ID: 1156338253

View in Genome Browser
Species Human (GRCh38)
Location 18:36188081-36188103
Sequence TGCGTGGACCGCCAGCGCCC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 146}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156338242_1156338253 14 Left 1156338242 18:36188044-36188066 CCGTGACCCTTCGGATGTCCTCC 0: 1
1: 0
2: 0
3: 4
4: 89
Right 1156338253 18:36188081-36188103 TGCGTGGACCGCCAGCGCCCGGG 0: 1
1: 0
2: 0
3: 9
4: 146
1156338245_1156338253 7 Left 1156338245 18:36188051-36188073 CCTTCGGATGTCCTCCCGAGGTA 0: 1
1: 0
2: 0
3: 3
4: 18
Right 1156338253 18:36188081-36188103 TGCGTGGACCGCCAGCGCCCGGG 0: 1
1: 0
2: 0
3: 9
4: 146
1156338251_1156338253 -8 Left 1156338251 18:36188066-36188088 CCGAGGTAGGAGCGGTGCGTGGA 0: 1
1: 0
2: 0
3: 8
4: 73
Right 1156338253 18:36188081-36188103 TGCGTGGACCGCCAGCGCCCGGG 0: 1
1: 0
2: 0
3: 9
4: 146
1156338249_1156338253 -7 Left 1156338249 18:36188065-36188087 CCCGAGGTAGGAGCGGTGCGTGG 0: 1
1: 0
2: 0
3: 7
4: 105
Right 1156338253 18:36188081-36188103 TGCGTGGACCGCCAGCGCCCGGG 0: 1
1: 0
2: 0
3: 9
4: 146
1156338248_1156338253 -4 Left 1156338248 18:36188062-36188084 CCTCCCGAGGTAGGAGCGGTGCG 0: 1
1: 0
2: 0
3: 1
4: 38
Right 1156338253 18:36188081-36188103 TGCGTGGACCGCCAGCGCCCGGG 0: 1
1: 0
2: 0
3: 9
4: 146
1156338241_1156338253 21 Left 1156338241 18:36188037-36188059 CCAGCGGCCGTGACCCTTCGGAT 0: 1
1: 0
2: 0
3: 0
4: 19
Right 1156338253 18:36188081-36188103 TGCGTGGACCGCCAGCGCCCGGG 0: 1
1: 0
2: 0
3: 9
4: 146
1156338244_1156338253 8 Left 1156338244 18:36188050-36188072 CCCTTCGGATGTCCTCCCGAGGT 0: 1
1: 0
2: 0
3: 3
4: 29
Right 1156338253 18:36188081-36188103 TGCGTGGACCGCCAGCGCCCGGG 0: 1
1: 0
2: 0
3: 9
4: 146

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156338253 Original CRISPR TGCGTGGACCGCCAGCGCCC GGG Intronic
900675904 1:3886135-3886157 TGGGTGGATCGCCTGAGCCCAGG - Intergenic
902259653 1:15215123-15215145 TGCGCTGACCGCCATCGGCCTGG + Exonic
902336817 1:15758829-15758851 TACCTGGGCCGCCCGCGCCCCGG - Intronic
904001586 1:27341948-27341970 GGCCTGGACTCCCAGCGCCCGGG - Intergenic
905422826 1:37859888-37859910 TGCGCTGACCGCCCTCGCCCTGG + Intergenic
907694230 1:56705625-56705647 TGGGTGGACCGCCTGAGCCCTGG - Intronic
908688833 1:66753855-66753877 TGGGTGGACCGCTTGAGCCCAGG + Intronic
909874322 1:80783569-80783591 TGCGTACACCGCCAGGGCCCTGG + Intergenic
916104459 1:161420901-161420923 TGCTTTAACTGCCAGCGCCCAGG + Intergenic
922172281 1:223165926-223165948 TGGGTGGATCGCTAGAGCCCAGG + Intergenic
923490337 1:234478593-234478615 GGCGGGGACCGCCGTCGCCCTGG - Exonic
923565023 1:235070063-235070085 TGCATGCACGGCCAGGGCCCTGG + Intergenic
1062808069 10:439522-439544 TGGGAGGACCGCCTGAGCCCAGG + Intronic
1064111140 10:12540004-12540026 TGAGTGGATCGCCTGAGCCCAGG - Intronic
1064467820 10:15602508-15602530 TGGGTGGACCGCCTGACCCCAGG + Intronic
1065339383 10:24689510-24689532 TGGGCGGATCGCCAGAGCCCAGG + Intronic
1066404892 10:35108983-35109005 TGGGTGGACCACCTGCGCTCAGG + Intergenic
1067067232 10:43110951-43110973 TGCCTTGACCTCCAGCTCCCAGG + Intronic
1069930352 10:71877601-71877623 CGGGAGGACCGCCAGAGCCCAGG + Intergenic
1070248488 10:74753438-74753460 TGTGTGGACAGGCAGGGCCCTGG - Intergenic
1070302024 10:75210679-75210701 CACGTGGACCGACAGCGCCCCGG - Intronic
1072978596 10:100080663-100080685 TGGGTGGATCGCCTGAGCCCAGG + Intronic
1075940445 10:126387153-126387175 TCGGTGGACCGACAGCGCCCCGG + Intronic
1080855345 11:36106960-36106982 TCCTTGGACCAGCAGCGCCCAGG - Intronic
1082003621 11:47408286-47408308 TGCGGGGACCGCGATCGACCAGG - Intronic
1083571029 11:63762566-63762588 TGCCGGGACCGCCTGTGCCCCGG + Exonic
1084156914 11:67318203-67318225 CCCGTGGGCTGCCAGCGCCCGGG - Intronic
1084374575 11:68767494-68767516 TGGGAGGATCGCCAGCACCCAGG + Intronic
1084400383 11:68939777-68939799 AGCATGGTCTGCCAGCGCCCTGG - Exonic
1084553416 11:69862498-69862520 TCCGTGGGCCACCAGCCCCCCGG - Intergenic
1087563834 11:99827314-99827336 TGCGTGGATCGCCTGAGCTCAGG - Intronic
1087660644 11:100983909-100983931 CGAGTGGACCGCCTGAGCCCAGG + Intronic
1092123472 12:6060319-6060341 TGCCTGGACCGCCAGCCCCACGG + Intronic
1092886337 12:12927543-12927565 TGTGTGGCCTGCCAGCGCCTGGG - Intergenic
1099071572 12:78050905-78050927 TGCGAGGATAGCCAGCACCCAGG - Exonic
1101259767 12:103016918-103016940 TGAGTGGATCGCCTGAGCCCAGG - Intergenic
1102549540 12:113681713-113681735 TGGGAGGACCGCCTGAGCCCAGG + Intergenic
1105509317 13:21038011-21038033 TGGGTGGACCGCTTGAGCCCAGG + Intronic
1106378855 13:29216488-29216510 TGCCTGCACCACCAGGGCCCTGG - Intronic
1107952377 13:45475288-45475310 TGGGAGGACCACCAGAGCCCAGG - Intronic
1113131607 13:107043046-107043068 TGCGTATACCACCAGGGCCCTGG - Intergenic
1113379055 13:109786470-109786492 GGCGCGGACCCCGAGCGCCCGGG - Exonic
1113669513 13:112166061-112166083 TGCGGGGCCTGCCTGCGCCCTGG - Intergenic
1115281553 14:31668668-31668690 TGCCTACACCACCAGCGCCCTGG - Intronic
1118229283 14:63932477-63932499 TGGGTGGATCGCCTGAGCCCAGG + Intronic
1122486877 14:102087506-102087528 TGCGTGGACGGAGAGCGGCCCGG + Intronic
1122544953 14:102517092-102517114 GGCGGGGACGCCCAGCGCCCTGG + Intergenic
1122649339 14:103217060-103217082 TGGGAGGACCGCCTGAGCCCAGG - Intergenic
1122975434 14:105168897-105168919 GGCGTCGCCTGCCAGCGCCCCGG + Intergenic
1123018903 14:105388456-105388478 TGCCTGGAGCACCAGCTCCCAGG - Intronic
1123943850 15:25229520-25229542 TGCCTGGACCACCATCACCCCGG - Intergenic
1124555339 15:30719776-30719798 TGTGTGGATCGCAAGCCCCCAGG - Intronic
1124675921 15:31685918-31685940 TGTGTGGATCGCAAGCCCCCAGG + Intronic
1126736706 15:51737816-51737838 TGCGTGTGCCGCGGGCGCCCGGG - Exonic
1127029977 15:54851060-54851082 TGCGTATACCACCAGGGCCCTGG + Intergenic
1132896764 16:2232937-2232959 TGCGTCCACAGCCAGCCCCCAGG - Intronic
1139545409 16:67647528-67647550 TGAGTGTCCCGCCAGCGCCTGGG - Exonic
1141183985 16:81774102-81774124 TGGGTGGACTGCCAGAGCTCAGG + Intronic
1142116374 16:88358226-88358248 AGCTCGGACCCCCAGCGCCCAGG + Intergenic
1145111236 17:20163651-20163673 TGAGAGGACCGCCTGCACCCAGG - Intronic
1146132677 17:30292106-30292128 CGCTGGGTCCGCCAGCGCCCGGG + Intergenic
1146735143 17:35232492-35232514 TGGGTGGATCGCCTGAGCCCAGG - Intergenic
1147121021 17:38335138-38335160 TGTGTGGACCGTGGGCGCCCTGG - Exonic
1149495718 17:57116068-57116090 TGCGTGGAACGCCTGGGCCAGGG - Intronic
1149524778 17:57346697-57346719 TGGGAGGATCGCCAGAGCCCAGG - Intronic
1151828804 17:76537956-76537978 TCCCGGGACCCCCAGCGCCCCGG - Intronic
1152362522 17:79839269-79839291 CGCGCCGGCCGCCAGCGCCCCGG - Exonic
1155206514 18:23562757-23562779 TGGGTGGACTGCCAGAGCTCAGG + Intronic
1156338253 18:36188081-36188103 TGCGTGGACCGCCAGCGCCCGGG + Intronic
1158259087 18:55588061-55588083 TCCGTGCACCGCCGGCGCCGAGG + Intronic
1162380430 19:10328706-10328728 TGTGTGGACCGCCTGCCACCTGG - Exonic
1163534453 19:17869175-17869197 TGGGAGGATCGCCAGAGCCCGGG - Intergenic
1163723403 19:18909109-18909131 TGCCTGGACCGCCTGCTCTCCGG + Intronic
1164017969 19:21269584-21269606 TGTGCCGACAGCCAGCGCCCTGG - Intronic
1164279664 19:23758581-23758603 TGCGCTGACAGCCAGCCCCCCGG - Intronic
1164939627 19:32242804-32242826 TGCGTGGACAGCCAGCATCTGGG + Intergenic
1165172906 19:33906249-33906271 TGCGCGGCCCGCCAGGGTCCGGG + Intergenic
1166084414 19:40465611-40465633 TGCTTGCACCGCCTGCGCCAGGG + Exonic
927787987 2:25987281-25987303 TGGGAGGACCCCTAGCGCCCAGG + Intergenic
928910765 2:36418512-36418534 TGGGTGGACTGCCTGAGCCCAGG - Intronic
929560655 2:42954402-42954424 TCAGTGGAGCGCCAGCTCCCAGG - Intergenic
930476701 2:51891486-51891508 TGCCTGTACCACCAGGGCCCTGG - Intergenic
930753367 2:54953037-54953059 TGCCTGGACCCCCTGTGCCCTGG + Intronic
931201007 2:60097290-60097312 TGCTTGGCACGCCAGTGCCCAGG + Intergenic
932618975 2:73254871-73254893 TGCCTGTACCTCCAGCCCCCAGG - Exonic
932913839 2:75834017-75834039 TGCCTAGACCGCCAGGGCCCTGG + Intergenic
935271228 2:101436006-101436028 TAAGTGGGCCACCAGCGCCCTGG + Intronic
935301728 2:101698339-101698361 CGCGCGGTCCCCCAGCGCCCGGG - Intronic
935325791 2:101935695-101935717 TGCCTGCACCACCAGGGCCCTGG + Intergenic
941107606 2:161375802-161375824 TGAGTGGATCGCTAGAGCCCAGG + Intronic
942042739 2:172081614-172081636 TTCGTGGACTGCCAGAGGCCCGG - Exonic
944235430 2:197437621-197437643 TGGGAGGATCGCCAGAGCCCAGG - Intergenic
1168904604 20:1393039-1393061 GGCGTGGACCAACAGCGACCTGG + Exonic
1168938747 20:1690941-1690963 TGCCTAGACCACCAGGGCCCTGG + Intergenic
1171382432 20:24743742-24743764 TGTGTGGACCACAAGCTCCCAGG + Intergenic
1172037312 20:32019143-32019165 AGCTTGGAGCGCCAGCGCGCCGG + Exonic
1173075915 20:39819075-39819097 TGCCTGGTCAGCCAGAGCCCAGG + Intergenic
1173832044 20:46096352-46096374 TGGGAGGATCGCCTGCGCCCAGG - Intergenic
1180923203 22:19533249-19533271 TGGGTGGACCGCTTGAGCCCAGG + Intergenic
1182788125 22:32924997-32925019 TGGGTGGACCGCTTGAGCCCAGG + Intronic
1184472336 22:44702816-44702838 AGCGAGGCCCGCCAGCGCCCGGG + Intronic
950644314 3:14368059-14368081 TGTGTGGACTGCTAGAGCCCTGG - Intergenic
953879947 3:46686407-46686429 TGCGTTCACCACCAGCTCCCGGG + Exonic
961071235 3:123929528-123929550 TGGGTGGATCGCCTGGGCCCAGG - Intronic
961464259 3:127071910-127071932 TCCTTAGACAGCCAGCGCCCCGG + Intergenic
963014013 3:140803399-140803421 TGCCTGTACCACCAGGGCCCTGG - Intergenic
963298408 3:143572981-143573003 TGCGTGGTCCCCCAGAACCCAGG + Intronic
966774820 3:183534628-183534650 TGGGTGGATCGCCTGAGCCCAGG - Intronic
967073313 3:185980962-185980984 TGGGTGGATCGCCTGAGCCCAGG + Intergenic
968579289 4:1382458-1382480 TGCAGGGCCCGTCAGCGCCCAGG + Intronic
969033573 4:4232335-4232357 TGGGTGGACCGCTTGGGCCCAGG + Intergenic
969550496 4:7863186-7863208 TGTGTGGACTGCCTGAGCCCAGG + Intronic
969696087 4:8735637-8735659 TGTGAGGACCTCCAGTGCCCAGG - Intergenic
972391504 4:38618003-38618025 TGGGGGGACCGCTAGAGCCCAGG - Intergenic
972434687 4:39021309-39021331 TGGGTGGACCGCTTGAGCCCTGG + Intronic
975429134 4:74267660-74267682 TGGGAGGATCGCCAGAGCCCAGG - Intronic
975624845 4:76335798-76335820 TGCGTGGATCGCCTGAGTCCAGG - Intronic
981885288 4:149666454-149666476 TGCCTGCACCACCAGGGCCCTGG + Intergenic
993381902 5:87217981-87218003 TGCCTGCACCACCAGGGCCCTGG - Intergenic
994005206 5:94829081-94829103 TGCCTACACCGCCAGGGCCCTGG - Intronic
997519566 5:134514064-134514086 TGGATGGATCGCCTGCGCCCAGG - Intergenic
1002928867 6:1620168-1620190 TGCGTCGGCCGCGAGCCCCCGGG - Intergenic
1007863771 6:44944529-44944551 TGGGTGGACCGCTTGAGCCCAGG + Intronic
1008622440 6:53284076-53284098 TGGGAGGACTGCCAGAGCCCAGG + Intronic
1009396972 6:63211494-63211516 GGCGTGGACCGACAGCGACCTGG - Exonic
1012553729 6:100488042-100488064 TGCTTGGAACCCCAACGCCCTGG - Intergenic
1012907637 6:105086642-105086664 TGGGTGGACTGCCTGAGCCCAGG - Intergenic
1013367560 6:109447231-109447253 TGCGTGGACCCCCAGGACACAGG + Intronic
1018070630 6:160161463-160161485 TCCCTGGACCGCCAGACCCCCGG - Intergenic
1019289985 7:245691-245713 TGCGTGGACCGGCACCTCACAGG + Intronic
1019768120 7:2866192-2866214 TGAGAGGACCGCTTGCGCCCTGG - Intergenic
1025946456 7:66108521-66108543 TGGGAGGATCGCCAGAGCCCAGG + Intronic
1026856927 7:73761302-73761324 TGAGAGGATCGCCAGAGCCCAGG + Intergenic
1027361583 7:77415915-77415937 TGAGGGAACCGCCAGCGGCCCGG + Intronic
1027790345 7:82633414-82633436 TGCCTGCACCACCAGCGCCCTGG + Intergenic
1034443615 7:151100747-151100769 TGCGAGGATCGCCTGAGCCCAGG + Intronic
1036725636 8:11218442-11218464 TGCGTGGATCGCTTGAGCCCAGG + Intergenic
1042359549 8:67867349-67867371 TGAGGGGACCTCCAGCACCCCGG + Intergenic
1045975146 8:108123139-108123161 TGCCTGTACCACCAGGGCCCTGG - Intergenic
1046819575 8:118621245-118621267 TGCTTATACAGCCAGCGCCCCGG - Intronic
1047270421 8:123352292-123352314 TGTGTGGACTCCCAGCTCCCAGG - Intronic
1049466562 8:142753592-142753614 GGCCTTGACCGCCAGGGCCCAGG - Intergenic
1053004308 9:34593987-34594009 TGCTTGGGCCGCCTGGGCCCAGG + Intergenic
1053608209 9:39681503-39681525 TGCCTGCACCACCAGGGCCCTGG - Intergenic
1053866049 9:42437863-42437885 TGCCTGCACCACCAGGGCCCTGG - Intergenic
1054245322 9:62660906-62660928 TGCCTGCACCACCAGGGCCCTGG + Intergenic
1054559450 9:66695437-66695459 TGCCTGCACCACCAGGGCCCTGG + Intergenic
1059216010 9:112562891-112562913 TGGGAGGACCGCCTGAGCCCAGG - Intronic
1061383326 9:130272783-130272805 TGGGTGGACCGCTTGAGCCCAGG - Intergenic
1062365143 9:136204848-136204870 TGCGTGCAGGGCCAGCGGCCAGG - Intronic
1062429455 9:136520504-136520526 TGGGTGGATCGCTTGCGCCCAGG + Intronic
1190854268 X:54277863-54277885 TGGGTGGACCGCTTGAGCCCGGG + Intronic
1193949286 X:87778439-87778461 TGCCTACACCACCAGCGCCCTGG + Intergenic
1195658076 X:107352284-107352306 TGCGTGGAGTGCCAGGGCCATGG - Intergenic
1196462548 X:115945162-115945184 TGGGTGGACCGCCTGCGGTCAGG + Intergenic
1197198213 X:123724983-123725005 TGGGAGGATCGCCAGAGCCCAGG + Intronic