ID: 1156347180

View in Genome Browser
Species Human (GRCh38)
Location 18:36268249-36268271
Sequence TGCAGGAAGTTCAGGGCATG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 276
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 253}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156347174_1156347180 19 Left 1156347174 18:36268207-36268229 CCTGATGGTGGTCACAAGCTGAG 0: 1
1: 0
2: 2
3: 19
4: 160
Right 1156347180 18:36268249-36268271 TGCAGGAAGTTCAGGGCATGTGG 0: 1
1: 0
2: 1
3: 21
4: 253

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156347180 Original CRISPR TGCAGGAAGTTCAGGGCATG TGG Intronic
900468816 1:2840604-2840626 GGCAGGAAGTTCAAAGCCTGGGG + Intergenic
903808681 1:26022575-26022597 AGCAGGAAGAGCAGGGCCTGGGG - Exonic
904827853 1:33286671-33286693 TCCTGGGAGTTCTGGGCATGTGG - Intronic
905627322 1:39497763-39497785 GGCAGGAAGTTGAGGGAAAGAGG + Intronic
907373987 1:54020720-54020742 TCCAGGAAGTTCAAGGATTGAGG - Intergenic
907398935 1:54212530-54212552 TCCAGTAAGTACAGGGTATGGGG - Exonic
909152002 1:72018748-72018770 TGCAGTGAGCTCAGGGCAGGAGG + Intronic
915795727 1:158731667-158731689 TGCAGCAATTTCAGAGCATGGGG - Intergenic
917415073 1:174800448-174800470 TGCTGGAACTTCTGGGGATGGGG + Intronic
917738486 1:177941256-177941278 GGCAGAAACTTCAGGGTATGGGG + Intronic
918626093 1:186657637-186657659 AACAGGAAATTCAGTGCATGTGG - Intergenic
919080532 1:192860532-192860554 TGCAGGGAGTTCAGAGAAAGGGG - Intergenic
920055313 1:203186707-203186729 TAAAGGAAGTACAGGGCCTGGGG - Exonic
920692860 1:208159952-208159974 TGCAGTGAGCTCAGGACATGGGG + Intronic
920809208 1:209266316-209266338 AGAAGGAACCTCAGGGCATGTGG + Intergenic
923744601 1:236688079-236688101 TGAAGGAAGTACGAGGCATGAGG + Intronic
1063006951 10:1981198-1981220 TGCAGGAAGTTCTGTGCCTCGGG - Intergenic
1064067918 10:12199400-12199422 TGAAGGGAGGTCAGGGCATAGGG - Intronic
1064211961 10:13367154-13367176 TACAGGAATTTCAGAGCAGGAGG - Intergenic
1064954383 10:20891588-20891610 TGCAGAACGTTCAGGACAGGAGG + Intronic
1065563885 10:26989858-26989880 TCCAGGAAGTTCAGAGGAGGCGG + Intergenic
1066416111 10:35223441-35223463 GGCAGGACTTTCAGGGCATAAGG + Intergenic
1067156660 10:43787067-43787089 TGCAGGATGTTGAGGGCCTGTGG + Intergenic
1067249179 10:44572822-44572844 TGCAGGTTGTTCAGGACGTGTGG - Intergenic
1067909826 10:50334997-50335019 TCAAGGGAGTACAGGGCATGAGG + Intronic
1068036307 10:51764345-51764367 TGAAGAAAAGTCAGGGCATGAGG - Intronic
1069947565 10:71998503-71998525 TGCAGGAAGTGCAGGACCTCAGG - Intronic
1070512671 10:77175812-77175834 GGCAGGAAGTACAGGGAAAGGGG + Intronic
1072628800 10:97131652-97131674 TTCAGGAAGTTCTGTGCTTGGGG - Intronic
1076712417 10:132345669-132345691 GGCAGGTAGCTGAGGGCATGGGG + Intronic
1076825582 10:132965719-132965741 GGCAGGAAGGTAATGGCATGAGG - Intergenic
1077549504 11:3193785-3193807 AGCAGAAAGTCCAGGGGATGTGG + Intergenic
1079077579 11:17393554-17393576 AGCAGGCAGTTCAGGGCAAGGGG - Intronic
1081337056 11:41879808-41879830 TGCAGGAAGCTCTGGCCATTGGG + Intergenic
1081630040 11:44683053-44683075 TGCAAGAAGATAAGGGCACGGGG + Intergenic
1081678080 11:44982661-44982683 TGAAGGGGGTTCAGGGCATGGGG - Intergenic
1081723140 11:45304583-45304605 GGCAGGAAGCTCAGGGACTGGGG + Intergenic
1081870068 11:46379368-46379390 GGCAGGAAGTTCAGGGCTCTGGG - Intronic
1083054093 11:59803136-59803158 TGCAGGGAGATAAGTGCATGTGG - Intergenic
1083424266 11:62574982-62575004 TGCAGGAAGTTCTGGGGGAGGGG + Intronic
1083800523 11:65044018-65044040 TGCAGGAAGTCAAGAGCCTGAGG + Intronic
1084768687 11:71328682-71328704 TGCAGGAAGGTCTGGGCTGGGGG - Intergenic
1086454514 11:86947986-86948008 TGCCGGCAATTCAGGGCTTGGGG - Exonic
1087892959 11:103556113-103556135 TCCCGGAAGGTCAGGGAATGGGG - Intergenic
1088926507 11:114308313-114308335 TGCAGGAACTTCTGAGGATGGGG + Intronic
1091532571 12:1373885-1373907 TACAGAAAATTCAAGGCATGTGG - Intronic
1092523576 12:9295922-9295944 TGGAGGAAGTTCAGGGCAGCGGG - Intergenic
1092543720 12:9435977-9435999 TGGAGGAAGTTCAGGGCAGCGGG + Intergenic
1092662940 12:10758465-10758487 GGCAGAATATTCAGGGCATGAGG + Intergenic
1094509223 12:31086074-31086096 TGGAGGAAGTTCAGGGCAGCGGG - Intronic
1096278526 12:50231635-50231657 TTCAGAAATTCCAGGGCATGTGG - Intronic
1101616698 12:106344894-106344916 TGCAGGAAGGGCAGGGAAGGTGG + Intronic
1102061570 12:109936035-109936057 TTCAGGAAGGTCAGGGGCTGGGG + Intronic
1102243714 12:111341872-111341894 TGCAGGAGGCTCAGGTCCTGGGG - Exonic
1103895422 12:124269943-124269965 TTCAGCACGTTCTGGGCATGGGG - Intronic
1104586542 12:130052537-130052559 TGAAGGAAGCTCAGGGCAGCTGG + Intergenic
1104809474 12:131611768-131611790 TGCAGGGAGGACAGGGCCTGGGG - Intergenic
1104923205 12:132301732-132301754 TGAAGGTTGTGCAGGGCATGGGG - Intronic
1105913280 13:24890998-24891020 TGCAGTAAATTAAGGACATGAGG - Intronic
1106505966 13:30370680-30370702 GGCAGGCACTTCAGGCCATGGGG - Intergenic
1110046973 13:70842984-70843006 AACAGGAAGTTCAGGGCACTGGG + Intergenic
1113445929 13:110366858-110366880 TGCAGGCAGCTCAGGGCCTCAGG - Intronic
1117470845 14:56042983-56043005 CGCAGGAAGCTGAGGGAATGAGG + Intergenic
1119292843 14:73509329-73509351 TGCATGATGTTCCGGGCAAGGGG + Exonic
1119599549 14:75966107-75966129 TGCAGAAGGATCAGGGCAAGAGG + Intronic
1119896108 14:78221128-78221150 TGGTGGAAGTTCAGGGGATGAGG + Intergenic
1120694611 14:87630712-87630734 TACAGTAAGTACAGGGCCTGAGG + Intergenic
1120988882 14:90357431-90357453 TGCAGGCTCTTCAGGGCAGGTGG - Intergenic
1121255951 14:92530694-92530716 TGCAGGGAGTTCAGGGGCTAGGG - Intronic
1121474328 14:94182424-94182446 TGCAGGAAGTACAGGGCACTGGG - Intronic
1122796319 14:104207904-104207926 TGCAGGAATTTCTAGGGATGGGG - Intergenic
1122829656 14:104389598-104389620 TCCAGGAAGGCCAGGGCCTGTGG - Intergenic
1122983223 14:105200827-105200849 TGCAGGGAAATCAGGGCGTGAGG - Intergenic
1124443150 15:29704248-29704270 TTCAGGAACTTGAGGCCATGGGG + Exonic
1125530735 15:40411855-40411877 TCCAGGAAGTCCAGGGCAGATGG + Intronic
1127293104 15:57587854-57587876 TGCTTGAACTTCAGGGCAGGAGG - Intergenic
1127372701 15:58355833-58355855 TGGAGGAAGTTAAGCGCCTGTGG + Intronic
1127933141 15:63610907-63610929 TGCAGTAAGTTCTGGGTTTGAGG + Intronic
1128865497 15:71112073-71112095 TTCTGGGAGTTCAGGGCATGTGG - Intronic
1130194013 15:81762129-81762151 TGCAGGAGTTTCTGGCCATGTGG + Intergenic
1130869745 15:87961168-87961190 TCCAGGAAGCCCAGGGCATATGG + Intronic
1131053978 15:89364913-89364935 TGGAAGAAGTTCAGGGCAAGCGG + Intergenic
1131055063 15:89370210-89370232 GGCAGGGAGTGCAGGGCAAGGGG - Intergenic
1131799122 15:96051747-96051769 TACAGAAAGTTCAGTGCAGGAGG - Intergenic
1132125331 15:99218759-99218781 CCAAGGAAGTTCAGGACATGGGG - Intronic
1135085874 16:19474110-19474132 TTCAGGAACTGCAGGGGATGGGG - Exonic
1138867080 16:60834864-60834886 TCTAGGAAGGTCAGGGCAAGGGG + Intergenic
1139368816 16:66452075-66452097 AGCATGAGGTTCATGGCATGTGG - Intronic
1140277355 16:73522608-73522630 GGCAGGAAATTTAGGGCAAGAGG + Intergenic
1140972521 16:80027347-80027369 TCCAGGAAGCTCTGGGCTTGCGG + Intergenic
1141268437 16:82517914-82517936 TGCAGAATGTGCAGGGCCTGGGG + Intergenic
1141379155 16:83560028-83560050 TGCAGGAAGTTGAAGCGATGAGG - Intronic
1142713943 17:1737928-1737950 AGCAGGAAGTTAAGAGCAGGAGG + Exonic
1142744347 17:1948253-1948275 TGCAGGAAGCCCAGGGCCCGTGG + Intronic
1143074035 17:4324545-4324567 TGCAGGAAATCTAGGGGATGTGG + Intronic
1144244973 17:13353616-13353638 TGGAGGAAGAGCAGGGCAGGAGG + Intergenic
1146208294 17:30922738-30922760 TGGAGGCAGTTCAGGGCCCGGGG - Intronic
1146428932 17:32772620-32772642 AGCAGGTAGGGCAGGGCATGTGG + Intronic
1148904053 17:50900353-50900375 CTCAGGACATTCAGGGCATGTGG + Intergenic
1149003310 17:51779022-51779044 GGCAGGAAGTACAGAGCCTGGGG + Intronic
1149321353 17:55484848-55484870 TGCAAGAAGTCAATGGCATGAGG + Intergenic
1150969085 17:70006395-70006417 TGAAGGAACTTAAGTGCATGAGG + Intergenic
1152601455 17:81264258-81264280 TGCTGGAAGTACAGGGCTGGAGG - Intronic
1153549313 18:6244725-6244747 GGCTGGAAGTTGAGGGAATGGGG + Intronic
1154470895 18:14699898-14699920 TGCTGGAACTACAAGGCATGAGG + Intergenic
1155882835 18:31171067-31171089 CACAGTAAGTTCAGGGTATGAGG + Intergenic
1156347180 18:36268249-36268271 TGCAGGAAGTTCAGGGCATGTGG + Intronic
1157584467 18:48792282-48792304 TGCAAGAAGTCCAGGTCAGGGGG + Intronic
1157732922 18:50020358-50020380 TGCAGGAAGGTTGGTGCATGTGG - Intronic
1158499877 18:57990854-57990876 TGCAAGAAGATGAGGGAATGGGG + Intergenic
1160718435 19:586959-586981 TGCAGGAAGCTCTGGGCAGGCGG - Intergenic
1161467112 19:4437190-4437212 TGCAGGAGGTTCAGGGGTGGGGG - Intronic
1161995591 19:7709450-7709472 TGAAGGAAGAGCAGGACATGTGG - Intergenic
1162333802 19:10047465-10047487 GGCAGGAAGTTGAGGGCTTGGGG - Intergenic
1162739944 19:12768100-12768122 TGCAGGAACTGCAGGGCCAGCGG - Exonic
1163083338 19:14959668-14959690 TTCAGGAAGGTGAGAGCATGGGG - Intronic
1164591438 19:29509707-29509729 TGCAGGAAGACCTGGGAATGGGG + Intergenic
1164939809 19:32243667-32243689 TGCAGGAAGGTTAGGCCCTGGGG + Intergenic
1166372576 19:42310386-42310408 TGCTGGAGGTGTAGGGCATGGGG - Exonic
1166548209 19:43647338-43647360 TGCAGGGAGTTCTGGCCATCAGG + Intronic
1168136068 19:54352616-54352638 TCCAGGAAGTTCAGGTGGTGAGG - Exonic
925985722 2:9213299-9213321 TGAAGGAAGGTCAGGGTGTGTGG + Intronic
928299891 2:30115800-30115822 TTCAGGAAGTGCTGGGCATTTGG - Intergenic
928360815 2:30660884-30660906 TGTAGTTAGTTCAGGACATGAGG + Intergenic
928421718 2:31142260-31142282 TGCAGGAAACCCAGGACATGCGG - Intronic
928432428 2:31232081-31232103 TGCAGGGATTTCAGGGGAGGGGG - Intronic
929355060 2:41013918-41013940 TGCAGGATATGCAGGGCAAGAGG + Intergenic
931808415 2:65830378-65830400 TGTAGGCAGTCCAGGGCCTGTGG + Intergenic
931899862 2:66776262-66776284 GTCAGGTAGTGCAGGGCATGTGG + Intergenic
933116745 2:78483255-78483277 GACAGGAAGTTGAGGACATGGGG - Intergenic
934574864 2:95393548-95393570 TTTAGGAAGCTCAGGCCATGTGG - Intergenic
934978301 2:98821816-98821838 TGCGGGAAGGGCAGGGCCTGGGG - Intronic
935924592 2:108053274-108053296 GACAGGAAGTTTGGGGCATGGGG + Intergenic
937266046 2:120615219-120615241 TGCAGGAAGAGGAGGGCAGGGGG - Intergenic
937333408 2:121045876-121045898 TGCAGAAAGTGCAGGGCACACGG + Intergenic
937979786 2:127608265-127608287 TGCAGGCAGCTGGGGGCATGCGG - Intronic
938560709 2:132469871-132469893 TGCCCGAAGTTCTGTGCATGAGG + Intronic
938568289 2:132540103-132540125 TACAGGAAGTTTGGGGAATGGGG - Intronic
938710940 2:133975837-133975859 AGCAAGAAGTTTAGGGGATGTGG + Intergenic
941598599 2:167509912-167509934 TGAAGGAAGTTGAGAGCATTTGG + Intergenic
942292603 2:174487143-174487165 TGCTGGAAGTTCGGGGCTGGGGG - Intergenic
942881566 2:180868216-180868238 TGCTAGAAGGTCAGGGCCTGTGG + Intergenic
943368376 2:186985712-186985734 TGCAGGTTGTTGAGGCCATGAGG - Intergenic
944279046 2:197873339-197873361 AGCAGGAAGTCCAGTGCCTGTGG + Intronic
945522541 2:210846119-210846141 TGTAGGAAGATCAGTACATGAGG + Intergenic
945963404 2:216160195-216160217 TGCAGGAAGGTTGGGGCTTGAGG + Intronic
947518170 2:230824790-230824812 TCCAGGACGCTCAGGGCATTTGG - Intergenic
948024297 2:234764848-234764870 TGGATGAAATTCAGGGCCTGGGG + Intergenic
948519692 2:238528027-238528049 GGCAGGAAGTGCATGGCATTAGG + Intergenic
948754682 2:240151943-240151965 TCCAGGAAGCTCCTGGCATGTGG + Intergenic
1168886739 20:1265426-1265448 TGGAGTAAGATGAGGGCATGTGG + Intronic
1168964695 20:1892364-1892386 TTCTGGAAGTCCAGGGCAGGAGG + Intergenic
1171259976 20:23723772-23723794 AGCAGGATTTTCAGGGCAGGTGG - Intergenic
1172846944 20:37935234-37935256 TGCAGGAATTGCAGGGGCTGGGG - Intronic
1173616987 20:44409768-44409790 TGCAGGTAGGTCAGGGAGTGAGG - Intronic
1174502950 20:50999097-50999119 TTCAGCAGGTTCTGGGCATGAGG + Intergenic
1175046487 20:56111144-56111166 TGCAGAGAAATCAGGGCATGGGG + Intergenic
1175362964 20:58429203-58429225 TTCAGGAAGTTCTGGGTATAAGG - Intronic
1175624350 20:60478067-60478089 TGCAGGTAGTTCAAAGCAAGGGG - Intergenic
1175830859 20:61965111-61965133 TGCAGGCAGGGCAGGGCAGGCGG - Intronic
1177253746 21:18632165-18632187 GACAGCAAGTTCAGGTCATGTGG - Intergenic
1177738491 21:25122648-25122670 TGCAGCAATTTCAGTGTATGTGG - Intergenic
1179010546 21:37552847-37552869 TGCGGGAAGTACAGGCCTTGAGG + Intergenic
1179320777 21:40289235-40289257 TGCAGGAAGATGAGGGAATCAGG + Intronic
1181062908 22:20290520-20290542 TGGAGGAAGATGGGGGCATGGGG + Intergenic
1181541266 22:23574448-23574470 TGCTGGGTCTTCAGGGCATGGGG - Intronic
1181688350 22:24544198-24544220 AGCAGGGAGTTCAGGGCAAAGGG - Intronic
1181774318 22:25148499-25148521 TGCAGGAAGTTCACAGCAGTGGG + Intronic
1182283789 22:29232378-29232400 TGCTGGGAGATCCGGGCATGGGG - Exonic
1183026877 22:35071883-35071905 TTCAGGTAGTTCAGGGGAGGAGG - Intronic
1183213807 22:36466621-36466643 TGCAGGAACTTCTGGGCCTTGGG - Intergenic
1184415589 22:44350184-44350206 TGCAGGACGTTCCGGGCAGCTGG - Intergenic
1184608064 22:45585724-45585746 TCCAGGAGGTGGAGGGCATGGGG + Intronic
1184951332 22:47844528-47844550 TGCAGGAGGGACAGGGCATAAGG + Intergenic
950387076 3:12668539-12668561 TGCCAGACGTTCAGGGGATGGGG - Intergenic
950716928 3:14854310-14854332 TCCAGGAAATTCTGGGCATGTGG - Intronic
952794786 3:37229244-37229266 TGGATGAAGTTCAAGGCATTGGG - Intergenic
953748754 3:45594230-45594252 GGCAGGAAGTTCACGGCAGCTGG - Intronic
956081029 3:65556377-65556399 CTCAGGTGGTTCAGGGCATGGGG - Intronic
958763282 3:98334101-98334123 TTCAGGGAGATTAGGGCATGGGG - Intergenic
959658754 3:108841680-108841702 TGCAGGAAGGGCAGGGAATGGGG - Intronic
963508701 3:146220894-146220916 TGCAGGCTGTTCAGGGGCTGTGG + Exonic
963624672 3:147656152-147656174 TGCAGGAAGTTCATGGCTTGTGG - Intergenic
964501012 3:157348103-157348125 GGCTGGAAGTGCAGAGCATGAGG - Intronic
964587146 3:158318704-158318726 TGCAGGAAGATCAGTCTATGTGG - Intronic
967200822 3:187070990-187071012 TGTAGGAAGGTATGGGCATGGGG + Intronic
969353061 4:6609350-6609372 TGCAGGCAGCTCAGTGAATGAGG + Intronic
969641651 4:8402289-8402311 TGCAGGAAGTGAAGGGCAGCGGG + Intronic
972032341 4:34477435-34477457 TGCAAGAAGTTCGGGTCATGAGG + Intergenic
976510828 4:85907994-85908016 TGGAGGAAGTTCAGAGCAGGTGG + Intronic
977135541 4:93299227-93299249 TTCAGGTAGTTCAGGCCCTGAGG + Intronic
977585657 4:98772922-98772944 TGCAGGAATTTCAGGCCAAGCGG - Intergenic
981170299 4:141615584-141615606 TGCACCAAGTGCAGGGCCTGTGG - Intergenic
982126282 4:152186431-152186453 AGGAGGAAGTCCAGGGCAAGTGG - Intergenic
982223248 4:153142384-153142406 GGCAGGAATTTCAGGGCAGGTGG + Intergenic
988539948 5:32099777-32099799 TGCAGCAACTTCAGGGCCTCTGG + Intronic
989268303 5:39503036-39503058 TGCAGTACGTTCAGGGCAGCCGG - Intergenic
990964500 5:61430630-61430652 TGCAGGAACTTGAGTGTATGAGG + Intronic
992657924 5:78928980-78929002 AGCAGGACGTTTTGGGCATGGGG - Intronic
997206804 5:132054923-132054945 TGCAGGAGATTCAGGGGGTGTGG + Intergenic
998390287 5:141783080-141783102 GGCAGGAGGTGGAGGGCATGTGG - Intergenic
998451092 5:142235406-142235428 TGCAGGAAGCTCAGGGCCCAGGG - Intergenic
999416964 5:151406665-151406687 AGCAGAAAGTTCAGCCCATGTGG - Intergenic
1001295870 5:170498495-170498517 TGCAGTAAGTTCAGGGTAGCAGG - Intronic
1001981436 5:176040514-176040536 ACCAGGAAGTGAAGGGCATGGGG - Intergenic
1002236029 5:177803552-177803574 ACCAGGAAGTGAAGGGCATGGGG + Intergenic
1002869047 6:1149014-1149036 TTCAGGGAGTTCAGAGCATGAGG + Intergenic
1003244328 6:4371273-4371295 TGCAGGAAGGGAAGGGGATGAGG - Intergenic
1004828686 6:19452680-19452702 TGCAGGAGTTTAAGGGCCTGAGG + Intergenic
1006411473 6:33876489-33876511 TGCAGGATGCTGAGGGCAGGCGG - Intergenic
1007425447 6:41743391-41743413 TGCAGGGGAGTCAGGGCATGGGG + Intronic
1007821894 6:44566505-44566527 TGCCAGAACTTCAGGGCCTGGGG - Intergenic
1007985924 6:46206722-46206744 TTCAGGAAGATCAGGTCAGGGGG - Intergenic
1008615283 6:53220321-53220343 TGCAGGAGGTTCAGGCTATAGGG - Intergenic
1009463925 6:63948740-63948762 TGCAGAATGTTCAGGTAATGAGG + Intronic
1010765953 6:79777563-79777585 TGCAAGAGGTTGAGGGCAGGAGG + Intergenic
1011047537 6:83102153-83102175 TGCAGGAAGGTCAGGTCAATAGG - Intronic
1011779461 6:90770796-90770818 TGCAGGAGCTTCTGGCCATGTGG + Intergenic
1015854638 6:137610264-137610286 TGCTGGGAGTTGAGGGCAAGGGG + Intergenic
1016372481 6:143389875-143389897 TGCAGCAAGTGCAGGGCACAAGG + Intergenic
1018460750 6:163996284-163996306 TCCAGGAAGATATGGGCATGAGG - Intergenic
1018546756 6:164945947-164945969 TGCAGAAAGTTGAGAGCATTTGG + Intergenic
1020762870 7:12289918-12289940 TGCCTGAAGTTCAGTGAATGGGG - Intergenic
1023847722 7:44132112-44132134 TGCAGGAATATCAGAACATGGGG + Intergenic
1024117056 7:46204492-46204514 AGCAGGAATTTCAGGGCTTAGGG - Intergenic
1024167447 7:46748908-46748930 TGCAGGAAGTGCTGAGCCTGAGG - Intronic
1029408253 7:100390786-100390808 TGCAGGAAGCTCAGTGCTGGTGG + Intronic
1032026173 7:128444324-128444346 TGCAGGAAGTTCAGGTTCTTTGG - Intergenic
1032364001 7:131282522-131282544 TCTAGCAAGTTCAGGGGATGAGG + Intronic
1034436123 7:151063497-151063519 TGTAGTCAGTTCAGGGCAGGTGG - Intronic
1034487924 7:151377628-151377650 AGCAGGAAGGTCAGGGCAGTGGG - Exonic
1035835750 8:2750049-2750071 TGTAGGAAGGTCAGGGTAGGGGG - Intergenic
1037582062 8:20251489-20251511 TGAATGAAGTCCAGAGCATGTGG - Intronic
1039902592 8:41763947-41763969 TGCAGGATCCTCAGGGCATCTGG + Intronic
1040030873 8:42822516-42822538 TGCACAAATTTCAGGACATGTGG - Intergenic
1042297611 8:67238734-67238756 TTTAGGAAATTCATGGCATGAGG - Exonic
1043361347 8:79476064-79476086 AGCAGGAAGTTCAGGACAAAGGG - Intergenic
1044000140 8:86869389-86869411 GGCAAGAAATTCAGGGCAGGAGG - Intronic
1044404610 8:91813645-91813667 TGCAAGCAGTTCAGGGCAGTCGG + Intergenic
1044543901 8:93437655-93437677 TGCAGAACCTTCAGGGAATGTGG + Intergenic
1044681163 8:94778910-94778932 TGGAGGAAGGTGAGGCCATGGGG + Intronic
1044701381 8:94968270-94968292 ACCAGGAAGTTCAGATCATGGGG + Intronic
1045629585 8:104102653-104102675 TGGAGGAAGTTCAGTGAAGGAGG + Intronic
1048983366 8:139715305-139715327 AGCAGGAGGATCAGGGCATCAGG + Intergenic
1049068363 8:140337648-140337670 GGCAGCAGGTTCAGGGCAGGTGG - Intronic
1052081286 9:24209069-24209091 AACAGGAAGGTCAGGGAATGCGG - Intergenic
1053007382 9:34613070-34613092 TGCAGGAAGTTTTGGTCCTGGGG - Intergenic
1053804108 9:41784086-41784108 GGCAGGAGGTTCAGAGCCTGAGG + Intergenic
1055903932 9:81271130-81271152 TGGAGGCAGTTCAGGTCACGTGG + Intergenic
1056013830 9:82360918-82360940 TCCAGGAAGCTCAGGGCACAAGG - Intergenic
1057208684 9:93187848-93187870 TGCAGGGAGATCAGGGGCTGTGG + Intronic
1057489026 9:95507786-95507808 AGGAAGAAGTTCAGGGCAGGGGG + Intronic
1057693980 9:97310780-97310802 TGTTGGGAGTTCAGAGCATGAGG - Intronic
1058634641 9:107024489-107024511 AGGAGGAAGTTCAGGGGAGGCGG - Intergenic
1059391059 9:113999715-113999737 GGCAGCAAGTGCAGGGCCTGGGG - Intronic
1060000540 9:119954284-119954306 TGCTGGAAGTTCAGGGTGAGTGG - Intergenic
1060421519 9:123472770-123472792 TGCAGGAAGTTTGGGGAATGAGG - Intronic
1062037348 9:134388710-134388732 TGCAGGAAGACCAGGGAAAGGGG - Intronic
1185705343 X:2262655-2262677 TGCAGGGAGAGCAGGGCCTGTGG - Intronic
1185762093 X:2696357-2696379 TGCAGGCTGTCCAGGGCTTGAGG + Intronic
1187282297 X:17866994-17867016 TGCAGGAGGTGCAAGCCATGAGG - Intergenic
1187372867 X:18725111-18725133 TGCAGGAAGTTGGAGGCTTGAGG + Intronic
1190452557 X:50596056-50596078 AGCAGCAAGTTCAGGGGAAGAGG - Exonic
1192586011 X:72318706-72318728 TGCATGAAGCTGAGGGAATGAGG - Intergenic
1196745742 X:119070461-119070483 AGCAGGAAGTGCTGGGCTTGAGG + Intergenic
1196783421 X:119402203-119402225 TCCAGAATGTTCAGGGAATGGGG + Intronic
1200152071 X:153956173-153956195 TGCAGGTAGGGCAGGGCCTGAGG - Exonic
1200684772 Y:6248270-6248292 TCCAGGACGTTCATGGCATTGGG + Intronic
1200990302 Y:9339535-9339557 TCCAGGACGTTCATGGCATTGGG + Intronic
1200992963 Y:9359850-9359872 TCCAGGACGTTCATGGCATTGGG + Intronic
1200995617 Y:9380128-9380150 TCCAGGACGTTCATGGCATTGGG + Intronic
1200998282 Y:9400474-9400496 TCCAGGACGTTCATGGCATTGGG + Intronic
1201000790 Y:9469006-9469028 TCCAGGACGTTCATGGCATTGGG + Intronic
1201003458 Y:9489338-9489360 TCCAGGACGTTCATGGCATTGGG + Intronic
1201006114 Y:9509620-9509642 TCCAGGACGTTCATGGCATTGGG + Intergenic
1201008772 Y:9529933-9529955 TCCAGGACGTTCATGGCATTGGG + Intronic