ID: 1156357617

View in Genome Browser
Species Human (GRCh38)
Location 18:36355857-36355879
Sequence ACCACAAATGTTCCTAGGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 149}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156357617_1156357619 -9 Left 1156357617 18:36355857-36355879 CCTTTCCTAGGAACATTTGTGGT 0: 1
1: 0
2: 0
3: 14
4: 149
Right 1156357619 18:36355871-36355893 ATTTGTGGTAATCAAGCACATGG 0: 1
1: 0
2: 0
3: 12
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156357617 Original CRISPR ACCACAAATGTTCCTAGGAA AGG (reversed) Intronic
903274798 1:22213683-22213705 TCCACCAATCCTCCTAGGAATGG + Intergenic
903685949 1:25132147-25132169 ATCAAAAATGTTCCTAGGCCCGG + Intergenic
904311147 1:29630312-29630334 CCCTCAAATGTTCCTAAGCAGGG - Intergenic
907171331 1:52468400-52468422 ACCATAAATGTTACTGGGGAAGG + Intronic
908233145 1:62125520-62125542 AACTCAAATGTTCCTATGATGGG + Intronic
908612854 1:65881678-65881700 ACCATAAAGGATCCCAGGAAAGG - Intronic
908866995 1:68559552-68559574 ACCATAAGTGTTCCTATAAAAGG + Intergenic
909347516 1:74609339-74609361 ATCACAAATGTTTCTGGGACTGG + Intronic
911579699 1:99620636-99620658 ACCACAAAAGGTACTAGGATGGG + Intergenic
911831869 1:102560450-102560472 ACCACACATGTACCCAGGACAGG - Intergenic
917304870 1:173614671-173614693 AACACACATGTTCCCAGCAAAGG + Intronic
919660526 1:200240267-200240289 AATACAAATATCCCTAGGAAAGG + Intergenic
919739916 1:200975192-200975214 AACACAAATGCTCCCAGGAAAGG + Intronic
1063508289 10:6621933-6621955 ACAACAAAGGTTCCTTGGAAAGG - Intergenic
1066061024 10:31723738-31723760 ACCACAATTCTTCTTAGGGAAGG - Intergenic
1067019889 10:42786114-42786136 GCCAAACATGTTCCTTGGAAGGG + Intronic
1068147327 10:53088405-53088427 ACCACAGGCGTGCCTAGGAATGG + Intergenic
1069106492 10:64389326-64389348 ATGACAATTGTTTCTAGGAAAGG + Intergenic
1075594377 10:123717510-123717532 ACCACAAATCCTCCTGTGAATGG - Intronic
1076280228 10:129240534-129240556 ACCAAATATTTTCCTAGGAAAGG - Intergenic
1079203981 11:18397954-18397976 TCTACATATGTTCTTAGGAAAGG + Intronic
1080451466 11:32381902-32381924 ACCACCACTGTTTCTAGGCAAGG - Intergenic
1083174808 11:60942853-60942875 CCAACAAATGTTCCTGTGAAGGG + Intronic
1085658581 11:78340777-78340799 ACAACAGATGACCCTAGGAAAGG + Intronic
1086467493 11:87070292-87070314 AAAACATATGTTCCTAAGAAAGG - Intronic
1088369828 11:109076908-109076930 ATCACAAATGCTCCAAGGTATGG + Intergenic
1089573788 11:119427094-119427116 ACCAATAATGTTCCAAGGCACGG + Intergenic
1089883518 11:121797347-121797369 AGCACAAATGTTACAAGAAAGGG - Intergenic
1091161591 11:133426643-133426665 GCCACAAATGTGCTTAGCAAAGG + Intronic
1095627956 12:44340484-44340506 ACCACAGATGTTACTGAGAACGG - Intronic
1099789841 12:87319280-87319302 ACCAGAACTGTTCTCAGGAAAGG + Intergenic
1100100070 12:91092239-91092261 TCCATACATATTCCTAGGAAGGG - Intergenic
1103028494 12:117593270-117593292 ACCACAAATGTCCCTGCGAAGGG + Intronic
1104306855 12:127617473-127617495 GCTACAGATGTTCCTACGAATGG + Intergenic
1106067550 13:26369965-26369987 ACCACAACTGGCCCTAGAAAAGG + Intronic
1107782625 13:43920811-43920833 ACGAAAAAAGTTCCTAGAAATGG - Intergenic
1108667627 13:52648650-52648672 ACCTAACATTTTCCTAGGAAAGG - Intergenic
1109413415 13:62004455-62004477 CCCACAAATGTCCGTTGGAATGG + Intergenic
1112007951 13:95270444-95270466 CCCACAAATGGGCCAAGGAATGG - Intronic
1115473939 14:33796445-33796467 ACTGCAAATGTTCCTGGGAGGGG - Intronic
1118587901 14:67373167-67373189 AACATAAATTTTCCTAGAAATGG - Intronic
1119031161 14:71193653-71193675 AACACAAAAGTTTCTTGGAAGGG + Intergenic
1122891154 14:104732869-104732891 ACCACATATGTGCCGAGGCAAGG + Intronic
1123187596 14:106535330-106535352 AACACAAATGTTACTGGAAAGGG + Intergenic
1125179794 15:36869741-36869763 ACCACAAATCTCCCTTGGCAAGG + Intergenic
1126176766 15:45743183-45743205 ACCAAAAATATCCCTGGGAATGG - Intergenic
1126687061 15:51257502-51257524 ACCACAAACAGCCCTAGGAAGGG + Intronic
1130629070 15:85547251-85547273 ACAACAAATGTACTTGGGAAGGG - Intronic
1136870178 16:33799860-33799882 AACACAAATGTTACTGGAAAGGG - Intergenic
1139046424 16:63065315-63065337 ACCGCCAATCTTCCTAGGGATGG + Intergenic
1139094198 16:63684790-63684812 ATCACACATGTTCCTGGAAATGG + Intergenic
1140750297 16:78017427-78017449 ACCTGAAATGTTTATAGGAAAGG - Intergenic
1141737022 16:85860688-85860710 ACACCAAAAGTTTCTAGGAAGGG - Intergenic
1141766137 16:86061078-86061100 AGCTCACATGCTCCTAGGAATGG - Intergenic
1141832846 16:86519385-86519407 ACCACAAATGTCCTTAGCAGAGG + Intergenic
1141913178 16:87074928-87074950 ACCACACATGTTCCACGCAAGGG - Intergenic
1203101993 16_KI270728v1_random:1316194-1316216 AACACAAATGTTACTGGAAAGGG + Intergenic
1144033824 17:11347099-11347121 TGCACAAATGTTCACAGGAAAGG + Intronic
1146466286 17:33089249-33089271 ATCACAGAGGTTCCTATGAAAGG + Intronic
1153839902 18:8997649-8997671 GCCACAAATCTTCCTTGAAAGGG - Intergenic
1155256755 18:24004687-24004709 AATACAACTGTTCCTAGGCAAGG + Intronic
1156015330 18:32540938-32540960 ACCACACATGTGCCAAGGGATGG - Intergenic
1156357617 18:36355857-36355879 ACCACAAATGTTCCTAGGAAAGG - Intronic
1156915000 18:42455184-42455206 TTCACAAATATTCCTGGGAAAGG + Intergenic
1158499435 18:57986915-57986937 ACAGCAACTGTCCCTAGGAAAGG + Intergenic
1161265787 19:3363752-3363774 ACCACAAATGTCCTTAGACATGG - Intronic
1161523049 19:4736558-4736580 ACCACAAATGTCCCCAGACATGG - Intergenic
1165287176 19:34852015-34852037 ACCACAACTTATTCTAGGAAGGG - Intergenic
1165936129 19:39390156-39390178 GCCACTAATGTTCCTAGGTCTGG - Exonic
925507329 2:4583207-4583229 ACCAAGAATGTTCATAGGAATGG + Intergenic
925568659 2:5285526-5285548 AACATAAATGTTCCTGGGGAAGG + Intergenic
927864312 2:26578914-26578936 ACAACAAATGTTCTAAGAAATGG - Intronic
928488840 2:31759804-31759826 AGCACAAATGTTCCCAGGGCAGG - Intergenic
928692520 2:33815501-33815523 ACCACAAATGTTAGCAGTAATGG - Intergenic
932160321 2:69454012-69454034 AGCACACATGATCCCAGGAATGG + Intergenic
932239124 2:70143213-70143235 ACTACAAAGATTCCTAAGAAGGG + Intergenic
932239267 2:70144147-70144169 ACTACAAAGGTTCCTAAGAAGGG - Intergenic
932691181 2:73914986-73915008 ACCTCACATTTTCCTAGGAAGGG + Intronic
933452798 2:82478300-82478322 ACCACCAATCTCCCCAGGAATGG + Intergenic
935574261 2:104692581-104692603 ACCAAAATTGTTTCTAGGACAGG + Intergenic
937524780 2:122754955-122754977 ACCAAAAATGTCCCTAGACATGG + Intergenic
937772924 2:125743218-125743240 TCCATAAATCTTCCTAGGTAGGG - Intergenic
938336092 2:130499381-130499403 ACCACAAAAGTTAAAAGGAAGGG + Intronic
938353730 2:130621284-130621306 ACCACAAAGGTTAAAAGGAAGGG - Intronic
944361630 2:198864005-198864027 ATGCCAAATGATCCTAGGAATGG - Intergenic
947455557 2:230250711-230250733 AGAAGAAATGTGCCTAGGAAAGG + Intronic
948043654 2:234926040-234926062 ACCAAAATTATTCTTAGGAAGGG - Intergenic
948254662 2:236557392-236557414 TCCACAAAGGCTCCTTGGAAAGG + Intergenic
948374497 2:237512512-237512534 ACAACAGATGTGACTAGGAACGG + Intronic
1170520626 20:17180830-17180852 ACCACACTTGTTCCCAGCAATGG + Intergenic
1171090426 20:22280439-22280461 ACCCAAAATGTTCCTCAGAATGG + Intergenic
1182834158 22:33327887-33327909 ACCACAAATGCTTCAAGAAAAGG + Intronic
1184108861 22:42383753-42383775 ACCCCAAATGTGCCCAGGGAGGG - Exonic
949990947 3:9578611-9578633 ACCAAAAATGATCCTAAGACTGG - Intergenic
954311318 3:49770286-49770308 TCAACAAATGTTGCTAGTAATGG + Intronic
955080319 3:55652064-55652086 CCCAGAAATGTTCGCAGGAAAGG - Intronic
956404256 3:68911767-68911789 GCCACAAACCTTCCTAGGAAGGG + Intronic
959765250 3:110019014-110019036 ACCACAGATGTATCTAGAAATGG - Intergenic
961994921 3:131232444-131232466 GACACAAATCTTCCTCGGAAGGG + Intronic
965520691 3:169665930-169665952 GCAAGAAATGTTCCTAGGAAAGG + Intergenic
966277787 3:178196568-178196590 AGCACAAATCATCCGAGGAAAGG - Intergenic
967993175 3:195146847-195146869 ACCACCAAGTTGCCTAGGAAGGG - Intronic
973875421 4:55213432-55213454 ACCACAAATGTTTCAAGCAAAGG + Intergenic
974721340 4:65742931-65742953 TCTACAAATGTTTCTAGCAAAGG - Intergenic
977423145 4:96828955-96828977 AACTCAGATGTTCCCAGGAAGGG + Intergenic
977622705 4:99155273-99155295 ACTATCAAAGTTCCTAGGAAGGG - Intronic
978732444 4:112045160-112045182 AACAAAATTGTTCCTAAGAAAGG + Intergenic
979499559 4:121423805-121423827 TCCACAGATGATCCTGGGAAAGG + Intergenic
982765960 4:159348499-159348521 AGGAGAAATGTACCTAGGAAAGG - Intronic
988042489 5:25907887-25907909 ACCACAAATTTCACCAGGAAAGG + Intergenic
988682148 5:33494094-33494116 ACCACAAAAGATCCAAGGGAGGG + Intergenic
990127163 5:52532836-52532858 ACCACAATTGTTACTAATAAAGG + Intergenic
990495412 5:56343004-56343026 CCCACAAATCATCCTACGAAAGG - Intergenic
994654529 5:102574160-102574182 TACACAAATGTTCATAGTAACGG - Intergenic
997771855 5:136562488-136562510 GCCACAAATGTGCCTAGAAAAGG + Intergenic
1000241738 5:159415021-159415043 AATGCAAATGTGCCTAGGAAAGG - Intergenic
1000826456 5:166051076-166051098 TCCACATTTGTTCCAAGGAAGGG + Intergenic
1000912578 5:167040183-167040205 ACAACAAAACTTTCTAGGAATGG + Intergenic
1001426501 5:171625986-171626008 ACCGCAACTGTCCCTGGGAAGGG + Intergenic
1001571537 5:172733487-172733509 ACCACAAGGGCTCCTGGGAATGG - Intergenic
1002956226 6:1867931-1867953 CCAACAGATGATCCTAGGAAGGG + Intronic
1005036192 6:21556910-21556932 AGCAAAGATGTTCCTAGGTAAGG + Intergenic
1005895149 6:30171770-30171792 ACCACAGATGTTCCTAGAGCAGG - Intronic
1006971969 6:38054992-38055014 ACTAGAAATGTTTCTATGAACGG + Intronic
1011748589 6:90433093-90433115 TCCACAAATGTACATGGGAATGG + Intergenic
1012307449 6:97675866-97675888 ACAAAAAATATTCGTAGGAAAGG + Intergenic
1012705113 6:102516059-102516081 ACCAACAAAATTCCTAGGAAAGG - Intergenic
1017391674 6:153946620-153946642 AGCATACATGTTCTTAGGAAGGG - Intergenic
1018985980 6:168637599-168637621 AACAGAAATGTTCCTCGCAAAGG - Intronic
1020358934 7:7306294-7306316 AACAAAAATGTTCCTTGGGATGG - Intergenic
1022083740 7:27046927-27046949 AACACACATGTGCATAGGAAAGG - Intergenic
1023666350 7:42527073-42527095 ACCATACATATCCCTAGGAAGGG + Intergenic
1026398886 7:69988883-69988905 ACAAAAAGTGCTCCTAGGAAAGG - Intronic
1027809757 7:82880592-82880614 ACCAAAAATGTTTCTAGACATGG - Intronic
1028409479 7:90512920-90512942 AACACAAATATTCCCAGAAAGGG - Intronic
1034868286 7:154659154-154659176 TCCACATCTGTTCCTATGAAAGG - Intronic
1037108971 8:15143042-15143064 ACTGCAAATGTACCTTGGAAAGG - Intronic
1041087403 8:54269536-54269558 CCCACAAATGTTAATAGGACTGG + Intergenic
1041885049 8:62798831-62798853 ACCAAAAATGTTGAAAGGAAAGG + Intronic
1043927603 8:86055350-86055372 ACAATAAGTGTTTCTAGGAAGGG - Intronic
1044796427 8:95903684-95903706 ACCAGAGATGTTTCTAGGAATGG + Intergenic
1046759776 8:118009254-118009276 ACCAGCAATGTGTCTAGGAAAGG + Intronic
1047688465 8:127325575-127325597 AGCACAAATGTTGGGAGGAAGGG + Intergenic
1052094776 9:24370345-24370367 CCCACACATACTCCTAGGAAAGG - Intergenic
1055930762 9:81557676-81557698 TCAGCAAATGTTCCTATGAATGG + Intergenic
1060236191 9:121864418-121864440 GCCAGAAAAGTTTCTAGGAAAGG + Intronic
1186524914 X:10239459-10239481 ACCACAAAAGTTTCCAGGCATGG - Intergenic
1189357371 X:40321239-40321261 AACACTAATGTTCCTTGGATGGG - Intergenic
1192277535 X:69648738-69648760 TCCATACATGTCCCTAGGAAGGG - Intronic
1193073686 X:77333073-77333095 TCCATATATGTCCCTAGGAAGGG - Intergenic
1193395072 X:80974115-80974137 AATACAAATGTTCCTGGAAAAGG + Intergenic
1193545940 X:82829158-82829180 ACCATGAAGCTTCCTAGGAACGG - Intergenic
1193648836 X:84104559-84104581 AACAAAAATGTTTCTCGGAACGG - Exonic
1195765972 X:108297511-108297533 ACCAAAAATGTTCCCAGACATGG + Intronic
1196170146 X:112578684-112578706 ACCACAAATGGTCAGAGAAATGG - Intergenic
1197880282 X:131159124-131159146 ACCAAAAATGATCCTAGAAGCGG + Intergenic
1200114876 X:153765603-153765625 CCCAGAAATGTTCCTGGGAGGGG + Intronic
1200248973 X:154542168-154542190 CCCAGAAATGTTCTGAGGAAAGG + Intronic
1200855855 Y:7937494-7937516 ACCACAAATGTTCTTGGCACAGG + Intergenic
1201276504 Y:12303620-12303642 ACCTCAAAGCTTCCTACGAAAGG - Intergenic
1201601123 Y:15729608-15729630 ACCACCACTGTAACTAGGAATGG - Intergenic
1202263321 Y:22992511-22992533 ATCACAAAGGTTCCTGGGAAAGG - Intronic
1202416311 Y:24626252-24626274 ATCACAAAGGTTCCTGGGAAAGG - Intronic
1202454476 Y:25043834-25043856 ATCATAAAGGTTCCTGGGAAAGG + Intronic