ID: 1156352023

View in Genome Browser
Species Human (GRCh38)
Location 18:36309978-36310000
Sequence GAGGGGTGATTACAGTGCAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 92}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156352023_1156352029 7 Left 1156352023 18:36309978-36310000 CCAATGCACTGTAATCACCCCTC 0: 1
1: 0
2: 0
3: 6
4: 92
Right 1156352029 18:36310008-36310030 GAAAAAATGAACTCAGCACATGG 0: 1
1: 0
2: 1
3: 35
4: 394
1156352023_1156352030 26 Left 1156352023 18:36309978-36310000 CCAATGCACTGTAATCACCCCTC 0: 1
1: 0
2: 0
3: 6
4: 92
Right 1156352030 18:36310027-36310049 ATGGCTTCTGTTGTTCCGCCTGG 0: 1
1: 0
2: 0
3: 7
4: 76

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156352023 Original CRISPR GAGGGGTGATTACAGTGCAT TGG (reversed) Intronic
901227898 1:7625034-7625056 GAGGGGTGAGAAGGGTGCATGGG + Intronic
901372435 1:8811224-8811246 GTGGGGTGAATACAGTTCAGGGG - Intronic
902435393 1:16395301-16395323 GGGGGGAGGTCACAGTGCATGGG - Exonic
902882785 1:19383841-19383863 GAAGGGTGATTACAAGGCTTCGG - Intronic
912157332 1:106937888-106937910 AAGGGATGATTTCAGTGCAAAGG - Intergenic
912946821 1:114092156-114092178 GAAAGGTGAATTCAGTGCATTGG - Intronic
915730503 1:158050469-158050491 GAGGGATGTTTATAGTGAATGGG - Intronic
924446097 1:244132951-244132973 GAGGTGTGATTACAGAGCAAGGG + Intergenic
1066443712 10:35462675-35462697 GAGGGGTCATTCCAGAGCAGAGG + Intronic
1069899814 10:71701021-71701043 GAGAGGTGACTACAGTCCCTGGG - Intronic
1071074036 10:81730183-81730205 GGGGGGTGATTCCAGGGTATAGG + Intergenic
1073742172 10:106420230-106420252 GTGGGGAGATTAGAGAGCATTGG - Intergenic
1079943885 11:26716927-26716949 GATGGGTCATTACAGTGTTTGGG - Intronic
1084557737 11:69884893-69884915 GAGAGGTCATTGCAGTGCATTGG + Intergenic
1091757792 12:3066541-3066563 GAGGGGAGCTTACAGGTCATAGG - Intergenic
1092028005 12:5259162-5259184 GAGTGGTGATGACAGTGGCTTGG - Intergenic
1093155630 12:15681406-15681428 ACGTGGTGATTATAGTGCATTGG - Intronic
1094527522 12:31242077-31242099 GAGGGGGGCTTACAGGTCATAGG - Intergenic
1098275073 12:68804825-68804847 GGGGGGAGGTCACAGTGCATGGG + Intergenic
1107922780 13:45227819-45227841 GAGAGATGAGTAAAGTGCATGGG + Intronic
1111395748 13:87667479-87667501 GAGGGGTGATTTAAGAGCTTAGG - Intergenic
1112188369 13:97150102-97150124 GATGGCTGATTACTGTGGATTGG - Intergenic
1112318180 13:98383403-98383425 GAGGGGTTCTTCCAGTGCACCGG + Intronic
1112717562 13:102204387-102204409 GAGGTGTGGTTACAGTGGGTGGG - Intronic
1116248112 14:42444485-42444507 GAGGGGTCATTATAATTCATAGG - Intergenic
1118050344 14:62019777-62019799 GAGGTGTGATTGCAGTGCAGCGG + Intronic
1118453316 14:65923753-65923775 TAGGGGAGATTACAGAGGATGGG - Intergenic
1120622267 14:86778549-86778571 GGGTGGTGATTACAGGTCATAGG + Intergenic
1120900472 14:89571031-89571053 CAGTGCTGAGTACAGTGCATGGG - Intronic
1122542981 14:102508208-102508230 GAGGGGAGATTTGAGGGCATGGG - Intronic
1123964662 15:25442994-25443016 GAGATGTGATAACAGTGCAAAGG + Intergenic
1130901615 15:88211123-88211145 GGGGGGTGATGACAATGCTTTGG - Intronic
1131519703 15:93104522-93104544 GAGGGGAGGTCACATTGCATGGG - Intergenic
1133303198 16:4795490-4795512 GAGGGGAGATGACAGTGGCTGGG + Intronic
1133571401 16:7043989-7044011 AAGAGGTGCTTGCAGTGCATAGG - Intronic
1142263065 16:89051459-89051481 GAGGGGCGATTAGAGCACATGGG - Intergenic
1143889175 17:10089211-10089233 GATGGGGGAAGACAGTGCATGGG - Intronic
1144804725 17:17956907-17956929 GAGGGGTTCTCACAGTGCAGCGG + Intronic
1145041548 17:19581274-19581296 GAGGTGTGATTTCAATCCATGGG - Intergenic
1146757276 17:35444125-35444147 GAGGGGGCATTATATTGCATGGG - Intronic
1151059526 17:71075667-71075689 GAGCAGTGAAAACAGTGCATTGG - Intergenic
1151675377 17:75594851-75594873 GAGGCGGGAATACAGTGCCTTGG - Intergenic
1156352023 18:36309978-36310000 GAGGGGTGATTACAGTGCATTGG - Intronic
1159544717 18:69824704-69824726 AAGGGGTCATGACAGTGAATGGG - Intronic
1159587505 18:70294756-70294778 GTGGGGTCATTGCAGTTCATTGG + Intronic
1167643457 19:50694337-50694359 GAGGGGGGATGACTGTGAATGGG + Intronic
925123700 2:1438674-1438696 GAGGGTGAATTACAGTGCTTGGG + Intronic
927895555 2:26779466-26779488 GAGGGGTATTTCCAGTGGATGGG - Exonic
931068917 2:58622233-58622255 GTGGGGTGCTTCCAGTTCATAGG + Intergenic
931900522 2:66783185-66783207 GGGGAGGGATTACAGTGCATAGG + Intergenic
934926825 2:98388110-98388132 AAGGGGTGCTTCCAGCGCATTGG - Intronic
937751486 2:125479594-125479616 GAGGGGTTCCTACAGTGCAGTGG + Intergenic
948970002 2:241418128-241418150 GAGGGGTGAGAACAGGGCAGGGG + Intronic
1171147413 20:22797523-22797545 GAGGGGTGATTAGATTGTAGAGG - Intergenic
1174135508 20:48376165-48376187 GATGGGTGACTACAGGGCAGGGG + Intergenic
1175490826 20:59380197-59380219 GAGGGGTGATTTCAGGCCCTTGG + Intergenic
1183598589 22:38826901-38826923 GGGGTGTGATTAAAGTGCAGGGG + Intronic
949623536 3:5843895-5843917 GATGCCTGATTACAGTGCAATGG - Intergenic
951830594 3:26922077-26922099 GTGGGGTGATGGCACTGCATAGG - Intergenic
955831120 3:63005299-63005321 GAGAAGAGATTACAGTACATGGG - Intergenic
956386757 3:68727831-68727853 AAGAGCTGATTACAGTCCATGGG + Intergenic
960229691 3:115210588-115210610 GAAGTATGATTACAGTGCTTTGG - Intergenic
961550862 3:127669955-127669977 GAGGGCTGATGACAGGGCACTGG - Intronic
962854420 3:139330935-139330957 GAGAGTTGGTTACAGTGCAGTGG + Intronic
963541377 3:146593965-146593987 GAGAGGTCATTACAGTGAACAGG - Exonic
964493457 3:157262249-157262271 GAGGAGTGATTACATTGCCTTGG - Intronic
966755935 3:183371397-183371419 GAGGGGGGTTTCCAGTTCATAGG + Intronic
970161896 4:13197455-13197477 AAGGGGAAATTACAGTCCATAGG + Intergenic
972725948 4:41746439-41746461 CGGGGGTGATCACAGCGCATGGG - Intronic
973658885 4:53081771-53081793 AAGGGGTGATTTCAGTGCTCTGG - Intronic
980905527 4:138944909-138944931 GAGGGAAGATGAAAGTGCATGGG - Intergenic
982791226 4:159593813-159593835 GAGGGGTGTTTACAATGCTGTGG - Intergenic
986563662 5:9088863-9088885 GAGGGGTTAACACAGTGCAATGG - Intronic
986814231 5:11390785-11390807 AAGGGATGAATACAGTGAATGGG - Intronic
997590410 5:135068764-135068786 TAGGGGGCATTACAGAGCATTGG + Intronic
1001768525 5:174274345-174274367 GAGGAGTGGTTACAGAGGATTGG - Intergenic
1007227468 6:40325207-40325229 GAGTGGTGTTGACAGTGCCTGGG + Intergenic
1019721136 7:2572201-2572223 GAGGGGTGAGTTCAGGGCCTGGG - Exonic
1020503890 7:8959015-8959037 GAGAGGTGATTTAAGTGCCTCGG + Intergenic
1020503994 7:8960334-8960356 GAGAGGTGATTTAAGTGCCTGGG + Intergenic
1022616569 7:31937003-31937025 GAGGGGTGCTTCCAGGTCATAGG + Intronic
1024197650 7:47074847-47074869 GAGGCCTGATCACAGAGCATAGG - Intergenic
1024995193 7:55268793-55268815 GAGGGGTGATAACAGAGCAGGGG + Intergenic
1030045965 7:105495892-105495914 GTGCTGGGATTACAGTGCATGGG - Intronic
1030657298 7:112182449-112182471 GAGGGGTGTTAGCATTGCATTGG + Intronic
1037021488 8:13977025-13977047 GAGGGGTGGTTACAGTTAAGTGG - Intergenic
1039232311 8:35461759-35461781 GAGGGCAGATAACAGTGCTTGGG + Intronic
1039566820 8:38557910-38557932 GAGGGGTGATTCCAATGAAGAGG - Intergenic
1041617664 8:59927149-59927171 GAGAGGTGAGTGCAGTGTATTGG - Intergenic
1043866953 8:85385675-85385697 TAGGGGTAATGACAATGCATTGG + Intronic
1043912347 8:85877515-85877537 GAGGGTTTAGTTCAGTGCATAGG - Intergenic
1049286465 8:141778098-141778120 GAGGGGTCACTGCAGTGCAGTGG - Intergenic
1052562617 9:30105864-30105886 GAGGGATGATCACAGAGCACTGG - Intergenic
1059275611 9:113094292-113094314 GAGGGATGTTGACAGTGCAAGGG + Intergenic
1061975556 9:134066733-134066755 GAGGGGAGACTGTAGTGCATTGG - Intronic
1185925458 X:4140872-4140894 GAATGGTGCTTACAGGGCATTGG - Intergenic
1186375049 X:8989722-8989744 GAGCATTGATCACAGTGCATTGG + Intergenic
1199768140 X:150955199-150955221 CTGGGGTGATTCCAGTGCACAGG + Intergenic
1200280651 X:154774313-154774335 GAGGGGAGAGTTCAGGGCATTGG + Intronic