ID: 1156343354

View in Genome Browser
Species Human (GRCh38)
Location 18:36233070-36233092
Sequence GGTACATGGGTAAGTTCTTT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 260
Summary {0: 1, 1: 2, 2: 38, 3: 61, 4: 158}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156343354 Original CRISPR GGTACATGGGTAAGTTCTTT AGG Intronic
902890423 1:19439309-19439331 TGTACATGGGTATGTTCTACAGG - Intronic
908150412 1:61295476-61295498 GGTACATTGGATAATTCTTTCGG + Intronic
908254199 1:62289279-62289301 GATACCTGGGCAAGTGCTTTAGG - Intronic
909191587 1:72559128-72559150 GGCACATGAGTAAGTTCTCCTGG + Intergenic
909763042 1:79317382-79317404 GTTATACGGATAAGTTCTTTAGG + Intergenic
911746397 1:101446008-101446030 GTTACATGGATAAGTTCTTTAGG + Intergenic
911900560 1:103497951-103497973 GGTACATGGTTGAGACCTTTAGG - Intergenic
912658048 1:111505222-111505244 AGTACATAGGTGAGTTCTTTTGG + Intronic
913050877 1:115115561-115115583 GGGACCAGGATAAGTTCTTTTGG + Intergenic
913185545 1:116367592-116367614 AGCACATGGGTAAGGTCTTCAGG - Intergenic
913339246 1:117741396-117741418 CTTACATGAGTAAGCTCTTTAGG + Intergenic
915274520 1:154778927-154778949 GGTACATGGCTAAGTTCAGACGG - Intronic
915744900 1:158148381-158148403 GGCACATGGGTTAGTTCCCTGGG - Intergenic
917410696 1:174757199-174757221 GGTACAGGGGAAAGTTCTAGTGG - Intronic
919397222 1:197066432-197066454 TGTACATGGGTATGTTGTTCAGG - Intronic
920513383 1:206566945-206566967 GGGACATGAGCAAGTACTTTAGG + Intronic
920800747 1:209185147-209185169 GTTACATGAATAAGGTCTTTAGG - Intergenic
924044672 1:240015234-240015256 GGTACATCTGTAAGTTTTCTTGG + Intronic
1063735568 10:8749859-8749881 GTTACATGCCCAAGTTCTTTAGG + Intergenic
1063751261 10:8950609-8950631 GTTACATGGATAGGTTCTTTAGG + Intergenic
1065248603 10:23786149-23786171 GGTACAGGGGGAAGTTCTTATGG + Intronic
1065615811 10:27521791-27521813 GTTACATGGATAAGTTCTTTAGG - Intronic
1066587831 10:36957254-36957276 GGAACATGGACAATTTCTTTTGG - Intergenic
1071271253 10:84009701-84009723 GTTCCTTGGGTTAGTTCTTTGGG - Intergenic
1071911124 10:90234981-90235003 GTTACATGAGTAAGTTCTTTGGG - Intergenic
1072178300 10:92952281-92952303 GAGACATGGGGAATTTCTTTGGG - Exonic
1072528641 10:96297461-96297483 GTTACATGGATAAGTTGTTTAGG + Intergenic
1074642580 10:115404097-115404119 GGTAAATGTTTGAGTTCTTTTGG + Intronic
1076625686 10:131820287-131820309 GTTACATGGGTAAGTTCTTTAGG + Intergenic
1078841865 11:15084669-15084691 GTTACGTGGATAAGTTCTTTAGG + Intergenic
1079634485 11:22718608-22718630 ATTACATGGCTAAGTTCTTTAGG - Intronic
1079964430 11:26963793-26963815 GGTAAATGGCTAATTTTTTTTGG - Intergenic
1080270457 11:30446012-30446034 TGTACATGTGTACGTTCTTGAGG + Intronic
1080706376 11:34698905-34698927 GTTACATGGATAAGTTCTTTAGG - Intergenic
1084994140 11:72958875-72958897 TGGAAATGGGTAAGTTGTTTTGG - Intronic
1088581065 11:111317409-111317431 GTTACATGTATAAGTTCTTCAGG - Intergenic
1088928937 11:114329577-114329599 GTTACATGAATAAGTTCTTTAGG - Intergenic
1091732147 12:2889274-2889296 GGGACATAGATGAGTTCTTTAGG + Exonic
1092082767 12:5731656-5731678 GGGACATGGGGATGCTCTTTGGG - Intronic
1094140117 12:27172223-27172245 GGTACATGGCTCATTTCATTGGG - Intergenic
1097849421 12:64396839-64396861 GGTGCATGGACAAGTTCTTGTGG - Intergenic
1098877026 12:75876557-75876579 GTTACATGGATGAGTTCTTTAGG - Intergenic
1099391921 12:82092040-82092062 GTCACATGAATAAGTTCTTTAGG + Intergenic
1100007570 12:89912482-89912504 GTTACATGGATAAATTCGTTAGG + Intergenic
1100287724 12:93183303-93183325 GGTACATGGGCAGGTTATGTAGG + Intergenic
1100603171 12:96129789-96129811 AGCACATGGGAAAGTGCTTTGGG - Intergenic
1100953752 12:99882740-99882762 ATTACATGGATAAGTTCTTTAGG - Intronic
1105831458 13:24165900-24165922 AGTACATGTGCAAGTTGTTTAGG - Intronic
1107233240 13:38136908-38136930 GTTACATGGGTATGTTGTGTGGG + Intergenic
1107588413 13:41877680-41877702 GTTAAATTGGTAAGTTCTCTTGG - Intronic
1108817410 13:54308405-54308427 GTTACACGAGTAAGTTCTTTAGG - Intergenic
1109211105 13:59537263-59537285 GGTACCTTGTTTAGTTCTTTTGG + Intergenic
1111184478 13:84713896-84713918 GTTACATGGACAAGTTCTTAAGG + Intergenic
1113703165 13:112403470-112403492 GTTACATGAATAAGTTCTTTAGG + Intronic
1114396609 14:22368883-22368905 GTTACATGGGTCCATTCTTTAGG - Intergenic
1114797233 14:25730024-25730046 GTTACATGGGTATGTTTGTTTGG - Intergenic
1115211894 14:30975494-30975516 GTTGCATGGAAAAGTTCTTTTGG - Intronic
1118062017 14:62149900-62149922 GTTACATGAGTAAGTTCTTTAGG - Intergenic
1119091923 14:71790848-71790870 ATTACATGGATAAGTTCTTTAGG + Intergenic
1119636216 14:76275557-76275579 GAAACATGAGTATGTTCTTTGGG + Intergenic
1126286220 15:47014580-47014602 GTTACATGAGTCAGTTCTTTAGG + Intergenic
1130916230 15:88307249-88307271 CCTACATTTGTAAGTTCTTTGGG + Intergenic
1131565092 15:93478565-93478587 GGTAAATGGGTAGGGTCTTGAGG - Intergenic
1133457258 16:5953386-5953408 GTTACATGAGTAAGTTCTTTAGG + Intergenic
1133552848 16:6874855-6874877 CTTACATGGGTAAGTTCATTGGG - Intronic
1135898308 16:26430745-26430767 GTTACATGAGTAAGTTCTTTAGG - Intergenic
1136995342 16:35185112-35185134 GTTACATGAGTAAGTTTTTTTGG - Intergenic
1138854179 16:60667901-60667923 AGTACATGGGTAAGTTCAAAGGG - Intergenic
1140293080 16:73682358-73682380 GGCACATGGGAATGTTGTTTTGG + Intergenic
1140547817 16:75828173-75828195 GTTACATGAATAAGTTCTTTAGG + Intergenic
1146430328 17:32787332-32787354 TTTACATGGGTAAGTTCTTTAGG + Intronic
1148966077 17:51437311-51437333 GTTACATGAGTAAGTTCTTTAGG + Intergenic
1149279948 17:55092253-55092275 GTTACATGGATAAGTTCTTTAGG - Intronic
1150724418 17:67640041-67640063 GGTACATCGTTAAGTTCACTTGG + Intronic
1150955001 17:69848052-69848074 GTTACATAAGTAAGTTCTTTAGG - Intergenic
1151240552 17:72754388-72754410 GTTACATGAGTAAGTTCTTTAGG - Intronic
1153185581 18:2482318-2482340 GGTATAGGGGTAAGTTAATTTGG + Intergenic
1153338428 18:3948864-3948886 GTTACATGAGTAAGTTCTTTGGG - Intronic
1153446635 18:5180097-5180119 GGAAGATGGGTCAATTCTTTTGG - Intronic
1155004719 18:21718335-21718357 GTTACATTAGTAAGTTCTTTAGG - Intronic
1155225214 18:23723926-23723948 GTTACATTAGTAAGTTCTTTAGG + Intronic
1155375258 18:25150376-25150398 GTTACGTGAGTAAGTTCTTTAGG - Intronic
1155529113 18:26747882-26747904 GGTACATGTATTAGTTTTTTGGG + Intergenic
1155921265 18:31605298-31605320 GGTACATGATTAAGTCCTTTAGG - Intergenic
1156021108 18:32600002-32600024 CTTACATGGATAAGTTCTTTGGG - Intergenic
1156343354 18:36233070-36233092 GGTACATGGGTAAGTTCTTTAGG + Intronic
1158118117 18:54019189-54019211 GGTAGACGGGAAAGTTCTCTTGG - Intergenic
1159955217 18:74514143-74514165 GGTACATATGTAAGTTCTGCAGG + Intronic
1165744612 19:38223330-38223352 GATACATGGGTAAGTGCCTAGGG - Intronic
1166648507 19:44551857-44551879 GTTACATGAGTAAGTTCTTTGGG - Intergenic
926866499 2:17365070-17365092 GCTACATGGGTAATTTCTTTAGG + Intergenic
926869260 2:17394478-17394500 GTTACATGAATAAGTTCTTTTGG - Intergenic
927327893 2:21827491-21827513 GTTACATGAGTAAGTTCTTTAGG + Intergenic
932446181 2:71782894-71782916 GGTGCATGGGTTGGATCTTTGGG + Intergenic
934288961 2:91674404-91674426 GGTACTTGGGCAAGTCCTTCAGG + Intergenic
936771881 2:115923634-115923656 GTTACATGAGTAAGTTCTTTAGG + Intergenic
937216829 2:120318331-120318353 GGTAAATGGGGAAGTTTTTTTGG - Intergenic
938853504 2:135286118-135286140 GTTACATGGATATGTTCTTTAGG + Intronic
939610177 2:144300430-144300452 GTTTTATGTGTAAGTTCTTTGGG - Intronic
940521205 2:154751092-154751114 GTTACATGAGTAAGTTCTTTAGG - Intronic
941131761 2:161659534-161659556 GGTACATGTGTATATTTTTTGGG + Intronic
941430983 2:165413900-165413922 ATTACATAGATAAGTTCTTTAGG + Intergenic
941892125 2:170593444-170593466 TGAACCTGGGTAAGTTGTTTTGG - Intronic
943978774 2:194519042-194519064 GTTATTTGGGTAAATTCTTTAGG - Intergenic
944878595 2:203987957-203987979 GTTACATAAGTAAGTTCTTTAGG - Intergenic
947957629 2:234207430-234207452 AGTATATGGGAAAGGTCTTTTGG + Intergenic
1172858127 20:38024196-38024218 GGAAACTGGGTAAGTTCTTCAGG + Intronic
1174938261 20:54895843-54895865 GTTACATGGATAAGCTCTTTAGG - Intergenic
1176246786 20:64101239-64101261 GGCAGATGGGCAAGTTCTGTAGG + Intergenic
1178733409 21:35126767-35126789 GTTACATGAATAAGTTCTTTAGG - Intronic
1178812313 21:35895489-35895511 GTTTCAAGAGTAAGTTCTTTGGG - Intronic
1181371154 22:22417785-22417807 GTTACATGAGTAAGTTCTTTAGG - Intergenic
1182013480 22:27020101-27020123 GACACTTGGGTTAGTTCTTTAGG + Intergenic
1184799169 22:46749727-46749749 GATACATGGGAAAGTGCTATAGG - Intergenic
951751865 3:26044787-26044809 GTTACATGGATAGGTTCTTTAGG + Intergenic
951823458 3:26840543-26840565 GGGACATGTGTAATTTCCTTAGG - Intergenic
952113314 3:30149536-30149558 GTTATATGAGTAAGTTCTTTCGG + Intergenic
952182761 3:30935830-30935852 GTTACATGAATAAGTTCTTTAGG + Intergenic
953822542 3:46220947-46220969 GTTACATGGATAAGTTCCTTAGG - Intronic
956006454 3:64783647-64783669 GGGAAATGGGGAAGCTCTTTAGG - Intergenic
956205483 3:66750537-66750559 GTTACATGGATGAGTTCTTTAGG - Intergenic
956299256 3:67751969-67751991 GTTACATGAGTAAGTTCTTTAGG - Intergenic
956661607 3:71603366-71603388 GGGACAAGGTTAAGTTCCTTGGG - Intergenic
956861767 3:73331322-73331344 GTTACACGAGTAAGTTCTTTAGG + Intergenic
956995154 3:74818669-74818691 GTTACATGAGTAAGTTCTTTAGG + Intergenic
958002806 3:87772626-87772648 GTTACATGAGTAAGTTCTTTAGG + Intergenic
959947947 3:112147390-112147412 TGTACATGGGTGAGTTTTTGTGG + Intronic
961026860 3:123565957-123565979 GGTAAATGGGGAAGCTCATTTGG - Intronic
961971326 3:130971714-130971736 GGTACTTGGGGGAGTTCTATTGG - Intronic
963383829 3:144565829-144565851 GTTACATGGATAAGTTCTAGGGG + Intergenic
965505154 3:169507285-169507307 GGTAAATGGGTAATTTAATTTGG + Intronic
966668441 3:182499266-182499288 GATACATGTGTAATTTATTTTGG - Intergenic
970319100 4:14858001-14858023 GTTGCATGGGTAAGTTATTTAGG - Intergenic
970813944 4:20131116-20131138 GGGACCAGGGTAAGTGCTTTTGG + Intergenic
971468034 4:26986475-26986497 GGCATATGGCTAAGTGCTTTGGG + Intronic
972719064 4:41677567-41677589 CCAACATGGGTTAGTTCTTTAGG - Intronic
974133284 4:57783377-57783399 GTTACATGGATAAATTCTTTAGG + Intergenic
975217001 4:71767708-71767730 GTTACATGGCTAAGTTCTTTAGG + Intronic
976069234 4:81222288-81222310 GGTAAATAGGTAAGTTCCTATGG + Intergenic
976069250 4:81222397-81222419 GGTAAATAGGTAAGTTCCTATGG + Intergenic
976561356 4:86505264-86505286 GGTACATGGGCAGGTTATATGGG - Intronic
976562220 4:86514893-86514915 GTTACTTGGATAAGTTCTTTAGG + Intronic
976781423 4:88762624-88762646 GGCCCATGGTGAAGTTCTTTAGG + Intronic
976850540 4:89540383-89540405 GGTGCATGTGTGAATTCTTTAGG + Intergenic
978110258 4:104955008-104955030 GGTACATGGGGAAGAGTTTTTGG - Intergenic
979017519 4:115452733-115452755 GGTACCTGGTTAATTTCATTGGG - Intergenic
980232049 4:130057644-130057666 GGTCCATGTGTAGGTTATTTTGG + Intergenic
980493767 4:133564161-133564183 GAGACATGAGTAAGTTTTTTAGG + Intergenic
982628499 4:157800753-157800775 GTTACATGGATGAGTTCTTTAGG + Intergenic
982768243 4:159372023-159372045 GTTACACGAGTAAGTTCTTTAGG - Intergenic
983546519 4:168970532-168970554 GTTACATGGATAAGTTATTTAGG + Intronic
984155617 4:176193027-176193049 GTTCCATGGATTAGTTCTTTAGG + Exonic
986478206 5:8157891-8157913 GATGCATGGGTAAGTTATTTTGG - Intergenic
986815240 5:11402531-11402553 TGTAAATGGGCAAGTTCTTCTGG - Intronic
986983140 5:13472183-13472205 TGAGCATGGGTATGTTCTTTGGG - Intergenic
987316373 5:16728388-16728410 GGTACCTGGGGACTTTCTTTTGG + Intronic
988278007 5:29107958-29107980 GTTACATGGATAAGTTCTTTAGG + Intergenic
988424156 5:31043268-31043290 GTTACATGGATACGTTCTTTAGG - Intergenic
989561671 5:42859191-42859213 GTTACATGAATAAGTTATTTAGG + Intronic
989843829 5:46114339-46114361 GTTACATGGGTATGTTTTTTTGG + Intergenic
990452435 5:55948127-55948149 GGTACAGGGCTAAGAACTTTAGG + Intronic
991418771 5:66418982-66419004 GTTACATGGATAAGTTCTTTAGG + Intergenic
991646818 5:68808496-68808518 GTTACATGGATAAGTTCTTTAGG - Intergenic
992335507 5:75764430-75764452 GTTACATGATTAAGTTCTTTAGG + Intergenic
992480606 5:77148069-77148091 GGTACCTGTGTAAGTCATTTTGG - Intergenic
993277332 5:85877384-85877406 GTTACATGAATAAGTTCTTTAGG + Intergenic
993614239 5:90090862-90090884 TTTATATGGATAAGTTCTTTAGG - Intergenic
993657317 5:90593681-90593703 GTTACATGAGTAAGTTCTTTTGG - Intronic
994069636 5:95585760-95585782 GTTGCATGAATAAGTTCTTTAGG - Intronic
994686108 5:102954198-102954220 GTTACATGGATAAGTTCTTTAGG + Intronic
995443930 5:112222090-112222112 AGAAAATGTGTAAGTTCTTTGGG - Intronic
996295393 5:121908943-121908965 GTTACATGTGTAACTTATTTAGG - Intergenic
996640252 5:125743258-125743280 GTTACATGAATAAGTTCTTTAGG - Intergenic
998651861 5:144129540-144129562 GGTATATGGGTAAGAACTTTGGG + Intergenic
998813264 5:145987240-145987262 GTTACATGCGTAAGTTCTTTAGG + Intronic
999086599 5:148897539-148897561 GTTACATGGATAAGTTATTTAGG - Intergenic
999917909 5:156283986-156284008 TGTACATGGGTAACTTCTTAGGG + Intronic
1000365472 5:160486671-160486693 GGGACATGGGTGTGTTCTCTGGG + Intergenic
1001143792 5:169166831-169166853 GGTACATGGGAAAGTCACTTTGG - Intronic
1008158648 6:48049318-48049340 GAAACATGTGTAAGTTCTCTAGG - Intronic
1009524520 6:64727874-64727896 GGTACCTAGGTAGGTTGTTTTGG - Intronic
1010008254 6:71020219-71020241 ATTACATGGACAAGTTCTTTAGG - Intergenic
1010090527 6:71974992-71975014 GTTACATGAGTAAGTTCTTTAGG - Intronic
1010464974 6:76157181-76157203 GTTACATGGTTAAGTTCTTTAGG + Intergenic
1010578128 6:77559597-77559619 GTTAAATGCATAAGTTCTTTAGG - Intergenic
1013148519 6:107420053-107420075 AGTAGATAGGTAAGTTCTTAAGG - Intronic
1013950949 6:115781262-115781284 TGTACATGTGAAAGTACTTTAGG + Intergenic
1014749432 6:125238401-125238423 GTTACATGGATAAGTTTTTCGGG + Intronic
1016822022 6:148355920-148355942 GTTACATGAATAAGTTCTTTAGG + Intronic
1024505802 7:50160280-50160302 AGTAAATGTGTAAATTCTTTTGG + Intergenic
1024827757 7:53412393-53412415 GTTATATGCATAAGTTCTTTAGG - Intergenic
1026511629 7:71032157-71032179 GTTACATGAGTAAGTTCTTTAGG + Intergenic
1028144210 7:87304154-87304176 GGTACATGGGTCATCTCATTGGG + Intergenic
1029152927 7:98493642-98493664 GTTACATGAGTAAGTTCTTTAGG + Intergenic
1030890859 7:114997262-114997284 GGTACATGGTTGAGTGCTATTGG + Intronic
1031846646 7:126813124-126813146 GGTACATGCGTAGGTTATATAGG - Intronic
1032829305 7:135607037-135607059 GATGGATGGGTCAGTTCTTTAGG + Intronic
1033027307 7:137787983-137788005 GTTACATGAATAAGTTCTTTAGG - Intronic
1033277902 7:139986411-139986433 GTTACATGAGTAAGTTCTTTAGG + Intronic
1033469536 7:141632437-141632459 GGTTCATGTGTGAATTCTTTGGG + Intronic
1033727796 7:144138747-144138769 GGCACAAGGGTAGGCTCTTTAGG - Intergenic
1034140679 7:148812684-148812706 AGTACAATGGTAAGTTGTTTGGG + Intronic
1034400228 7:150857180-150857202 GGTACAACGGGAAGTTCTATGGG + Exonic
1035861770 8:3036865-3036887 GTTACATGGATAAGTTATCTAGG + Intronic
1037721753 8:21450304-21450326 GGAACATAGGGAAGTTCTCTGGG - Intergenic
1039127820 8:34223497-34223519 GGTACATGTGTAGGTTGTGTAGG + Intergenic
1039132159 8:34277975-34277997 GATAAAGGGGTAAGTTATTTAGG + Intergenic
1039653643 8:39374024-39374046 GCTACATGGATAAGTTCGTTAGG - Intergenic
1042166945 8:65955104-65955126 GGTAGATGTGTAAGGTCTTAGGG - Intergenic
1042803006 8:72741464-72741486 ATTGCATGGATAAGTTCTTTAGG + Intronic
1043251955 8:78086255-78086277 GTTACATGGATAAGTTATTTAGG + Intergenic
1043551737 8:81381063-81381085 GGTACATGTGAAATTTCATTAGG + Intergenic
1043611237 8:82065949-82065971 GTTACATTTTTAAGTTCTTTAGG - Intergenic
1044112487 8:88292338-88292360 TGTATATGGGTATGTTCTTAGGG - Intronic
1044462692 8:92464396-92464418 GTTACATGGATAAGTTCTTCAGG - Intergenic
1045161884 8:99557185-99557207 GTTACATGTATAAGTTATTTAGG + Intronic
1045813654 8:106254321-106254343 GTTACATGAATAAGTTCTTTAGG + Intergenic
1045880408 8:107031169-107031191 GGTACTTGTGAAAGTTCCTTTGG - Intergenic
1045963516 8:107997186-107997208 GGTAGATGGAGAAGTTCTTGTGG - Intronic
1047226842 8:122962171-122962193 GTTACATGGATAAGTTCTTTAGG + Intronic
1047891983 8:129322821-129322843 TGTAGATGGATAAGATCTTTTGG + Intergenic
1050316907 9:4411724-4411746 TGTCCATGGGTTATTTCTTTGGG - Intergenic
1052030479 9:23622543-23622565 GGTATATGAGTAACTTTTTTTGG - Intergenic
1053516000 9:38731383-38731405 GGAACATGAGTCATTTCTTTAGG - Intergenic
1055124767 9:72706431-72706453 GTTAAATGAGTAAGTTCTTGGGG + Intronic
1055135336 9:72823080-72823102 GTTACTTGAGTCAGTTCTTTAGG + Intronic
1055245076 9:74230058-74230080 GTTACATGGATAAGTTCTTTAGG - Intergenic
1055847049 9:80578095-80578117 ATTACATGGATAAGTTCTTGTGG - Intergenic
1056147025 9:83742258-83742280 GATACAGGGTTAAGTTCTATTGG + Intronic
1056309926 9:85330110-85330132 GTTACATGGATAAGTTCTTTAGG - Intergenic
1057644855 9:96863956-96863978 CTTACATGGATAAGTTGTTTAGG - Intronic
1058087904 9:100770120-100770142 GTTACATGAGTAAGTTCTTTAGG + Intergenic
1061339411 9:129967191-129967213 GGAACATGGATAAGGACTTTGGG + Intronic
1186703523 X:12117335-12117357 GTTCCATGGATATGTTCTTTAGG + Intergenic
1188176673 X:26999246-26999268 ATTACATGGATAAGTTCCTTAGG - Intergenic
1188852062 X:35144217-35144239 TGTACATGGGTTAGTTCAGTAGG - Intergenic
1189729892 X:44008766-44008788 GTTACATGGATAAGTTCTTTAGG - Intergenic
1190505781 X:51125023-51125045 GGTACATGGTTCATTTCATTTGG + Intergenic
1191199315 X:57762332-57762354 ACTACATGGGTAAGTCCTATCGG - Intergenic
1192216809 X:69164932-69164954 GGTAAATGGTTAAGATTTTTAGG - Intronic
1192877089 X:75242015-75242037 GTTACATGGATAAATTCTTTAGG - Intergenic
1192889592 X:75375441-75375463 GGTACATGTGCAGGTTCGTTAGG + Intronic
1193010550 X:76670825-76670847 GGTACATGGGTCATCTCATTGGG + Intergenic
1193190644 X:78566119-78566141 GTTACATGAATAAGCTCTTTAGG + Intergenic
1193251535 X:79296796-79296818 GTTACATGAATGAGTTCTTTAGG - Intergenic
1193383158 X:80840475-80840497 GTTACATGGATAAGTTATTTAGG - Intergenic
1193432935 X:81434243-81434265 GGTACATGTGTAAGTTTGTTAGG + Intergenic
1193695110 X:84699120-84699142 GTTACATAGATAAGTTCTTTAGG + Intergenic
1193736855 X:85167344-85167366 GTTACATGTATAAGTTATTTAGG - Intergenic
1194291218 X:92073691-92073713 GTTGAATGGGTCAGTTCTTTAGG + Intronic
1194606127 X:95980800-95980822 GCTACATGAATAAGTTCTTTAGG + Intergenic
1195014079 X:100761370-100761392 GTTACATGGGTAAGTTCTTTAGG - Intergenic
1195321269 X:103723886-103723908 TGTCCATGGGGAAGTTCTTGAGG + Exonic
1195839062 X:109151964-109151986 GTTACATGAATAAGTTCTTTAGG - Intergenic
1196947585 X:120843182-120843204 ATTACATAAGTAAGTTCTTTAGG + Intergenic
1199588794 X:149446157-149446179 GGTACATGTGCAAGTTATGTAGG + Intergenic
1200418836 Y:2941343-2941365 TGTACATGATTAACTTCTTTTGG + Intronic
1200608732 Y:5298274-5298296 GTTGAATGGGTCAGTTCTTTAGG + Intronic
1201320773 Y:12695981-12696003 GGCCCATGGGGAAGTTCTGTGGG - Intergenic
1201381996 Y:13390918-13390940 AGTACATATGTAGGTTCTTTTGG - Intronic