ID: 1156361385

View in Genome Browser
Species Human (GRCh38)
Location 18:36387265-36387287
Sequence GACACTTTTGTCAAAAATGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 247
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 224}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156361385 Original CRISPR GACACTTTTGTCAAAAATGG GGG Intronic
901760094 1:11465377-11465399 TACACATTTGTCAAAAATGCAGG - Intergenic
903540010 1:24091549-24091571 GACACATTTGTCATTAGTGGTGG - Intronic
904445182 1:30567187-30567209 CATACTTTTGTGAACAATGGTGG + Intergenic
908045137 1:60160801-60160823 GACACTATTATCTACAATGGGGG + Intergenic
908648565 1:66306912-66306934 GGCACTTTTGTAAAAGATCGGGG + Intronic
910687270 1:89930082-89930104 GACAATTTTTCCAGAAATGGGGG - Intronic
912613245 1:111070322-111070344 TATACTTTTGTGAAAAATGTTGG + Intergenic
914006294 1:143735462-143735484 AATACTGTTTTCAAAAATGGTGG + Intergenic
916486323 1:165262899-165262921 GACAATTTTGTTAGAAAAGGTGG - Intronic
917117693 1:171618904-171618926 GATACTCATGTCAAAAAAGGGGG - Intergenic
917983931 1:180295408-180295430 AACACTCTTGTCAAAACTTGTGG - Intronic
918945180 1:191054597-191054619 GAGATTTTTGTGAATAATGGAGG - Intergenic
919459723 1:197862362-197862384 GACACTTTTGGCAAATCTGGAGG + Intergenic
919515884 1:198522125-198522147 GACAATTTTTCCAAGAATGGAGG - Intergenic
922877914 1:228955070-228955092 GGCACCCTTGTCAAAAATGTTGG + Intergenic
924374684 1:243392969-243392991 CTCCTTTTTGTCAAAAATGGTGG + Intronic
1064761589 10:18626922-18626944 AAGACTTTTATCAAAAAGGGAGG + Intronic
1066344471 10:34570566-34570588 GAAACTTTAGTCTAAATTGGAGG - Intronic
1066352378 10:34648484-34648506 GACAATTTTTCCACAAATGGGGG + Intronic
1072353698 10:94584831-94584853 AACAGTTTTATCAAAAATAGGGG + Intronic
1072806245 10:98425557-98425579 GACAAGTTTGTCAAGAATCGAGG - Exonic
1073020390 10:100438583-100438605 GATACTTTTCTAGAAAATGGGGG - Intergenic
1073393473 10:103198598-103198620 GACACTTGGGTAAAAAATGAAGG + Intergenic
1073529908 10:104221427-104221449 GACACTTATCTCAACCATGGGGG - Intronic
1074167738 10:110899822-110899844 GACAGTTTTGTCATTACTGGTGG + Exonic
1075056861 10:119225466-119225488 GACACTGTTGTCACATACGGGGG + Intronic
1078551298 11:12282182-12282204 GTCACTTTTTTAAAAAATGAGGG - Intronic
1079294642 11:19222043-19222065 AAGACTTTTGTGAACAATGGGGG + Intergenic
1080236788 11:30079344-30079366 GACTTTTTTTTCAAAAATCGAGG + Intergenic
1081923725 11:46804532-46804554 GTCACTTTTCTCATAAATTGAGG + Intronic
1082841383 11:57692946-57692968 GACACTTTTTCCACAGATGGGGG + Intronic
1083026280 11:59553880-59553902 GGCACTTTTGTAAGAAGTGGAGG + Intergenic
1084377613 11:68788798-68788820 AACCCTTTTGGCAAAAATGAAGG + Intronic
1084923211 11:72489280-72489302 GACAATTGTATCATAAATGGGGG + Intergenic
1086702339 11:89913613-89913635 GACACCTTTGTCTGAAATAGCGG + Intronic
1086703828 11:89930837-89930859 GACACCTTTGTCTGAAATAGCGG - Intergenic
1086734828 11:90293320-90293342 GACACTTTTGTAAATAATGATGG + Intergenic
1088288855 11:108214193-108214215 GACACTGTTATGAAAAATGCAGG - Intronic
1091601893 12:1922702-1922724 GACACTTTCATCATAAAAGGTGG - Intergenic
1091671315 12:2454077-2454099 GACACAAATGTCAAAACTGGAGG - Intronic
1101371534 12:104136142-104136164 GCAATTTTAGTCAAAAATGGTGG - Intronic
1101974935 12:109349267-109349289 TACACTTTTTTGAAAAATGGAGG + Intronic
1101979987 12:109397639-109397661 TACACTTATTACAAAAATGGAGG - Intronic
1105373820 13:19825115-19825137 TACACTTTTGAAAAAAATAGAGG - Intronic
1105937657 13:25117016-25117038 GTGAGTTTTGGCAAAAATGGGGG + Intergenic
1109691557 13:65898746-65898768 GACACCTCTGTCAAAAATGAGGG + Intergenic
1109986221 13:69989241-69989263 GTCACCTTTGTCAAAAATCATGG + Intronic
1110463098 13:75768668-75768690 GACACTTTTCACAGAAATGAAGG - Intronic
1110680453 13:78305597-78305619 GACACTTTTTTAAAAAGTGGAGG + Intergenic
1112492415 13:99879357-99879379 GACACATTTGTTCAAAAGGGAGG - Intronic
1112640683 13:101270891-101270913 GTCACCTTTGGCAAAAATGAAGG - Intronic
1112880342 13:104099212-104099234 GACACTCTTTTCAAAAATGATGG - Intergenic
1114216015 14:20658343-20658365 GAAACTTTTGTCAAAGATGTGGG - Intergenic
1115033193 14:28823931-28823953 TATACTTTTGTGAAAAAAGGTGG + Intergenic
1115103071 14:29726527-29726549 GACACTTATGTCAATACAGGTGG + Intronic
1115470965 14:33768117-33768139 GACATTTTTATCAAAGATGATGG + Intronic
1115567057 14:34633723-34633745 AACATTTTTGTCAAAAATCAAGG + Intergenic
1115628084 14:35215489-35215511 GACAGTTTTGTCAGATGTGGTGG + Intronic
1115734704 14:36312599-36312621 GAAACTTTTTTGAAAAGTGGTGG - Intronic
1115842986 14:37492875-37492897 GACATTTTTGTCACAACTGGTGG - Intronic
1116204833 14:41850973-41850995 AACCCTTTGGGCAAAAATGGTGG - Intronic
1116348660 14:43830017-43830039 GAAACTTTTCTAAAAAATTGAGG - Intergenic
1117529608 14:56646774-56646796 GAAATTTCTGTCAAAAATGTGGG + Intronic
1117866310 14:60153153-60153175 GACATTCTGGTCAACAATGGTGG - Exonic
1120364318 14:83546174-83546196 GTCCCTTGTGTGAAAAATGGGGG - Intergenic
1120678103 14:87446101-87446123 GACTCTTTTGTCAAATAAGTTGG + Intergenic
1120695020 14:87635061-87635083 GAGACTGTGGTCAACAATGGAGG - Intergenic
1124192761 15:27594800-27594822 GAGCCTTATGTCAGAAATGGCGG + Intergenic
1124702235 15:31926038-31926060 GACATTTTTTTCAAACATGTTGG - Intergenic
1125002125 15:34782672-34782694 GAAACTATTCCCAAAAATGGAGG - Intergenic
1125449880 15:39797058-39797080 GATACCTTTGGCACAAATGGGGG + Intergenic
1126297546 15:47157446-47157468 TACACTTTGATCAAAATTGGGGG - Intergenic
1127604933 15:60576821-60576843 GAAACTTTTGTCATGAATGTAGG - Intronic
1130008823 15:80130441-80130463 GACATTTTGCTCTAAAATGGTGG - Intronic
1130080816 15:80731846-80731868 GACTCTTTTTTTAAAAATTGTGG + Intronic
1131823741 15:96299119-96299141 GAGAATTTTGGCAAAAATGATGG + Intergenic
1133619590 16:7513615-7513637 GACAGTTTTGTCACAAATGAGGG - Intronic
1133844645 16:9442586-9442608 TACACTTTTCTGTAAAATGGGGG + Intergenic
1134492300 16:14704082-14704104 CACACTTTTGTGAACAAAGGTGG - Intergenic
1134497681 16:14743204-14743226 CACACTTTTGTGAACAAAGGTGG - Intronic
1136152923 16:28364152-28364174 CACACTTTTGTGAACAAAGGTGG + Intergenic
1136210160 16:28751121-28751143 CACACTTTTGTGAACAAAGGTGG - Intergenic
1137295252 16:47086185-47086207 CACTCTTTTCTCAAAAATGTTGG + Intronic
1139089054 16:63621334-63621356 GACACTTATGTCAAATATTCTGG + Intergenic
1139242346 16:65406099-65406121 GCCAATTTTGTGAAAAATGTTGG - Intergenic
1144137828 17:12315441-12315463 GACAATTTTGTCTAACATGCTGG - Intergenic
1144186512 17:12801391-12801413 GAGACTTGTGTAGAAAATGGGGG - Intronic
1144238149 17:13282899-13282921 GAGTCTTTTGTCAAAAATTGGGG + Intergenic
1146819882 17:35976389-35976411 GAGACTTTTGTCAAGGTTGGGGG - Intergenic
1153021698 18:635214-635236 GACAATTTTTCCAAAGATGGTGG + Intronic
1153823854 18:8856702-8856724 TACGCCTTTGTCAGAAATGGAGG + Intergenic
1154236238 18:12608951-12608973 GACAATTTTTCCACAAATGGGGG + Intronic
1154295143 18:13140916-13140938 GCCACTTTTGTGTAAAATGTTGG + Intergenic
1155595524 18:27481587-27481609 GACATTTTTCTAATAAATGGTGG + Intergenic
1155706524 18:28822513-28822535 GATACTTTTTTCAGAAATGAAGG - Intergenic
1156361385 18:36387265-36387287 GACACTTTTGTCAAAAATGGGGG + Intronic
1156692334 18:39723134-39723156 GACACTTTTGAGAAACATGAAGG - Intergenic
1157458547 18:47861662-47861684 AAGATTTTTGTCAAAAATGAGGG - Intronic
1159647567 18:70936946-70936968 GACACTTTTTCCACAAATGGGGG - Intergenic
1159696122 18:71558131-71558153 CACACTGATGTCAAAACTGGAGG + Intergenic
1161366630 19:3883638-3883660 GGCACTTTTGTCACAACTGAGGG - Intronic
1161827846 19:6580990-6581012 CACTCTTTTTTCAAAAATTGAGG + Intergenic
1166345532 19:42163001-42163023 GACACTGCTGTGGAAAATGGAGG + Intronic
1168143018 19:54402097-54402119 GACAATTTTGGCCAACATGGTGG - Intergenic
926557070 2:14370909-14370931 GAAACTATTGCCAAAAATTGAGG + Intergenic
926882635 2:17564174-17564196 AACACTTGTGAAAAAAATGGGGG - Intronic
927346429 2:22048743-22048765 GACCCTTTTGACAAAACTGATGG + Intergenic
928818741 2:35333925-35333947 TACACTTTTGTGAACAAAGGTGG + Intergenic
929488308 2:42374362-42374384 GACACTTCTGTGAAAAAAGTAGG - Intronic
930352120 2:50270039-50270061 GAGACTTTGGTCAGAAACGGAGG - Intronic
930688049 2:54330362-54330384 GAAGGTTTTGTCAGAAATGGTGG + Intronic
931020333 2:58037560-58037582 AACACTTTTATGAAAAATGGGGG - Intronic
931696615 2:64875714-64875736 AACACATTAATCAAAAATGGAGG + Intergenic
931793176 2:65683727-65683749 GCCACTTTTGTGCAACATGGAGG - Intergenic
931872903 2:66480840-66480862 GAAACTTTTGTGAAGAATGGTGG + Intronic
932853039 2:75205601-75205623 GAAACTATTCTCAAAAATTGAGG - Intergenic
933303884 2:80573561-80573583 CCCACTTTTGTCAGAAATGCTGG - Intronic
939212087 2:139188785-139188807 GACACTTTTCACAGAAATAGGGG - Intergenic
940588537 2:155687953-155687975 GACACTTTTGACAAAAACGTAGG + Intergenic
940693730 2:156953078-156953100 GACACTATTGCCAAAAATTGAGG - Intergenic
940930850 2:159428841-159428863 GCCACTTTGGTCAAAATTGAGGG - Intronic
941341785 2:164314731-164314753 GACACTTTTGTCAGATAATGTGG + Intergenic
948094787 2:235324922-235324944 TCCATTGTTGTCAAAAATGGAGG - Intergenic
1169013507 20:2272046-2272068 CACGCATTTGTCAAAACTGGGGG - Intergenic
1169453594 20:5732971-5732993 GACATTTTTGTCACAACTGCAGG + Intergenic
1169527453 20:6445414-6445436 GACAATTTTTTCACAGATGGGGG - Intergenic
1170661836 20:18349444-18349466 GACATTTTTGTCAAAACTTCGGG + Intergenic
1170721772 20:18887223-18887245 GGCAGTTTTTTCAAAAATTGAGG + Intergenic
1171326061 20:24294267-24294289 GAAGCTTTTATTAAAAATGGGGG + Intergenic
1172575507 20:36005217-36005239 GACAATTTTTTCACAGATGGGGG + Intronic
1174866563 20:54142045-54142067 GACAATTTTTCCACAAATGGTGG + Intergenic
1177684029 21:24413804-24413826 GAGAATAATGTCAAAAATGGAGG + Intergenic
1178140063 21:29672562-29672584 GACCTTTTTGTCAAACATGCAGG - Intronic
1178415931 21:32405112-32405134 GACAATTTTTCCAAAGATGGGGG + Intergenic
1183291866 22:37007592-37007614 GAGACTTTGGTCAAAGAGGGCGG + Intronic
1183380973 22:37490356-37490378 AACACTTTTGTCATAGATGCTGG - Exonic
950829154 3:15857824-15857846 AACAACTTTGTCAAAAATGCAGG + Intronic
950936645 3:16846024-16846046 GTCAGTTTTCTGAAAAATGGGGG + Intronic
954790732 3:53131385-53131407 GACACTTTGGACAAAGAGGGTGG - Intergenic
955985081 3:64564704-64564726 GACAGTTTTGTCACAAGTTGGGG - Intronic
956549404 3:70441533-70441555 GACACTTTAGCCTATAATGGCGG - Intergenic
956979861 3:74623210-74623232 GAGTCTTTTGTCCAAAATGATGG + Intergenic
957525842 3:81378000-81378022 TACACTTTTTCCATAAATGGTGG + Intergenic
959979657 3:112501866-112501888 GACACTTTTTATAAAATTGGTGG + Intergenic
960712676 3:120546581-120546603 GGCACTTCTGTGAAGAATGGGGG - Intergenic
963099890 3:141590429-141590451 GACACTACTGTAAAAAATAGAGG - Intronic
964029741 3:152123533-152123555 GACACTTTTCTAAAACTTGGTGG - Intergenic
964139627 3:153382015-153382037 GATACTTTCATCAAAAATTGGGG + Intergenic
964291969 3:155191406-155191428 GACACTAATCTCAAACATGGAGG - Intergenic
965604909 3:170488556-170488578 GGCACCTTTGTCAAAAATGAAGG - Intronic
966114186 3:176442347-176442369 GACATTTTTCTCACAAATGCTGG + Intergenic
966951485 3:184822567-184822589 TACACATTTTTCAAAAATAGTGG - Intronic
968593704 4:1472044-1472066 AACACTTTTATCAAAATTGGCGG + Intergenic
969936298 4:10685306-10685328 GAAACTTTTTTAAAAAATGAGGG + Intergenic
970390053 4:15599890-15599912 GATACTTATATGAAAAATGGTGG - Intronic
971424904 4:26506109-26506131 CAAACTTTTGTTAAAAATGGTGG + Intergenic
972159487 4:36205706-36205728 CACATTTATGTGAAAAATGGAGG + Intronic
973722015 4:53733566-53733588 GATTCTTTTTTAAAAAATGGAGG + Intronic
973723128 4:53745174-53745196 AACTCTTTTTTAAAAAATGGGGG + Intronic
974223893 4:59013606-59013628 CACACTTTTCTGAAAAATGCAGG - Intergenic
974819892 4:67052826-67052848 GACTATTTTTTCAAAAATAGTGG - Intergenic
975242552 4:72078767-72078789 TACATTTTTGTCAAAAATTTGGG - Intronic
975374242 4:73624503-73624525 GACACTTTTATCAAATACTGAGG + Intergenic
977935292 4:102795289-102795311 GACACTTTTATGAAACACGGTGG - Intronic
979442043 4:120761952-120761974 TACACTTTTTTAAAAAATTGTGG - Intronic
980905773 4:138947386-138947408 TACACATTTGTTAAATATGGGGG + Intergenic
983124147 4:163929864-163929886 GACACTTTTGTGAAAGAAAGAGG + Intronic
983768875 4:171522550-171522572 GACACATCTTTCAAAAATGAAGG + Intergenic
984023680 4:174518017-174518039 GACATTTTGGTCAATAATGCTGG - Exonic
986888228 5:12266640-12266662 GACACTTTAGTCACAAAAGCTGG - Intergenic
988303828 5:29468775-29468797 GAAACTTTTGGCAAAAGTGATGG - Intergenic
988325646 5:29763561-29763583 CACACTTCTGTGAAACATGGTGG + Intergenic
988903020 5:35754305-35754327 GACACTATTGTCAGCAATAGGGG + Intronic
989472486 5:41836554-41836576 GACACTTTTTCCACAGATGGGGG + Intronic
989974621 5:50569668-50569690 AAAACTTTTGTGAAAAATAGAGG + Intergenic
990976739 5:61567493-61567515 GACATTTTTGTCACAATTAGGGG - Intergenic
991076319 5:62543209-62543231 AAAACTTTTGTGAAAAATGCAGG - Intronic
992136606 5:73752322-73752344 GACACTATTGTCAGAAGAGGGGG + Intronic
994727267 5:103451345-103451367 GAGACTTTTGGCAGAACTGGAGG - Intergenic
994993323 5:107026963-107026985 GAGGCTTTTGTTAAAAATGATGG - Intergenic
995929769 5:117425588-117425610 GACACTTTTTTCAAAAGTGTTGG - Intergenic
997106511 5:131026046-131026068 GACTCCTTTGTCTGAAATGGTGG - Intergenic
997330040 5:133053174-133053196 GACACAGTTCTAAAAAATGGTGG + Intronic
998494799 5:142578872-142578894 GACAATTTTGAAAAAATTGGAGG - Intergenic
999482096 5:151958166-151958188 GATACATTTGTCACAAAAGGAGG + Intergenic
999848981 5:155516955-155516977 GACACCTGTGTCGAAAAAGGGGG - Intergenic
1001040688 5:168333013-168333035 TTCACTTTTATTAAAAATGGTGG + Intronic
1001156819 5:169279551-169279573 GGCACTTTTGTTAGAAAAGGTGG - Intronic
1003485250 6:6570084-6570106 GAGACAGTTGGCAAAAATGGAGG - Intergenic
1004156155 6:13170255-13170277 GAAACATTTGTCAAAATTAGAGG - Intronic
1004612698 6:17259920-17259942 TAAACTTTTGCCAAAAATGCAGG - Intergenic
1005063963 6:21800254-21800276 GACACTTTTTTAAAAACAGGGGG - Intergenic
1005466308 6:26118068-26118090 GATATTTTTACCAAAAATGGAGG - Intronic
1005518079 6:26573399-26573421 AACTCTCTTGTCTAAAATGGTGG - Intergenic
1006306827 6:33227068-33227090 AACACTGTTGACAAAAATGTGGG + Intergenic
1007569742 6:42880945-42880967 GGCACTTTTGGCAAAGAAGGAGG + Exonic
1007869081 6:45012109-45012131 GACACTTTTACCAAAAATGTGGG - Intronic
1007947398 6:45838577-45838599 GAGACTCTTGGCAAAACTGGAGG - Intergenic
1008895632 6:56551528-56551550 GAAACATTTGATAAAAATGGTGG - Intronic
1011209734 6:84942291-84942313 AAAACTTTTTTCAAAATTGGAGG - Intergenic
1011946826 6:92915128-92915150 CATACTGTTTTCAAAAATGGTGG - Intergenic
1012306211 6:97661221-97661243 GACACCTTTTTCCAAAATTGTGG - Intergenic
1013212907 6:108002618-108002640 GACAGTTTTATTAAAAATGTAGG - Intergenic
1014549243 6:122770374-122770396 GACACTTTTATCTGATATGGAGG + Intergenic
1015681347 6:135812199-135812221 CACACATTTGCCAAATATGGAGG + Intergenic
1016624421 6:146149551-146149573 GTCCCTTTTGTGTAAAATGGAGG - Intronic
1016638880 6:146325646-146325668 GACAATTTTGTGAAGAATGTTGG - Intronic
1018376594 6:163218878-163218900 GACACTTTTGTCACAAGGTGGGG + Intronic
1018990470 6:168669807-168669829 GATATTTTTGACAAAAATGCAGG - Intronic
1021421686 7:20452321-20452343 GACACTTTTCTCATTAATAGTGG + Intergenic
1022341335 7:29471385-29471407 GAGACTGATGTCAAAAATTGTGG - Intronic
1024851888 7:53728083-53728105 GACTCTTTGGTGAAAAATTGAGG - Intergenic
1027475752 7:78629365-78629387 GAAACTGATGTCAAAGATGGAGG - Intronic
1027746998 7:82088828-82088850 GACAATTTTTCCACAAATGGAGG + Intronic
1028065975 7:86384948-86384970 GTCACTTTTTTAAAAAATGAGGG - Intergenic
1028874401 7:95804725-95804747 GTCACTTTTGTCAGACATGTTGG - Exonic
1030191926 7:106818785-106818807 GATACTTTTGTCACAAAAGATGG - Intergenic
1033531793 7:142271618-142271640 TTCACTTTTGCCATAAATGGGGG + Intergenic
1033886788 7:145959174-145959196 TTCTCTTTTGTCAAAAATTGCGG + Intergenic
1034228351 7:149499800-149499822 GACACCTGTGCCCAAAATGGAGG - Intergenic
1038685630 8:29715009-29715031 GAAAATTTTGTTAAACATGGTGG - Intergenic
1038880959 8:31611086-31611108 GACATTCTTGTTCAAAATGGGGG - Intergenic
1039065277 8:33602197-33602219 TACACTTTTTTCAAAAAGCGGGG + Intergenic
1051188780 9:14488385-14488407 GAAAAGTTTGTTAAAAATGGAGG + Intergenic
1051924218 9:22304135-22304157 AACAATTTTCTAAAAAATGGTGG + Intergenic
1052189489 9:25642075-25642097 GACAATTTTTCCACAAATGGGGG + Intergenic
1052258290 9:26485150-26485172 GGCACCTTTGTCAAAAATGTAGG + Intergenic
1053022646 9:34706559-34706581 GACAATGTTGTCAAAGATGAAGG + Intergenic
1059336410 9:113571965-113571987 GTCACCTTTGTCAGAAATTGAGG + Intronic
1060698183 9:125728151-125728173 GCCACTATTGTCAAAGTTGGTGG + Intergenic
1187392445 X:18894972-18894994 GACATTTTTGCCAAATATGAGGG + Intronic
1189842366 X:45094079-45094101 GACAATTATTTCAAAAAGGGAGG - Intronic
1191159668 X:57315356-57315378 GAAACTATTCTAAAAAATGGAGG + Intronic
1191651494 X:63543040-63543062 GACACTATGTTGAAAAATGGTGG - Intergenic
1193390529 X:80922322-80922344 GAAACTTTTCTAAAAAATTGTGG - Intergenic
1193517227 X:82481111-82481133 GACAATTTTTGAAAAAATGGTGG + Intergenic
1196428300 X:115595223-115595245 GAAACTTTTACCTAAAATGGAGG + Intronic
1196861168 X:120028289-120028311 GACACTATTGGCAAAAAGTGAGG + Intergenic
1197808842 X:130423159-130423181 GACAATTTTTCCACAAATGGGGG - Intergenic
1198686019 X:139228912-139228934 GACACTTTTGATAAAAATTTAGG + Intergenic
1199405056 X:147447255-147447277 CAAACTATTGTGAAAAATGGAGG - Intergenic
1201388201 Y:13466679-13466701 GCCACTTTTGTTAAAAATTTTGG - Intronic
1201552045 Y:15227857-15227879 GGTACTTTTGTTGAAAATGGTGG + Intergenic
1202170716 Y:22040922-22040944 GACCTTTTTTTCCAAAATGGTGG + Intergenic
1202220647 Y:22545451-22545473 GACCTTTTTTTCCAAAATGGTGG - Intergenic
1202322466 Y:23650212-23650234 GACCTTTTTTTCCAAAATGGTGG + Intergenic
1202548307 Y:26019844-26019866 GACCTTTTTTTCCAAAATGGTGG - Intergenic