ID: 1156358803

View in Genome Browser
Species Human (GRCh38)
Location 18:36365732-36365754
Sequence GACACTGAGCTGGTGACGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 219
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 198}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156358797_1156358803 26 Left 1156358797 18:36365683-36365705 CCTCATTAAAGCTTACAAAAAAC 0: 1
1: 0
2: 0
3: 29
4: 341
Right 1156358803 18:36365732-36365754 GACACTGAGCTGGTGACGGCCGG 0: 1
1: 0
2: 0
3: 20
4: 198

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156358803 Original CRISPR GACACTGAGCTGGTGACGGC CGG Intronic
902526347 1:17060245-17060267 GAGAGTATGCTGGTGACGGCAGG - Intergenic
902863622 1:19262966-19262988 CTCACTGAGCAGGTGAGGGCAGG - Intergenic
904838384 1:33354398-33354420 TACCGTGAGCTGGGGACGGCTGG + Exonic
905121816 1:35688382-35688404 GAGGCTGAGCTGGTGGCAGCAGG + Intergenic
910068301 1:83180791-83180813 AACACAGAGCTGGTGATAGCAGG + Intergenic
912335731 1:108860885-108860907 GGCAATGTGCTGGTGAAGGCAGG + Intronic
913593228 1:120349401-120349423 GACCCTGAGATGGAGACAGCTGG - Intergenic
914094029 1:144529585-144529607 GACCCTGAGATGGAGACAGCTGG + Intergenic
914199592 1:145473083-145473105 GACCCTGAGATGGAGACAGCTGG + Intergenic
914304497 1:146404317-146404339 GACCCTGAGATGGAGACAGCTGG - Intergenic
914312172 1:146476449-146476471 GACCCTGAGATGGAGACAGCTGG + Intergenic
914478707 1:148046216-148046238 GACCCTGAGATGGAGACAGCTGG + Intergenic
914502178 1:148256887-148256909 GACCCTGAGATGGAGACAGCTGG - Intergenic
914515193 1:148368365-148368387 GACCCTGAGATGGAGACAGCTGG + Intergenic
914597559 1:149168511-149168533 GACCCTGAGATGGAGACAGCTGG + Intergenic
922223903 1:223628770-223628792 GACACTGTGCAGGTGACTGCTGG - Exonic
1062842183 10:680027-680049 GACACTGAGGTGGGGAGGGATGG + Intronic
1063460930 10:6214721-6214743 GGCACTGAGCTGGGCACAGCGGG - Intronic
1064296443 10:14083354-14083376 GTCACTGAGTTGGTGAGGGATGG + Intronic
1064583871 10:16820011-16820033 GACACCGAGCTGGTGTCTGCTGG - Intergenic
1065820863 10:29523975-29523997 GACACTGATGTGTTCACGGCAGG + Exonic
1066268179 10:33796780-33796802 GACACCCAGCTGGTGTCTGCTGG - Intergenic
1067321703 10:45227043-45227065 GACACTTAGCTGGTGTCTGCTGG - Intergenic
1068108076 10:52644644-52644666 GCCACAGAGCTGGTGAGGGGTGG + Intergenic
1069593798 10:69657495-69657517 GACAGTGAGGTGGGGGCGGCTGG - Intergenic
1070224212 10:74483389-74483411 GACTCTGGGCTGGTGATGGGAGG + Intronic
1071288602 10:84172020-84172042 GACACTGAGTTGTAGAAGGCAGG + Intergenic
1072432391 10:95384653-95384675 TACACTGAGCTGGTGCAGCCGGG - Intronic
1074116430 10:110460380-110460402 CACACTGACCTGGTCACAGCTGG + Intergenic
1075871264 10:125773984-125774006 GACGCTGAGCTGGCGGCTGCTGG - Exonic
1076891966 10:133289249-133289271 CAGACTGAGCTGGTGGTGGCAGG + Intronic
1079398263 11:20084611-20084633 GACACTGGGCTGGGCACTGCAGG - Intronic
1084430236 11:69106847-69106869 GTCACTCAGCAGGTGAGGGCTGG - Intergenic
1085032565 11:73281620-73281642 GACACTCAGCTGGTGAGGGGTGG - Intronic
1087304518 11:96472940-96472962 GACACTGAGGAGGTGAAGCCAGG - Intronic
1092254059 12:6916712-6916734 CTCACTGAGCTGATGAGGGCTGG - Exonic
1092498579 12:9023254-9023276 GACACTTAGCTGCTGACCTCTGG + Intergenic
1096848047 12:54418715-54418737 GACACGGAGCTGGAGAAGTCTGG - Intronic
1097509387 12:60517859-60517881 TACACTGAGCAGGGGAGGGCAGG - Intergenic
1098137895 12:67421825-67421847 AACACTGAGCTGGTCATCGCCGG + Intergenic
1101648520 12:106653696-106653718 GACACTGATCTGCTGACTGAAGG - Intronic
1105410910 13:20170513-20170535 GACACTGTGGTGGTGGGGGCTGG - Intergenic
1107484360 13:40812162-40812184 GACACTGAGCAGGGGACTGTGGG - Intergenic
1108557302 13:51606955-51606977 GTCACTGAACAAGTGACGGCTGG - Intronic
1109263268 13:60167889-60167911 GACACTCAGCTGGTGTCCACAGG + Intergenic
1117229496 14:53701051-53701073 GACACTTAGCTGATGTCTGCTGG + Intergenic
1118611186 14:67541651-67541673 CACACTGAGCTGAGGAAGGCAGG + Intronic
1119804346 14:77473057-77473079 GACACTGCGCAGGTGGCTGCAGG - Intergenic
1121624547 14:95374681-95374703 CACACTGAGCTGGTGAGGGATGG - Intergenic
1121710010 14:96030695-96030717 CACACAGAGCTGGTGAGGGCTGG - Intergenic
1124895413 15:33771936-33771958 GGCTCAGAGCTGGTGAAGGCTGG + Exonic
1125003436 15:34794744-34794766 GGCTCTGGGCTGGTGAAGGCCGG - Exonic
1126425234 15:48520599-48520621 GCCACTGGGCTTGTGAGGGCTGG + Intronic
1128720213 15:69942370-69942392 GACAGTGAGCTTGGGAAGGCAGG + Intergenic
1129660179 15:77548989-77549011 GTCACAGAGCTGGTGAGGGACGG - Intergenic
1130020720 15:80229120-80229142 GACCCTGAGCTGGGTAAGGCTGG + Intergenic
1131872022 15:96773261-96773283 GACACTGGGATGGCTACGGCAGG + Intergenic
1132370282 15:101292515-101292537 TACACAGAGCTGATGAAGGCAGG + Intronic
1133324858 16:4936500-4936522 GAAACTGAGCTGGCGTCGGGGGG - Intronic
1133962275 16:10504928-10504950 CACACTGAGCGGGGGAGGGCAGG - Intergenic
1141121536 16:81362232-81362254 GTGACTGAGCGGGTGACGCCAGG + Intronic
1143383473 17:6510573-6510595 GACCCTGTGCTGGTCACTGCAGG - Intronic
1143982207 17:10879840-10879862 GACACTGAGCTGGGAAAGGGCGG - Intergenic
1144179870 17:12741823-12741845 GACACCCAGCTGGTCCCGGCAGG + Intronic
1146401303 17:32502010-32502032 GACACCCAGCTGGTGACCACTGG + Intronic
1146570811 17:33950869-33950891 ACCACTGAGCTGGTGCCAGCAGG - Intronic
1147479035 17:40741461-40741483 GACACTGAGTTGGTGTCAGAAGG + Intergenic
1148937330 17:51173871-51173893 GACACCCAGCTGGTGTCTGCTGG + Intergenic
1151328969 17:73395500-73395522 GACACTGACCGGGTGACAGTGGG - Intronic
1151465163 17:74280355-74280377 GTCACGCAGCTGGTGACGGGAGG + Intronic
1152009216 17:77700656-77700678 GACCCGGAGCTGGGGACGGCTGG + Intergenic
1152407848 17:80107747-80107769 GGCACTGAGCTGGGGAGCGCAGG + Intergenic
1152426710 17:80221981-80222003 GACACTGAGCTGGTTATGGAGGG + Intronic
1152539058 17:80965766-80965788 GAGACTGAGCTGGGGCTGGCCGG + Exonic
1152756252 17:82088292-82088314 GACTCGGAGCTGGTGTCTGCGGG + Exonic
1152923535 17:83077739-83077761 GACCCTGAGCAGGTCACGGCAGG + Intergenic
1154198481 18:12282940-12282962 GACACTCAGCTGGTGTCTGCTGG + Intergenic
1155429906 18:25744181-25744203 GGCACTGACCTGATGACAGCTGG - Intergenic
1155828407 18:30479771-30479793 TTCACTGAGCTGGTGAGAGCTGG + Intergenic
1156139142 18:34084064-34084086 GGCACTGACCTGATGCCGGCTGG + Intronic
1156358803 18:36365732-36365754 GACACTGAGCTGGTGACGGCCGG + Intronic
1160125218 18:76165568-76165590 GACACAGAGCTGAGGAGGGCAGG - Intergenic
1160198357 18:76776144-76776166 AACACTGAGCTGTTCACGTCAGG - Intergenic
1160230535 18:77045297-77045319 GACCCTGACCTGATGCCGGCAGG - Intronic
1160230562 18:77045471-77045493 GACCCTGACCTGGTGCAGGCAGG - Intronic
1160352654 18:78197388-78197410 GACACGGGGCTGGAGACGCCAGG - Intergenic
1160517813 18:79488095-79488117 GAAACTGAGCTCCTGACGCCCGG - Intronic
1161285038 19:3464368-3464390 AACACTAAGCTGGGGACGCCAGG + Intronic
1161576125 19:5055436-5055458 GCCACTGAGCTGGGGACTTCCGG + Intronic
1163848684 19:19651584-19651606 GACACTGTGCTGCTGAGGCCTGG + Intronic
1164059056 19:21649728-21649750 GGCACTGAGCTGATGACAGTGGG + Intergenic
1164067606 19:21733807-21733829 GGCACTGAGCTGATGACAGTGGG - Intronic
1164156525 19:22600810-22600832 GACACTTAGCAGATGATGGCTGG + Intergenic
1165092063 19:33392746-33392768 GACCCTGAGCTGGCGAGGGCTGG + Intronic
1165433216 19:35783983-35784005 CACACTGAGATGGGGAAGGCAGG + Intronic
1165732129 19:38152604-38152626 GCCAGGGAGCTGGTGGCGGCGGG - Intronic
1166096342 19:40541670-40541692 GACACAGAGATGGCGACGGGAGG - Intronic
1166982156 19:46637545-46637567 GACACTGAGCTGGTGAGAGATGG - Intergenic
1168685968 19:58349960-58349982 CAAACAGAGCTGGGGACGGCGGG + Intronic
925043141 2:749477-749499 GACACCGGGCTGGTGACACCAGG + Intergenic
925425796 2:3747905-3747927 GTCACTGGGCTGGTCAGGGCGGG + Intronic
925456868 2:4023469-4023491 GACACTGAGCTGGCTGCAGCAGG - Intergenic
926060072 2:9799738-9799760 GACACTGAGCTGGAGACCTAGGG - Intergenic
926635009 2:15169471-15169493 GACACCGTGCTGCTGAGGGCAGG - Intronic
926733617 2:16056446-16056468 CACTCTGAGCTGGTGAGGGGAGG - Intergenic
928311890 2:30218065-30218087 GCCACTGAGCAGGTGACTGCGGG + Intergenic
930951417 2:57147348-57147370 GGCACTGACCTGGTGCCAGCTGG - Intergenic
931176767 2:59861927-59861949 GACTCTGAGCTTGTGATGGGAGG + Intergenic
931219578 2:60277131-60277153 GAACCTGAGCTGGAGAGGGCAGG - Intergenic
933299130 2:80522912-80522934 GACACTGAGCAGGAGAAGACGGG + Intronic
933942423 2:87255573-87255595 GTCACTGAGCTGGTGTAGGTGGG - Intergenic
936337803 2:111605995-111606017 GTCACTGAGCTGGTGTAGGTGGG + Intergenic
937679395 2:124627326-124627348 GACACTGACCTGATGTCCGCTGG - Intronic
938643841 2:133311020-133311042 GACACCTAGCTGGTGTCTGCTGG - Intronic
938767756 2:134471979-134472001 GACACAGTGCTGGTAACAGCAGG - Intronic
941020098 2:160398569-160398591 GAAACTGAGCTGGACACTGCAGG + Intronic
942227636 2:173831014-173831036 GACACGCAGCTGGTGTCTGCTGG + Intergenic
946112784 2:217434809-217434831 GACACTGAACTGCTGTCGACCGG - Intronic
947993468 2:234506072-234506094 GACACAGAGTTGGTGCCAGCAGG + Intergenic
948921262 2:241066982-241067004 GGCACTGAGCAGGTGTCAGCAGG + Intronic
1169928901 20:10811096-10811118 GACACTGACCTAATGACAGCAGG - Intergenic
1170923602 20:20702359-20702381 GAGAAGGAGCTGGTGAAGGCAGG + Intronic
1174450237 20:50615547-50615569 GACACTGCCCTGATGATGGCAGG + Intronic
1176270817 20:64234893-64234915 GACACTGGGCTGGTGGTGGTGGG + Intronic
1176270968 20:64235368-64235390 GACACTGGGCTGGTGGTGGTGGG + Intronic
1176271066 20:64235675-64235697 GACACTGGGCTGGTGGTGGTGGG + Intronic
1176986676 21:15445415-15445437 GACAATGAGCAGGTGCAGGCAGG - Intergenic
1178797316 21:35756863-35756885 GACTCTGAGTTGGGGAAGGCAGG - Intronic
1179612811 21:42563424-42563446 CACCCTGAGCTGGTGCCGGGAGG + Intronic
1180908488 22:19431953-19431975 GAGGCAGAGCTGGTGACGGGCGG - Exonic
1181343514 22:22200870-22200892 GACACTGAGGTGGGGGCTGCAGG - Intergenic
1182097006 22:27632899-27632921 GAGGCTGAGCTGGAGAAGGCTGG + Intergenic
1182321827 22:29482672-29482694 AACACTGAGCTGGAGGCTGCAGG - Intronic
1182900361 22:33893460-33893482 GAATGTGAGCTGATGACGGCAGG - Intronic
1183622648 22:38983503-38983525 GCCACAGAGCTGGGGACGGATGG - Intronic
1183632545 22:39042041-39042063 GCCACAGAGCTGGGGACGGATGG - Intronic
1184047748 22:41982049-41982071 TACACCGAGCTGGTGATGGGGGG - Intronic
1184367547 22:44062178-44062200 GACACCCAGCTGGTGTCTGCTGG - Intronic
1184692297 22:46122850-46122872 GGCACAGAGCTGGGTACGGCTGG + Intergenic
950461489 3:13124904-13124926 GGCACGGAGGTGGTGAGGGCGGG - Intergenic
953393029 3:42544851-42544873 GACATTGAGCTGGAGGCAGCCGG - Intergenic
953556961 3:43953500-43953522 GAGACGGAGCTGGGGACAGCGGG + Intergenic
954914710 3:54138975-54138997 GACACTGGGCTGGAGGGGGCAGG + Intronic
960803279 3:121559747-121559769 GACACTTAGCTGGTGCCCACTGG - Intergenic
965208298 3:165750299-165750321 GACACATAGCTGGTGTCTGCTGG + Intergenic
966356025 3:179079591-179079613 GACACTCAGGAGGTGACGGAGGG + Intergenic
966642331 3:182204797-182204819 GCCACTCAGCTGGTGAGGGCAGG - Intergenic
967402862 3:189083183-189083205 GACACTGAGCTGGGGAGGTGGGG + Intronic
969690798 4:8703109-8703131 GACTGTGAGCTGCTGAGGGCAGG - Intergenic
970481797 4:16483602-16483624 AACACTCAGCTGGTAACTGCAGG + Intergenic
973545064 4:51973139-51973161 GACACTGACCTGATGCCGGCGGG + Intergenic
973826055 4:54708656-54708678 CACACTGAGCTGCTGGCTGCTGG - Intronic
977592092 4:98838456-98838478 GCCACTGAGCTGGTCATTGCTGG - Intergenic
979809307 4:125015350-125015372 GCCACTGAGCTGGTCATTGCTGG + Intergenic
981592116 4:146375781-146375803 GACACCCAGCTGGTGTCTGCTGG - Intronic
981722086 4:147811971-147811993 GCGGCTGAGCTGGTGACTGCTGG + Intronic
982184150 4:152779563-152779585 GACCGTGAGCTGGTGCCGGGAGG - Exonic
983972234 4:173889742-173889764 GGCACTGAGCTGATGCCAGCAGG + Intergenic
984069606 4:175094513-175094535 GGCACTGAGCTGGTTCAGGCAGG - Intergenic
985747754 5:1656737-1656759 GACAGTGAGGTGGGGACCGCAGG - Intergenic
985850828 5:2388116-2388138 GACAGTGGGCTGATGAAGGCAGG - Intergenic
986460423 5:7964682-7964704 GCCACTGAGCTGGTCATGCCTGG + Intergenic
994400654 5:99275395-99275417 GCCTCTGAGCTGGTGATGGGAGG - Intergenic
995508386 5:112883820-112883842 GCCACTGAGCTGGAGAAGACTGG - Intronic
998148045 5:139741464-139741486 GACCCTGAGCTGGGGCAGGCTGG + Intergenic
998570225 5:143250399-143250421 GTCACTGAGCTGGTGATGCCTGG - Intergenic
1000701136 5:164451867-164451889 AACACTGAGCTGGTCATTGCTGG + Intergenic
1001317363 5:170653308-170653330 GACACTGAGCTGATCACCACTGG - Intronic
1002288025 5:178178296-178178318 GCCATTGTGCTGGTGACTGCTGG + Intergenic
1002454020 5:179336080-179336102 TGCACAGAGCTGGTGAAGGCTGG + Intronic
1003168192 6:3699729-3699751 GACACTGAGTTGGGGACTGTGGG + Intergenic
1007711601 6:43827844-43827866 GACACTGGGCTGGGGACACCAGG - Intergenic
1012842469 6:104346579-104346601 GCCACTGAGCTGGTCATTGCAGG - Intergenic
1013071913 6:106737257-106737279 GACACCCAGCTGGTGTCTGCTGG - Intergenic
1013894616 6:115071236-115071258 CACACTGAGCTGGGTAGGGCAGG - Intergenic
1019095428 6:169575525-169575547 GATCCTGAGCTGTTGAAGGCAGG + Intronic
1021581260 7:22156464-22156486 GACAATGGGCTGATGAAGGCAGG + Intronic
1022468271 7:30665704-30665726 GACACAGAGGTGGCCACGGCTGG - Intronic
1024527826 7:50363526-50363548 GACACAGAGCTGGGGAGTGCTGG - Intronic
1027173034 7:75886223-75886245 GGCTCTGAGCTGTTGACAGCTGG - Intronic
1027275798 7:76553982-76554004 TACACAGAGCTGGTGATAGCAGG - Intergenic
1027785877 7:82577970-82577992 GACACTAAGCTGGTGTCTGCTGG + Intergenic
1029599268 7:101554165-101554187 GCCACTGAGATGGGGCCGGCAGG + Intronic
1029616416 7:101661159-101661181 GCCCTTGAGCTGGTGACTGCTGG - Intergenic
1030633725 7:111924486-111924508 CACGCTGAGCTGGTGCAGGCAGG + Intronic
1030638484 7:111977221-111977243 GACAAAGAGGTGGTGACTGCTGG + Exonic
1030970987 7:116054558-116054580 GACACTTAGCTGGTGAATGATGG + Intronic
1036615515 8:10384569-10384591 GACACTGAGCTGGTCTCAACAGG + Intronic
1037189222 8:16101241-16101263 GGCACTCAGCTGGTGTCTGCTGG - Intergenic
1038397789 8:27259873-27259895 GCCAGTGAGCTGGAGAGGGCAGG + Intergenic
1045872026 8:106938094-106938116 AAAACTGAGCTGGTGACTGATGG + Intergenic
1046702792 8:117419392-117419414 GACACTGACCTGCTGTCTGCAGG - Intergenic
1047537499 8:125733135-125733157 GACAGTGAGCTTGGGACGGCTGG + Intergenic
1047659775 8:127020450-127020472 GCCACTGAGCTGGTCATTGCTGG - Intergenic
1048054234 8:130848154-130848176 GTCACTGAGCTGGTGACTGGTGG + Intronic
1048260790 8:132943538-132943560 AACACTGGGCTGGTGACAGGTGG - Intronic
1049388750 8:142357514-142357536 GGCAGTGAGCAGGTGGCGGCAGG + Intronic
1051973016 9:22913649-22913671 AACATAGAGCTGGTGACTGCTGG + Intergenic
1053024495 9:34718772-34718794 AACACTGAGTTGTTGAGGGCAGG - Intergenic
1057311602 9:93946552-93946574 GACACTGTGCTGGGGAGGGGTGG - Intergenic
1059108274 9:111530603-111530625 GACACCCAGCTGGTGCCTGCTGG + Intronic
1061375110 9:130219590-130219612 GACACTCAGGTGGAGAGGGCAGG - Intronic
1062086569 9:134652302-134652324 AACAGTGAGCTGGTGACAGCAGG + Intronic
1062636559 9:137494601-137494623 GTCACGGAGCAGGTGAGGGCAGG - Intronic
1062636592 9:137494754-137494776 GTCACGGAGCAGGTGAGGGCAGG - Intronic
1062636604 9:137494805-137494827 GTCACGGAGCAGGTGAGGGCAGG - Intronic
1062636615 9:137494856-137494878 GTCACGGAGCAGGTGAGGGCAGG - Intronic
1188005086 X:25011468-25011490 GAAACTGAGCTGGTGTCAGTTGG - Intronic
1190081342 X:47359032-47359054 GACACTGAACTGGTGTTTGCTGG - Intergenic
1190909539 X:54758554-54758576 GGCTCTGAGCTGGTGGTGGCAGG - Exonic
1191881728 X:65849306-65849328 GACACCTAGCTGGTGTCTGCTGG + Intergenic
1192503179 X:71666282-71666304 AACACTGAGGTGGAGAGGGCCGG + Intergenic
1192503629 X:71668285-71668307 AACACTGAGGTGGAGAGGGCCGG - Intergenic
1193288990 X:79749784-79749806 AAGACTGAGCTGGTCTCGGCAGG - Intergenic
1196286019 X:113881626-113881648 GACACTCAGTTGGTGTCTGCAGG - Intergenic
1200012476 X:153129099-153129121 GTCACTGATTTGGTGTCGGCAGG - Intergenic
1200027123 X:153270820-153270842 GTCACTGATTTGGTGTCGGCAGG + Intergenic
1201696375 Y:16831774-16831796 GACACTGAGCTGTAGAAGGGAGG - Intergenic
1202600345 Y:26587813-26587835 GTCACTGAGGTGTTGAGGGCTGG + Intergenic