ID: 1156358867

View in Genome Browser
Species Human (GRCh38)
Location 18:36366334-36366356
Sequence ACATTAAGACAAATGGAACG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 161}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156358867 Original CRISPR ACATTAAGACAAATGGAACG AGG Intronic
901273047 1:7968448-7968470 ACTTTATGAAAAATGTAACGGGG - Intronic
906577697 1:46905533-46905555 CCTTTAAGACAAATGAAAGGGGG + Intergenic
908648522 1:66306420-66306442 ATAATAAGACAAAAGGAAAGAGG + Intronic
909177169 1:72375704-72375726 AAATTAAAACAAATGGAATATGG - Intergenic
910389091 1:86718805-86718827 ACATTAGAATAAATGGAAAGGGG - Intronic
912442185 1:109707657-109707679 CCTTTAAGACAAATGAAAAGGGG + Intronic
912986721 1:114440776-114440798 ACATTAAGAGAAATGGAGAATGG + Intronic
913492905 1:119398330-119398352 AACTTAACACAAATGGAACGAGG - Intergenic
913499402 1:119457203-119457225 AACTTAACACAAATGGAAGGAGG - Intergenic
917616321 1:176748627-176748649 TCATTGAGACAAATGTAATGTGG - Intronic
918086817 1:181252533-181252555 CCTTTAAGACAAATGAAAAGGGG + Intergenic
918198262 1:182242923-182242945 GCCTTAAGTCAAATGGAACTTGG + Intergenic
918911145 1:190571886-190571908 ACATTATGATAAGTGGAATGAGG - Intergenic
921081633 1:211743358-211743380 ACAGACAGACATATGGAACGTGG - Intergenic
922590752 1:226774053-226774075 ACATTTAGACACATGGTATGTGG - Intergenic
922710985 1:227832062-227832084 ACTTTAAAACAAATGTAACTAGG - Intronic
1065638589 10:27755924-27755946 ATATTTAGACATATGGTACGTGG - Intergenic
1066110655 10:32193826-32193848 ACATATAGACCAATGGAATGGGG - Intergenic
1067433745 10:46263365-46263387 CCATGAAGACAAGTGGAAGGAGG - Intergenic
1068818014 10:61339788-61339810 AGATTAAGAAAATTGGAAGGTGG - Intergenic
1069940467 10:71951889-71951911 ACATTAACTCAAATGGACTGAGG + Intergenic
1070855966 10:79608254-79608276 ACATGAAGACAAATGGTCTGAGG - Intergenic
1071806485 10:89127150-89127172 ATATTAATACAAATGGGAGGTGG - Intergenic
1073217468 10:101844171-101844193 ACATGGAGACAAACGGAGCGGGG - Intergenic
1073354198 10:102840873-102840895 CCTTTAAGACAAATGAAAGGGGG - Intergenic
1076201246 10:128560148-128560170 AAATTAATAAAAATGTAACGAGG - Intergenic
1076277201 10:129211492-129211514 ACATGAAGACAAAAGGAGTGGGG + Intergenic
1078359186 11:10655217-10655239 AGATTAAGACAAAAGAAAAGTGG - Intronic
1080107599 11:28526636-28526658 ACATGAAGACACATGGAGAGGGG + Intergenic
1084223996 11:67703630-67703652 CCTTTAAGACAAATGAAAAGGGG + Intergenic
1087194047 11:95286729-95286751 ACATTAAAATAAATGTAATGTGG + Intergenic
1087680480 11:101213986-101214008 CCTTTAAGACAAATGAAAGGGGG - Intergenic
1089650362 11:119908903-119908925 ACAATCAGACAAATGGAAGCAGG - Intergenic
1094478017 12:30856636-30856658 ACATCAAGTCAAATGGATGGAGG + Intergenic
1099003018 12:77203207-77203229 AGATTTAGGCAAATTGAACGTGG + Intergenic
1099348975 12:81540937-81540959 AGATAAAGAGAAATGGAATGCGG - Intronic
1102278847 12:111602441-111602463 ACATTATGACAAATGAAAGAAGG - Intergenic
1105946330 13:25192918-25192940 AAATAAAGACAAAAGGAAAGAGG - Intergenic
1106663671 13:31829374-31829396 ACATTAAGATAAAAGAAACTTGG - Intergenic
1106775853 13:33008863-33008885 ACATTAAGACAATTGCAAATAGG - Intergenic
1110613772 13:77518861-77518883 ACATTTAGACATATGGTATGTGG - Intergenic
1110723385 13:78791022-78791044 ACAGTAGGAAAAATGGAAGGAGG - Intergenic
1112572280 13:100604145-100604167 ACATTAAGCAAAATGGAAAACGG + Exonic
1114587043 14:23824949-23824971 ACCCTAAGACAAATGGCATGGGG + Intergenic
1114737375 14:25056200-25056222 ACTTCAAGAAAAATGGAAGGGGG + Intergenic
1116379590 14:44248792-44248814 AGATTATGACAAATGTAACCAGG - Intergenic
1117053960 14:51891225-51891247 ACTTTAAGGCAAATAGAAGGAGG + Intronic
1119123418 14:72100775-72100797 ACATTAAGATAAATGGTAGGAGG - Intronic
1125990605 15:44103130-44103152 ACATTAGGGCAAATGGCATGAGG - Intronic
1126426629 15:48534439-48534461 ACATTAGGAAACATGGAAGGTGG - Intronic
1127107594 15:55633518-55633540 ATTTTAATACAAATGGAACAAGG - Intronic
1128627905 15:69230555-69230577 ACATTAAAACTAATGTAACAAGG - Intronic
1130095563 15:80853239-80853261 ACATTTAGTCAAATGGAAAGGGG + Intronic
1130395593 15:83498343-83498365 AAACTAAGACACATGGAAAGTGG - Intronic
1130955337 15:88623405-88623427 AGATTAAGAGAAATGGGAAGGGG - Intronic
1132086848 15:98915503-98915525 TCATGAAGCCAAATGGAAAGAGG - Intronic
1138404802 16:56782240-56782262 AAATTAAGACAAATGCACCCTGG + Intronic
1144802006 17:17935736-17935758 CCATTAGGACATAAGGAACGAGG + Intronic
1148111444 17:45146773-45146795 ACAGAAAGAAAAATGGCACGGGG + Intergenic
1151558227 17:74857955-74857977 ACATTAAAACAAATAGAAACAGG - Intronic
1153574348 18:6505669-6505691 AAAGTCAGCCAAATGGAACGTGG - Intergenic
1155622365 18:27794474-27794496 ATATTGAGACATATGGTACGTGG - Intergenic
1155664450 18:28291362-28291384 AGATTAAGACAAAAGCAACCAGG + Intergenic
1156358867 18:36366334-36366356 ACATTAAGACAAATGGAACGAGG + Intronic
1157756543 18:50222892-50222914 CCTTTAAGACAAATGAAAGGGGG - Intergenic
1158755429 18:60318823-60318845 ATATAAAGACTAATGGAACAGGG - Intergenic
1158804486 18:60953104-60953126 CCATTAACACAAATGGTAGGTGG + Intergenic
1159669461 18:71204976-71204998 ACACTAAAATAAATGAAACGGGG + Intergenic
1159751632 18:72310161-72310183 AGATTAAGACAAATGCAAAATGG + Intergenic
1160777738 19:863924-863946 ACATTAAAAAAAGAGGAACGCGG + Intergenic
1163941857 19:20502478-20502500 CCTTTAAGACAAATGAAAGGGGG - Intergenic
1164288947 19:23849915-23849937 CCTTTAAGACAAATGAAAAGGGG - Intergenic
1167828934 19:52001930-52001952 AGATTTAGACAAATCAAACGGGG + Intronic
1168209846 19:54882344-54882366 ACATTGAGATGAATGAAACGAGG - Intronic
925280877 2:2683538-2683560 ACACTAAGATGAATGGAACGTGG - Intergenic
929502583 2:42502985-42503007 ACATTAAAAAAAAAGGAAAGGGG + Intronic
930254120 2:49069265-49069287 ACATTAAGCCAGAAGGAACCTGG - Intronic
930277388 2:49329173-49329195 ACATTTAGAAAAATGGAAATAGG + Intergenic
931040888 2:58298360-58298382 AAAATAAAAGAAATGGAACGTGG + Intergenic
931600131 2:63994683-63994705 CCTTTAAGACAAATGAAAGGGGG + Intronic
935956961 2:108386850-108386872 ACATTAAGAAAAACGAAACTGGG + Intronic
937112349 2:119376479-119376501 CCTTTAAGACAAATGAAAAGGGG - Intergenic
937272973 2:120666094-120666116 ACTTTCAAACAAGTGGAACGGGG - Intergenic
938130479 2:128711451-128711473 ACAATAAGACAATGGGAAGGGGG - Intergenic
939096222 2:137836569-137836591 ATATTTAGACAAGTGGAATGTGG - Intergenic
941229159 2:162887232-162887254 AAATATAGACAAATAGAACGTGG - Intergenic
942107135 2:172643885-172643907 ATATTTAGACAAATGGTATGTGG + Intergenic
943000960 2:182328381-182328403 ACATAGAAAGAAATGGAACGAGG + Intronic
943424469 2:187713522-187713544 ACATGAAGACATATGGGAGGTGG + Intergenic
945723402 2:213446950-213446972 CCTTTAAGACAAATGAAAGGGGG + Intronic
1169594545 20:7183103-7183125 ACATTAAGACCATAGCAACGGGG - Intergenic
1169698164 20:8415422-8415444 AAATTAAGACCTATGGAAAGGGG - Intronic
1173672001 20:44805451-44805473 ACATTAAGAAAATGGGAAGGGGG + Intronic
1175826781 20:61940832-61940854 ACATTGAGACAGATGGCATGTGG - Intergenic
1176919203 21:14666434-14666456 ACAGAAAAACAAATGGAAGGTGG + Intergenic
1177731445 21:25032036-25032058 ACATTAAAAAAAATGGAAGCAGG - Intergenic
1179431944 21:41327513-41327535 ATCTTAAGACAAATGGAAATGGG - Intronic
1183614343 22:38934266-38934288 CCATTAAGTCAAAAGGCACGGGG + Intergenic
1203324753 22_KI270738v1_random:3546-3568 ACATGAAAACAAATGGATAGTGG + Intergenic
951211455 3:19979724-19979746 ACATTAAAACCACTGGAAAGAGG - Intronic
951293473 3:20903087-20903109 CCATTTAGAGAAATGGAACCAGG + Intergenic
951874913 3:27412861-27412883 ATATTAAGAGAAATGAAACAAGG + Intronic
954074389 3:48166712-48166734 CCATTAAGACAAATATAACCAGG + Intronic
957660484 3:83145265-83145287 AGGTGAAGACAAATGGAACGTGG - Intergenic
960856258 3:122105199-122105221 ACATTAAAACAAATACAACATGG - Intronic
961101571 3:124203370-124203392 AAATTAAGACCAAGGGAACCAGG + Intronic
964004560 3:151812133-151812155 ACATTAAGTCGAATGGACTGAGG - Intergenic
964197896 3:154085654-154085676 AAATTAAGACAAATGTGACCAGG - Intergenic
964430422 3:156599858-156599880 ACATTATGAAAAATGGAACTGGG + Intergenic
964635851 3:158858253-158858275 ACATTACCACAAATGAAAAGAGG - Intergenic
965541367 3:169874839-169874861 ACAGTAAGAAAAATGAAACTTGG + Intergenic
974293713 4:59967529-59967551 AAAATAAGACAAAAAGAACGTGG + Intergenic
974605328 4:64143901-64143923 CCTTTAAGACAAATGAAAGGGGG - Intergenic
974998936 4:69196550-69196572 TCTTTAAGACAAATGAAAAGGGG + Intronic
976462803 4:85332518-85332540 ACAGCAAAACAAATGGAACAGGG - Intergenic
980895877 4:138859721-138859743 AAATTAACACAAATGGAGCTGGG - Intergenic
983190689 4:164750583-164750605 CCCTTAAGACAAATGAAAAGGGG + Intergenic
990799467 5:59584149-59584171 ACAGTAGGACAAAGGGAAAGAGG + Intronic
991287237 5:64991426-64991448 ACATTAAAACAAATGGAGGCTGG + Intronic
995708928 5:115014988-115015010 ATATTAAGACAATTGGTACTTGG + Intergenic
996414231 5:123192644-123192666 ACATTAGGACAAATGGCAACAGG + Exonic
999609275 5:153351644-153351666 ACTTTAAGAAAAATGGGACCAGG - Intergenic
1000482059 5:161789572-161789594 ACAGTAAAACAAATGGAATGAGG + Intergenic
1000873028 5:166600976-166600998 ACATTAAAAAAAATGGGAAGGGG - Intergenic
1001876085 5:175202432-175202454 ACATCAAGGAAAATGGAAGGGGG + Intergenic
1001901971 5:175438862-175438884 AGATTAAGACAACTTGAAAGAGG - Intergenic
1003389746 6:5703554-5703576 AAATTTAGACAAATAGAAGGTGG - Intronic
1004022605 6:11788726-11788748 ACATTAACTCAAATGGACTGAGG - Intronic
1004619676 6:17321824-17321846 ACATTAACTCAAATGGACTGAGG + Intergenic
1006017522 6:31094192-31094214 ACAGTAAGAGGAATGGAAAGAGG - Intergenic
1007097090 6:39220064-39220086 GCACTCAGACAAATGGAAGGGGG + Intronic
1007384684 6:41512621-41512643 ATATTTAGACATATGGAATGTGG - Intergenic
1009675869 6:66820436-66820458 ACATATAGACCAATGGAACAGGG - Intergenic
1014076258 6:117238768-117238790 ATATTTAGACAAATGGTACATGG + Intergenic
1014915174 6:127137711-127137733 AAACTGAGACAAATGGAAAGGGG - Intronic
1017059852 6:150472044-150472066 ACATGAAGATAAATGAGACGTGG - Intergenic
1017850293 6:158299471-158299493 CCTTTAAGACAAATGAAAGGGGG - Intronic
1019187070 6:170226908-170226930 GCTATAAGACAAATGGAAGGGGG - Intergenic
1022265656 7:28751831-28751853 ACATAAAAACAAATGCAATGTGG - Intronic
1022431846 7:30331818-30331840 ATGTTAACACAAATGGAACACGG - Intronic
1024108775 7:46122830-46122852 ACACATAGACAAATGGAACAAGG - Intergenic
1029963387 7:104712013-104712035 ACATTAGGATACATGGAAAGGGG + Intronic
1032720284 7:134546053-134546075 ATAGAAAGACAAATGGAAGGAGG + Intergenic
1032974125 7:137202037-137202059 ATATTAGGACAAATGGATTGGGG + Intergenic
1035449213 7:158964878-158964900 ACATTAAGGCTCAGGGAACGTGG + Intergenic
1036531369 8:9591243-9591265 ACATTTAGCCAAATGGACCTAGG - Intronic
1038247594 8:25873457-25873479 ACATTAAAACAAATGGATGTGGG - Intronic
1038987078 8:32823269-32823291 ACATTAAGAAAAATGAGATGGGG + Intergenic
1039273110 8:35904860-35904882 ACATTAAGAAAAGTAGAACTGGG + Intergenic
1040139811 8:43896854-43896876 CCTTTAAGACAAATGAAAGGGGG + Intergenic
1043879176 8:85522323-85522345 ACATTAAGAAAAATGTCACTGGG + Intergenic
1047180309 8:122581521-122581543 ACATTAAGACAAAGGAAAAGAGG - Intergenic
1051329832 9:16012445-16012467 ACAGTAAGAAAAATGGTAAGAGG - Intronic
1053314091 9:37037281-37037303 ACAGAAAGAAATATGGAACGGGG + Intergenic
1053335126 9:37261607-37261629 ACATTAGGGCAAATGGAGCAGGG - Intronic
1058257079 9:102780135-102780157 AGATTAATAGAAATGGAACTTGG - Intergenic
1059198653 9:112394635-112394657 CCTTTAAGACAAATGAAAGGGGG - Intronic
1059464980 9:114462990-114463012 ACATTAAGAGAAAGGGAGAGAGG - Intronic
1061334978 9:129927112-129927134 ACATGAGGTCAAATGGAAAGGGG + Intronic
1186808219 X:13161324-13161346 ACGTTCAGACAAATGAAAGGTGG - Intergenic
1187131547 X:16507972-16507994 ACATTCAGATGAATGGAACTTGG + Intergenic
1190642290 X:52492435-52492457 AAATAAGGACAAATGGAGCGAGG - Intergenic
1190645383 X:52520432-52520454 AAATAAGGACAAATGGAGCGAGG + Intronic
1191931532 X:66378641-66378663 ACACCAAAACAAATGTAACGTGG - Intergenic
1196594521 X:117528203-117528225 GCATTAAGATAAATGAAACATGG - Intergenic
1197047925 X:122022551-122022573 ACATTCAGAAAAATGAAACTGGG - Intergenic
1198248089 X:134851060-134851082 CCATTAATACAAATGAAATGTGG + Intronic
1199154272 X:144527914-144527936 ACATTGAGAAAAATGAAAAGGGG + Intergenic
1201475438 Y:14376418-14376440 CCCTTAAGACAAATGAAAGGGGG - Intergenic
1201887670 Y:18903558-18903580 ACATTAAGACAAAGGTAATATGG + Intergenic