278104-42278126 CAGTTCAAGTGTCACTTCCTTGG - Intronic
1042996984 8:74711539-74711561 CAGTCACAGTGACAGTTCCATGG + Intronic
1045408114 8:101888033-101888055 CAGTCCCAGTGAAAGTTCTGAGG + Intronic
1045476734 8:102559256-102559278 CAGTTCCAGAGTCTGTTCTTAGG + Intronic
1048738635 8:137530357-137530379 CAGTTTCAGTGCCTGTTTTATGG - Intergenic
1050872743 9:10594317-10594339 CACTTCTAGTGTCAGTAATAAGG - Intronic
1051106346 9:13585036-13585058 CAGTTCCATTGTCTGTTATTGGG - Intergenic
1051684671 9:19645609-19645631 GAGTTCCGGTGACAGTTCTCAGG + Intronic
1052029507 9:23612080-23612102 TAGTTACAGTCTCAGTTCCAAGG + Intergenic
1056058298 9:82852611-82852633 CAGTTACAGTTTTATTTCTAAGG - Intergenic
1057670623 9:97084464-97084486 TAGTTCCAGTGTGAGTCTTAAGG + Intergenic
1058229692 9:102410440-102410462 CAGTTCCAGAGTTAGTCCTAGGG + Intergenic
1059670264 9:116484520-116484542 TAGTTCCAGTGTCAGTTCTTGGG - Intronic
1061610640 9:131743280-131743302 TAGTTTCACTGTCACTTCTATGG + Intergenic
1186438747 X:9566822-9566844 GACTTCCTGTGTCAATTCTAGGG - Intronic
1186443459 X:9605753-9605775 CAGTTCCAGTCTGTGTGCTAGGG + Intronic
1188063519 X:25629580-25629602 CAGTTCCAGTTTCACTTGTTAGG - Intergenic
1189510335 X:41655631-41655653 CAGTTCCAGAGTCAGTCCTAGGG - Intronic
1189516108 X:41714933-41714955 CAGTTCCAGAGTCAGTCCTAGGG - Intronic
1189549438 X:42077777-42077799 CAGTTCCAGACTCAGCTCAAAGG - Intergenic
1192381138 X:70617875-70617897 CATTTCCAAAGTCAGTCCTAGGG - Intronic
1193769877 X:85575771-85575793 CAGTTCCACAGTCAGTCCTATGG - Intergenic
1194945993 X:100068182-100068204 CAGTTACAGTGTTACTTCTGTGG - Intergenic
1196249561 X:113444708-113444730 CAGTTGCATTGTCAGTTTAAGGG - Intergenic
1196569123 X:117245079-117245101 CTGTTCCAGTGCTAGTTCTTTGG - Intergenic
1197994844 X:132361993-132362015 TTGTTCCAGTGTAAGTCCTAGGG - Intergenic
1198677395 X:139145555-139145577 CAGTTGGAGTGTAAGTTTTATGG - Intronic
1199235103 X:145483452-145483474 CAGATGAAGTGTCAGTTCTTAGG + Intergenic
1199323750 X:146472255-146472277 GATTTCCAGTGTTAATTCTAAGG - Intergenic