ID: 1156361863

View in Genome Browser
Species Human (GRCh38)
Location 18:36390789-36390811
Sequence GATTCTCCACTCCCTTGAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 348
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 336}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156361859_1156361863 -6 Left 1156361859 18:36390772-36390794 CCTGTTACGCCTGGAGTGATTCT 0: 1
1: 0
2: 0
3: 7
4: 69
Right 1156361863 18:36390789-36390811 GATTCTCCACTCCCTTGAAGGGG 0: 1
1: 0
2: 1
3: 10
4: 336
1156361855_1156361863 19 Left 1156361855 18:36390747-36390769 CCCACACTTAACACATGATGATG 0: 1
1: 0
2: 1
3: 19
4: 206
Right 1156361863 18:36390789-36390811 GATTCTCCACTCCCTTGAAGGGG 0: 1
1: 0
2: 1
3: 10
4: 336
1156361856_1156361863 18 Left 1156361856 18:36390748-36390770 CCACACTTAACACATGATGATGG 0: 1
1: 0
2: 0
3: 14
4: 245
Right 1156361863 18:36390789-36390811 GATTCTCCACTCCCTTGAAGGGG 0: 1
1: 0
2: 1
3: 10
4: 336

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156361863 Original CRISPR GATTCTCCACTCCCTTGAAG GGG Intronic
905118162 1:35660350-35660372 GACTCTCCACTGTCTTCAAGAGG + Intergenic
905620979 1:39447152-39447174 TACTCTCCACTTCCTTGAACGGG - Intronic
907931118 1:59001442-59001464 CATTCTCAACTCCTTTTAAGTGG + Intergenic
909176808 1:72371503-72371525 GATTTTCCCCTCCCTGGAAAAGG - Intergenic
909835084 1:80243973-80243995 GATTCTTCACTCACATGAACAGG + Intergenic
910238481 1:85060915-85060937 GCTTGTCCACTCCCAGGAAGTGG - Intronic
911311477 1:96297349-96297371 GATTCTTCACTTCCTTGCATTGG + Intergenic
911749237 1:101477206-101477228 GATTCTTCAATCCCTTCAAGTGG - Intergenic
911862352 1:102968682-102968704 GATTCACTATTCCCTTAAAGTGG + Intronic
915668867 1:157470395-157470417 CCTTCTCCACTCCCTGGCAGAGG + Intergenic
917725351 1:177822426-177822448 GATCCTCCACTCTATTGGAGAGG + Intergenic
921100291 1:211922876-211922898 GACTCTCCACTCCCTCCCAGGGG + Intergenic
1063627312 10:7702136-7702158 GATTCTCCCCTCCCTTGCCTAGG - Intergenic
1067251990 10:44594272-44594294 AATTCTCCACTCCCCTGGAAAGG + Intergenic
1068350411 10:55837234-55837256 GCTTCTCCATTCCCTGGATGTGG - Intergenic
1075245750 10:120820974-120820996 GACTCTTCACTCTTTTGAAGTGG + Intergenic
1079106685 11:17576571-17576593 GATAGTCCACTCCCTGGAAGTGG - Exonic
1081628617 11:44671822-44671844 AATTCTCCAGTCCCCTGAATGGG + Intergenic
1082252077 11:49993652-49993674 GATTATCAAATGCCTTGAAGTGG - Intergenic
1084077228 11:66789323-66789345 CATTCTCCATTCCCTTTAACAGG + Intronic
1087833433 11:102845192-102845214 GGTTCTCCATTCCTTTGATGGGG + Intergenic
1088021023 11:105119706-105119728 AATTCTCCAGTCCTTTGAACTGG + Intergenic
1090848038 11:130546710-130546732 CCTTCCCCACTCCCTTGCAGGGG - Intergenic
1093087699 12:14885300-14885322 GATTGTCCAGTCCCTAGAAAGGG + Intronic
1093784135 12:23173335-23173357 GTTCCTTCACTCCCTTGAATAGG + Intergenic
1094336626 12:29364266-29364288 GATTCTCCATTCTGTTGAGGGGG - Intronic
1096835643 12:54349322-54349344 GATCCTCAACTCCCTTAACGTGG - Intronic
1097279085 12:57833443-57833465 CATTCCCCACTCCCTTGATGGGG + Intronic
1099677152 12:85775655-85775677 GATTCTACACTTCCTTGAAAAGG + Intergenic
1100607967 12:96167410-96167432 GGTTCTCAACTCCCATGAAAAGG + Intergenic
1100839078 12:98593861-98593883 CCGTCTCCACGCCCTTGAAGAGG - Intronic
1104433146 12:128732991-128733013 GATTCTCCATTTTCCTGAAGTGG + Intergenic
1106456761 13:29934627-29934649 GATACTCCACTTCCCAGAAGTGG - Intergenic
1107709602 13:43138791-43138813 GCTTCTCTACTTCCTGGAAGGGG - Intergenic
1107876689 13:44796932-44796954 GATTCTCCACAACCAGGAAGTGG + Intergenic
1108185665 13:47886087-47886109 GATTCTCCCCACCCTTACAGAGG - Intergenic
1110467797 13:75822546-75822568 GAATCCCCTCTCCCTTGAATTGG - Intronic
1120025641 14:79581065-79581087 GAGTCCCCACTCCCTGGAAAAGG - Intronic
1121708631 14:96020130-96020152 GATTCTCCCTCCCCTGGAAGAGG - Intergenic
1121999406 14:98634531-98634553 AATTCACCACTGCCTTGCAGCGG + Intergenic
1125360100 15:38856183-38856205 GATTCTCCAAGCCCATGAAATGG + Intergenic
1126404413 15:48308425-48308447 GTTTCCCCACTCTCTAGAAGAGG + Intergenic
1128318926 15:66679252-66679274 GTTTCTCAACTCCCTGGAGGTGG - Intronic
1129452199 15:75657391-75657413 AATTCCCCACTCCTTAGAAGTGG + Exonic
1131234708 15:90685489-90685511 CATCCTCCACTCCCTTGATGTGG + Intergenic
1133184570 16:4086292-4086314 GATTCTCCACTTGCTTGCAATGG - Intronic
1143741213 17:8955300-8955322 GACTCTCCAGTGCCTTGCAGGGG - Intronic
1146615782 17:34356435-34356457 GCTTCTCCACTCCCTATAAAAGG + Exonic
1148767216 17:50046400-50046422 GCTTCTCCAGGCCCTAGAAGTGG + Intergenic
1149221770 17:54422992-54423014 GATTCTCTACTCCATTCAATTGG - Intergenic
1149644973 17:58233953-58233975 GATTCTCCTGTCTCTGGAAGAGG - Intronic
1150565970 17:66340312-66340334 GATTCTGCAGTCCCTTGTGGAGG - Intronic
1152028378 17:77826432-77826454 GGTTCTCCAGTCTCTTGCAGAGG - Intergenic
1153715924 18:7847885-7847907 TAGTGTCCACTCCCTTGAGGGGG - Intronic
1154348274 18:13562373-13562395 GTTTCTCCACTCCCTTAACTAGG + Intronic
1156361863 18:36390789-36390811 GATTCTCCACTCCCTTGAAGGGG + Intronic
1161759827 19:6162958-6162980 GGTTCTACTCTCCCTTGCAGAGG - Intronic
925343299 2:3151443-3151465 GATTCACCACTCCATTGACCTGG + Intergenic
926843403 2:17107093-17107115 TAGTCTCCACTGCCCTGAAGGGG - Intergenic
932294533 2:70613353-70613375 GAAACTCCACTCCCTTTAGGGGG - Intronic
932932098 2:76053452-76053474 GATTCTTCATTCCTATGAAGAGG + Intergenic
936724753 2:115299962-115299984 GATTCTCTACATCCTTCAAGTGG + Intronic
937648153 2:124288681-124288703 GATTTTCCACTCCCTTCTATGGG + Intronic
940062983 2:149593184-149593206 GAAGCTCAGCTCCCTTGAAGGGG - Intergenic
942616713 2:177798820-177798842 TATGCTCCACCTCCTTGAAGAGG - Intronic
944449948 2:199832732-199832754 GATTCTCCATTGCCTTGTGGAGG - Intronic
946091732 2:217231654-217231676 GCTTCTACTCACCCTTGAAGGGG - Intergenic
1171327052 20:24303962-24303984 AATTCACCACTCCCTTGGTGAGG - Intergenic
1171355906 20:24545215-24545237 GACTCTCCACTCCCTGCCAGTGG - Intronic
1171586071 20:26525682-26525704 CATTTTCCATTCCCTGGAAGTGG + Intergenic
1171590410 20:26588127-26588149 CATTTTCCATTCCCTGGAAGTGG + Intergenic
1171633547 20:27240034-27240056 CTTTCTCCATTCCCTGGAAGTGG + Intergenic
1172304225 20:33870261-33870283 TATTGTCCCCTCCCTTGGAGGGG + Intergenic
1174823916 20:53751576-53751598 GATTTTCCACTGCCTTCTAGAGG - Intergenic
1178091566 21:29168976-29168998 GAATCTCCACTTCCTTTAGGTGG + Intronic
1181132107 22:20738081-20738103 GACTCTCCACTTCCCAGAAGAGG - Intronic
949355474 3:3176106-3176128 TATGCTCCACTCCCTTGAAGAGG + Intronic
949785344 3:7734118-7734140 GCTTCTCCATTCTCTTGAAGTGG + Intronic
954542927 3:51407450-51407472 TGTTCTCCACTGCCTAGAAGCGG - Intronic
958568181 3:95843040-95843062 GATATTCCACGCCCTTGAATTGG + Intergenic
959359679 3:105372535-105372557 AATTATCCATTCCATTGAAGGGG + Intronic
964025416 3:152067869-152067891 GTTTCTCTACTCCTTTGAAATGG + Intergenic
964615228 3:158656614-158656636 TATGTTCCACCCCCTTGAAGGGG + Intronic
964670130 3:159216029-159216051 TTTTCTCCCTTCCCTTGAAGAGG + Intronic
964683704 3:159370627-159370649 GATTCTCACCTGCATTGAAGAGG - Intronic
964763677 3:160158010-160158032 GATGCTGCACAGCCTTGAAGAGG - Intergenic
965261806 3:166496108-166496130 AATTCTCAAGTCTCTTGAAGAGG - Intergenic
967073366 3:185981291-185981313 GATTGTCCACTTCCGGGAAGGGG + Intergenic
967540857 3:190666196-190666218 GATTCTGCACTACCTGAAAGGGG - Intergenic
969054577 4:4393661-4393683 GATTCACAACTGCCCTGAAGGGG + Intronic
969505647 4:7585561-7585583 GTTTCTACAATACCTTGAAGTGG - Intronic
969622983 4:8288106-8288128 AAATCTCCTCTCCCTTGATGGGG - Intronic
970468374 4:16350534-16350556 GCTGTTCAACTCCCTTGAAGTGG - Intergenic
973404700 4:49716223-49716245 CTTTCTGCACTCCCTGGAAGTGG + Intergenic
973406086 4:49738688-49738710 CTTTCTGCACTCCCTGGAAGTGG + Intergenic
973406169 4:49740049-49740071 CTTTCTGCACTCCCTGGAAGTGG + Intergenic
973409030 4:49786997-49787019 CTTTCTGCACTCCCTGGAAGTGG + Intergenic
973409343 4:49792095-49792117 CTTTCTGCACTCCCTGGAAGTGG + Intergenic
973410355 4:49808924-49808946 CTTTCTGCACTCCCTGGAAGTGG + Intergenic
973411974 4:49835630-49835652 CTTTCTGCACTCCCTGGAAGTGG + Intergenic
973412443 4:49843285-49843307 CTTTCTGCACTCCCTGGAAGTGG + Intergenic
973412590 4:49845831-49845853 CTTTCTGCACTCCCTGGAAGTGG + Intergenic
973412746 4:49848381-49848403 CTTTCTGCACTCCCTGGAAGTGG + Intergenic
973412896 4:49850931-49850953 CTTTCTGCACTCCCTGGAAGTGG + Intergenic
973413094 4:49854162-49854184 CTTTCTGCACTCCCTGGAAGTGG + Intergenic
973415174 4:49888336-49888358 CTTTCTGCACTCCCTGGAAGTGG + Intergenic
973415300 4:49890373-49890395 GTTTCTGCACTACCTGGAAGAGG + Intergenic
973415522 4:49894113-49894135 CTTTCTGCACTCCCTGGAAGTGG + Intergenic
973415676 4:49896661-49896683 CTTTCTGCACTCCCTGGAAGTGG + Intergenic
973415828 4:49899207-49899229 CTTTCTGCACTCCCTGGAAGTGG + Intergenic
973417135 4:49920632-49920654 CTTTCTGCACTCCCTGGAAGTGG + Intergenic
973418764 4:49947651-49947673 CTTTCTGCACTCCCTGGAAGTGG + Intergenic
973418833 4:49948836-49948858 CTTTCTGCACTCCCTGGAAGTGG + Intergenic
973418980 4:49951382-49951404 CTTTCTGCACTCCCTGGAAGTGG + Intergenic
973419133 4:49953929-49953951 CTTTCTGCACTCCCTGGAAGTGG + Intergenic
973420516 4:49976545-49976567 CTTTCTGCACTCCCTGGAAGTGG + Intergenic
973420670 4:49979092-49979114 CTTTCTGCACTCCCTGGAAGTGG + Intergenic
973420819 4:49981639-49981661 CTTTCTGCACTCCCTGGAAGTGG + Intergenic
973421915 4:49999497-49999519 CTTTCTGCACTCCCTGGAAGTGG + Intergenic
973422061 4:50002044-50002066 CTTTCTGCACTCCCTGGAAGTGG + Intergenic
973422550 4:50010207-50010229 CTTTCTGCACTCCCTGGAAGTGG + Intergenic
973422711 4:50012924-50012946 CTTTCTGCACTCCCTGGAAGTGG + Intergenic
973423459 4:50025167-50025189 CTTTCTGCACTCCCTGGAAGTGG + Intergenic
973423613 4:50027718-50027740 CTTTCTGCACTCCCTGGAAGTGG + Intergenic
973423964 4:50033499-50033521 CTTTCTGCACTCCCTGGAAGTGG + Intergenic
973424118 4:50036046-50036068 CTTTCTGCACTCCCTGGAAGTGG + Intergenic
973424273 4:50038594-50038616 CTTTCTGCACTCCCTGGAAGTGG + Intergenic
973425108 4:50052534-50052556 CTTTCTGCACTCCCTGGAAGTGG + Intergenic
973425381 4:50056962-50056984 CTTTCTGCACTCCCTGGAAGTGG + Intergenic
973425894 4:50065462-50065484 GTTTCTGCACTACCTGGAAGAGG + Intergenic
973426704 4:50078896-50078918 CTTTCTGCACTCCCTGGAAGTGG + Intergenic
973428812 4:50113764-50113786 CTTTCTGCACTCCCTGGAAGTGG + Intergenic
973428895 4:50115125-50115147 CTTTCTGCACTCCCTGGAAGTGG + Intergenic
973429822 4:50130591-50130613 CTTTCTGCACTCCCTGGAAGTGG + Intergenic
973429972 4:50133142-50133164 CTTTCTGCACTCCCTGGAAGTGG + Intergenic
973431224 4:50153725-50153747 CTTTCTGCACTCCCTGGAAGTGG + Intergenic
973432853 4:50180760-50180782 CTTTCTGCACTCCCTGGAAGTGG + Intergenic
973432934 4:50182119-50182141 CTTTCTGCACTCCCTGGAAGTGG + Intergenic
973433085 4:50184671-50184693 CTTTCTGCACTCCCTGGAAGTGG + Intergenic
973433229 4:50187222-50187244 CTTTCTGCACTCCCTGGAAGTGG + Intergenic
973433375 4:50189773-50189795 CTTTCTGCACTCCCTGGAAGTGG + Intergenic
973434076 4:50201336-50201358 CTTTCTGCACTCCCTGGAAGTGG + Intergenic
973434999 4:50216808-50216830 CTTTCTGCACTCCCTGGAAGTGG + Intergenic
973435151 4:50219356-50219378 CTTTCTGCACTCCCTGGAAGTGG + Intergenic
973437060 4:50250317-50250339 CTTTCTGCACTCCCTGGAAGTGG + Intergenic
973437215 4:50252868-50252890 CTTTCTGCACTCCCTGGAAGTGG + Intergenic
973437361 4:50255413-50255435 CTTTCTGCACTCCCTGGAAGTGG + Intergenic
973438253 4:50270203-50270225 CTTTCTGCACTCCCTGGAAGTGG + Intergenic
973438401 4:50272750-50272772 CTTTCTGCACTCCCTGGAAGTGG + Intergenic
973438745 4:50278522-50278544 CTTTCTGCACTCCCTGGAAGTGG + Intergenic
973439861 4:50296720-50296742 CTTTCTGCACTCCCTGGAAGTGG + Intergenic
973440824 4:50312708-50312730 CTTTCTGCACTCCCTGGAAGTGG + Intergenic
973442520 4:50340433-50340455 CTTTCTGCACTCCCTGGAAGTGG + Intergenic
973442588 4:50341620-50341642 CTTTCTGCACTCCCTGGAAGTGG + Intergenic
973444660 4:50375792-50375814 CTTTCTGCACTCCCTGGAAGTGG + Intergenic
973444808 4:50378340-50378362 CTTTCTGCACTCCCTGGAAGTGG + Intergenic
973445295 4:50386505-50386527 CTTTCTGCACTCCCTGGAAGTGG + Intergenic
973445635 4:50392287-50392309 CTTTCTGCACTCCCTGGAAGTGG + Intergenic
973446042 4:50399251-50399273 CTTTCTGCACTCCCTGGAAGTGG + Intergenic
973446194 4:50401798-50401820 CTTTCTGCACTCCCTGGAAGTGG + Intergenic
973447357 4:50421184-50421206 CTTTCTGCACTCCCTGGAAGTGG + Intergenic
973448000 4:50431887-50431909 CTTTCTGCACTCCCTGGAAGTGG + Intergenic
973449996 4:50464710-50464732 CTTTCTGCACTCCCTGGAAGTGG + Intergenic
973450340 4:50470489-50470511 CTTTCTGCACTCCCTGGAAGTGG + Intergenic
973450723 4:50476599-50476621 CTTTCTGCACTCCCTGGAAGTGG + Intergenic
973450876 4:50479147-50479169 CTTTCTGCACTCCCTGGAAGTGG + Intergenic
973450956 4:50480506-50480528 CTTTCTGCACTCCCTGGAAGTGG + Intergenic
973451112 4:50483056-50483078 CTTTCTGCACTCCCTGGAAGTGG + Intergenic
973451264 4:50485608-50485630 CTTTCTGCACTCCCTGGAAGTGG + Intergenic
973452078 4:50499210-50499232 CTTTCTGCACTCCCTGGAAGTGG + Intergenic
973454683 4:50542399-50542421 CTTTCTGCACTCCCTGGAAGTGG + Intergenic
973454833 4:50544950-50544972 CTTTCTGCACTCCCTGGAAGTGG + Intergenic
973454982 4:50547496-50547518 CTTTCTGCACTCCCTGGAAGTGG + Intergenic
973455133 4:50550043-50550065 CTTTCTGCACTCCCTGGAAGTGG + Intergenic
973455673 4:50559059-50559081 CTTTCTGCACTCCCTGGAAGTGG + Intergenic
973457779 4:50593239-50593261 CTTTCTGCACTCCCTGGAAGTGG + Intergenic
973458099 4:50598509-50598531 CTTTCTGCACTCCCTGGAAGTGG + Intergenic
973460309 4:50634578-50634600 CTTTCTGCACTCCCTGGAAGTGG + Intergenic
973462567 4:50671812-50671834 CTTTCTGCACTCCCTGGAAGTGG + Intergenic
973462641 4:50673003-50673025 CTTTCTGCACTCCCTGGAAGTGG + Intergenic
973463077 4:50680148-50680170 CTTTCTGCACTCCCTGGAAGTGG + Intergenic
973465688 4:50723002-50723024 CTTTCTGCACTCCCTGGAAGTGG + Intergenic
973467436 4:50751916-50751938 CTTTCTGCACTCCCTGGAAGTGG + Intergenic
973468512 4:50769734-50769756 CTTTCTGCACTCCCTGGAAGTGG + Intergenic
973469930 4:50793019-50793041 CTTTCTGCACTCCCTGGAAGTGG + Intergenic
973470815 4:50807817-50807839 CTTTCTGCACTCCCTGGAAGTGG + Intergenic
973471895 4:50825506-50825528 CTTTCTGCACTCCCTGGAAGTGG + Intergenic
973472755 4:50839793-50839815 CTTTCTGCACTCCCTGGAAGTGG + Intergenic
973472910 4:50842340-50842362 CTTTCTGCACTCCCTGGAAGTGG + Intergenic
973473116 4:50845570-50845592 GTTTCTGCACTACCTGGAAGAGG + Intergenic
973473340 4:50849310-50849332 CTTTCTGCACTCCCTGGAAGTGG + Intergenic
973473625 4:50853898-50853920 CTTTCTGCACTCCCTGGAAGTGG + Intergenic
973473877 4:50857974-50857996 CTTTCTGCACTCCCTGGAAGTGG + Intergenic
973473949 4:50859161-50859183 CTTTCTGCACTCCCTGGAAGTGG + Intergenic
973474804 4:50873262-50873284 CTTTCTGCACTCCCTGGAAGTGG + Intergenic
973475098 4:50878363-50878385 CTTTCTGCACTCCCTGGAAGTGG + Intergenic
973476411 4:50900135-50900157 CTTTCTGCACTCCCTGGAAGTGG + Intergenic
973476538 4:50902173-50902195 CTTTCTGCACTCCCTGGAAGTGG + Intergenic
973476878 4:50907951-50907973 CTTTCTGCACTCCCTGGAAGTGG + Intergenic
973477484 4:50918152-50918174 CTTTCTGCACTCCCTGGAAGTGG + Intergenic
973477532 4:50918999-50919021 CTTTCTGCACTCCCTGGAAGTGG + Intergenic
973477681 4:50921545-50921567 CTTTCTGCACTCCCTGGAAGTGG + Intergenic
973478041 4:50927324-50927346 CTTTCTGCACTCCCTGGAAGTGG + Intergenic
973478621 4:50936847-50936869 CTTTCTGCACTCCCTGGAAGTGG + Intergenic
973478770 4:50939396-50939418 CTTTCTGCACTCCCTGGAAGTGG + Intergenic
973480074 4:50960823-50960845 CTTTCTGCACTCCCTGGAAGTGG + Intergenic
973480731 4:50971704-50971726 CTTTCTGCACTCCCTGGAAGTGG + Intergenic
973481976 4:50992281-50992303 CTTTCTGCACTCCCTGGAAGTGG + Intergenic
973482055 4:50993638-50993660 CTTTCTGCACTCCCTGGAAGTGG + Intergenic
973482460 4:51000442-51000464 CTTTCTGCACTCCCTGGAAGTGG + Intergenic
973482811 4:51006224-51006246 CTTTCTGCACTCCCTGGAAGTGG + Intergenic
973483163 4:51012003-51012025 CTTTCTGCACTCCCTGGAAGTGG + Intergenic
973483580 4:51018976-51018998 CTTTCTGCACTCCCTGGAAGTGG + Intergenic
973483809 4:51022716-51022738 CTTTCTGCACTCCCTGGAAGTGG + Intergenic
973484009 4:51026116-51026138 CTTTCTGCACTCCCTGGAAGTGG + Intergenic
973484093 4:51027475-51027497 CTTTCTGCACTCCCTGGAAGTGG + Intergenic
973484241 4:51030023-51030045 CTTTCTGCACTCCCTGGAAGTGG + Intergenic
973484690 4:51037334-51037356 CTTTCTGCACTCCCTGGAAGTGG + Intergenic
973485234 4:51046351-51046373 CTTTCTGCACTCCCTGGAAGTGG + Intergenic
973488890 4:51106561-51106583 CTTTCTGCACTCCCTGGAAGTGG + Intergenic
973489242 4:51112692-51112714 CTTTCTGCACTCCCTGGAAGTGG + Intergenic
973489512 4:51117110-51117132 CTTTCTGCACTCCCTGGAAGTGG + Intergenic
973491168 4:51143980-51144002 CTTTCTGCACTCCCTGGAAGTGG + Intergenic
973491800 4:51154190-51154212 CTTTCTGCACTCCCTGGAAGTGG + Intergenic
973491926 4:51156228-51156250 CTTTCTGCACTCCCTGGAAGTGG + Intergenic
973492393 4:51164049-51164071 CTTTCTGCACTCCCTGGAAGTGG + Intergenic
973493827 4:51187868-51187890 CTTTCTGCACTCCCTGGAAGTGG + Intergenic
973494026 4:51191102-51191124 CTTTCTGCACTCCCTGGAAGTGG + Intergenic
973494221 4:51194329-51194351 CTTTCTGCACTCCCTGGAAGTGG + Intergenic
973495391 4:51213718-51213740 CTTTCTGCACTCCCTGGAAGTGG + Intergenic
973495461 4:51214905-51214927 CTTTCTGCACTCCCTGGAAGTGG + Intergenic
973496401 4:51230386-51230408 CTTTCTGCACTCCCTGGAAGTGG + Intergenic
973498295 4:51261350-51261372 CTTTCTGCACTCCCTGGAAGTGG + Intergenic
973498437 4:51263727-51263749 CTTTCTGCACTCCCTGGAAGTGG + Intergenic
973498736 4:51268831-51268853 CTTTCTGCACTCCCTGGAAGTGG + Intergenic
973498863 4:51270870-51270892 CTTTCTGCACTCCCTGGAAGTGG + Intergenic
973499330 4:51278689-51278711 CTTTCTGCACTCCCTGGAAGTGG + Intergenic
973500024 4:51290253-51290275 CTTTCTGCACTCCCTGGAAGTGG + Intergenic
973500371 4:51296023-51296045 CTTTCTGCACTCCCTGGAAGTGG + Intergenic
973500692 4:51301296-51301318 CTTTCTGCACTCCCTGGAAGTGG + Intergenic
973501359 4:51312178-51312200 CTTTCTGCACTCCCTGGAAGTGG + Intergenic
973504039 4:51356396-51356418 CTTTCTGCACTCCCTGGAAGTGG + Intergenic
973504626 4:51366085-51366107 CTTTCTGCACTCCCTGGAAGTGG + Intergenic
973505102 4:51373742-51373764 CTTTCTGCACTCCCTGGAAGTGG + Intergenic
973505527 4:51380715-51380737 CTTTCTGCACTCCCTGGAAGTGG + Intergenic
973506594 4:51398065-51398087 CTTTCTGCACTCCCTGGAAGTGG + Intergenic
973507484 4:51412865-51412887 CTTTCTGCACTCCCTGGAAGTGG + Intergenic
973508026 4:51422029-51422051 CTTTCTGCACTCCCTGGAAGTGG + Intergenic
973508787 4:51434283-51434305 CTTTCTGCACTCCCTGGAAGTGG + Intergenic
973509215 4:51441261-51441283 CTTTCTGCACTCCCTGGAAGTGG + Intergenic
973509406 4:51444500-51444522 CTTTCTGCACTCCCTGGAAGTGG + Intergenic
973509670 4:51448924-51448946 CTTTCTGCACTCCCTGGAAGTGG + Intergenic
973510018 4:51454702-51454724 GTTTCTGCACTACCTGGAAGTGG + Intergenic
973510832 4:51468140-51468162 CTTTCTGCACTCCCTGGAAGTGG + Intergenic
973511234 4:51474607-51474629 CTTTCTGCACTCCCTGGAAGTGG + Intergenic
973511313 4:51475963-51475985 CTTTCTGCACTCCCTGGAAGTGG + Intergenic
973511695 4:51482428-51482450 CTTTCTGCACTCCCTGGAAGTGG + Intergenic
973511840 4:51484979-51485001 CTTTCTGCACTCCCTGGAAGTGG + Intergenic
973512233 4:51491442-51491464 CTTTCTGCACTCCCTGGAAGTGG + Intergenic
973512432 4:51494678-51494700 CTTTCTCCACTCCCTGGAAGTGG + Intergenic
973512793 4:51500459-51500481 CTTTCTGCACTCCCTGGAAGTGG + Intergenic
973512919 4:51502496-51502518 CTTTCTGCACTCCCTGGAAGTGG + Intergenic
973513322 4:51508960-51508982 CTTTCTGCACTCCCTGGAAGTGG + Intergenic
973514042 4:51520696-51520718 CTTTCTGCACTCCCTGGAAGTGG + Intergenic
973514661 4:51530904-51530926 CTTTCTGCACTCCCTGGAAGTGG + Intergenic
973515203 4:51539924-51539946 CTTTCTGCACTCCCTGGAAGTGG + Intergenic
973515853 4:51550644-51550666 CTTTCTGCACTCCCTGGAAGTGG + Intergenic
973516390 4:51559489-51559511 CTTTCTGCACTCCCTGGAAGTGG + Intergenic
973517978 4:51585492-51585514 CTTTCTGCACTCCCTGGAAGTGG + Intergenic
973518301 4:51590773-51590795 ATTTCTGCACTCCCTGGAAGTGG + Intergenic
973518613 4:51595876-51595898 CTTTCTGCACTCCCTGGAAGTGG + Intergenic
973518808 4:51599106-51599128 CTTTCTGCACTCCCTGGAAGTGG + Intergenic
973518962 4:51601655-51601677 CTTTCTGCACTCCCTGGAAGTGG + Intergenic
973519234 4:51606079-51606101 CTTTCTGCACTCCCTGGAAGTGG + Intergenic
973519512 4:51610673-51610695 CTTTCTGCACTCCCTGGAAGTGG + Intergenic
973519838 4:51615949-51615971 CTTTCTGCACTCCCTGGAAGTGG + Intergenic
973519966 4:51617987-51618009 CTTTCTGCACTCCCTGGAAGTGG + Intergenic
973521025 4:51635502-51635524 CTTTCTGCACTCCCTGGAAGTGG + Intergenic
973521217 4:51638737-51638759 CTTTCTGCACTCCCTGGAAGTGG + Intergenic
973521559 4:51644361-51644383 CTTTCTGCACTCCCTGGAAGTGG + Intergenic
973522183 4:51654562-51654584 CTTTCTGCACTCCCTGGAAGTGG + Intergenic
973522454 4:51658985-51659007 CTTTCTGCACTCCCTGGAAGTGG + Intergenic
973522579 4:51661025-51661047 CTTTCTGCACTCCCTGGAAGTGG + Intergenic
973523071 4:51669027-51669049 CTTTCTGCACTCCCTGGAAGTGG + Intergenic
973524213 4:51687737-51687759 CTTTCTGCACTCCCTGGAAGTGG + Intergenic
973524333 4:51689775-51689797 CTTTCTGCACTCCCTGGAAGTGG + Intergenic
973524538 4:51693007-51693029 CTTTCTGCACTCCCTGGAAGTGG + Intergenic
973524983 4:51700312-51700334 CACTCTGCACTCCCTGGAAGTGG + Intergenic
973525203 4:51703885-51703907 CTTTCTGCACTCCCTGGAAGTGG + Intergenic
973525604 4:51710352-51710374 CTTTCTGCACTCCCTGGAAGTGG + Intergenic
973525682 4:51711707-51711729 CTTTCTGCACTCCCTGGAAGTGG + Intergenic
973526005 4:51716986-51717008 CTTTCTGCACTCCCTGGAAGTGG + Intergenic
973526479 4:51724642-51724664 CTTTCTGCACTCCCTGGAAGTGG + Intergenic
973527197 4:51736380-51736402 CTTTCTGCACTCCCTGGAAGTGG + Intergenic
976162091 4:82213279-82213301 GAATGTCCACACCATTGAAGAGG + Intergenic
978140430 4:105312286-105312308 GCTGCTGCACTCCTTTGAAGTGG + Intergenic
978652356 4:111021205-111021227 CATTCTCTCCTACCTTGAAGTGG - Intergenic
979580086 4:122347758-122347780 GATTCTTCAGTTCCTCGAAGAGG + Exonic
990217974 5:53555094-53555116 TGTTCTCCACTCCTTTGATGAGG - Intergenic
991132726 5:63143004-63143026 TATTCTCCACTTCCTTGAGTGGG + Intergenic
996880179 5:128288172-128288194 GATTGTCTATTCCCTTGAAATGG - Intronic
997729267 5:136154138-136154160 GACTCTCCACTCTCTTATAGTGG - Exonic
1000258581 5:159564234-159564256 GATTCTCTTCTCCCTGGAATGGG + Intergenic
1000859280 5:166437023-166437045 ACTTCTCAACTCCCTGGAAGTGG - Intergenic
1000913948 5:167057556-167057578 GTTTCCCCACTCCCTTTATGTGG + Intergenic
1001131381 5:169066653-169066675 CATTCTCCACTCCCTTTGACCGG + Intronic
1003358494 6:5399015-5399037 TCTTCTCCACTCTCTTTAAGTGG + Intronic
1005776488 6:29137972-29137994 GAGTCACCACTCCATAGAAGAGG + Intergenic
1011036736 6:82985291-82985313 AATTCTCCATTACCTTGGAGTGG - Intronic
1012420822 6:99063454-99063476 GCGTCTCCACTGCCTGGAAGGGG + Intergenic
1013826020 6:114212797-114212819 CTTTCTCGAGTCCCTTGAAGGGG - Intronic
1024483134 7:49885939-49885961 GAGTCTCCCCTCCCTGCAAGGGG + Intronic
1025061342 7:55811255-55811277 GTTTATCCACCTCCTTGAAGAGG + Intronic
1028430204 7:90737499-90737521 AATTTTCCACTCCCCAGAAGAGG - Intronic
1032878932 7:136067904-136067926 GAATCTCCCCTCCCTTTAATTGG + Intergenic
1035048813 7:155986482-155986504 TATTCTCCACTCCAATGAATTGG + Intergenic
1037506891 8:19539769-19539791 GATTCTCCACCCCCTTCCAGAGG + Intronic
1047865285 8:129016982-129017004 TATTCTCCACTTCATTGATGCGG - Intergenic
1049991095 9:992621-992643 GATGCTCCCCACCCTTGAATGGG + Intergenic
1051494729 9:17707190-17707212 GATTCTCCATTTCCTTGTTGTGG + Intronic
1052278448 9:26705332-26705354 GTTTCTCCACACCTTTGAATAGG - Intergenic
1053959192 9:43526897-43526919 GTTTCTGCACTACCTGGAAGTGG + Intergenic
1053961946 9:43575222-43575244 CTTTCTGCACTACCTTGAAGTGG + Intergenic
1053970811 9:43728544-43728566 GTTTCTGCACTACCTGGAAGTGG + Intergenic
1053995901 9:44162489-44162511 GTTTCTCCACTACCTGGAAGTGG + Intergenic
1053999816 9:44231257-44231279 CTTTCTCCACTACCTGGAAGTGG + Intergenic
1054001343 9:44258490-44258512 GTTTCTGCACTACCTGGAAGTGG + Intergenic
1054009606 9:44402801-44402823 ATTTCTGCACTACCTTGAAGTGG + Intergenic
1054011693 9:44438516-44438538 CTTTCTGCACTACCTTGAAGTGG + Intergenic
1054015224 9:44499930-44499952 CTTTCTCCACTACCTGGAAGTGG + Intergenic
1054016004 9:44513205-44513227 GTTTCTGCACTACCTGGAAGTGG + Intergenic
1054028297 9:44723790-44723812 CTTTCTGCACTACCTTGAAGTGG + Intergenic
1054029351 9:44741992-44742014 GTTTCTGCACTACCTGGAAGTGG + Intergenic
1054030179 9:44756624-44756646 GTTTCTGCACTACCTGGAAGTGG + Intergenic
1054040532 9:44933585-44933607 GTTTCTGCACTACCTGGAAGTGG + Intergenic
1054043038 9:44976104-44976126 CTTTCTCCACTACCTGGAAGTGG + Intergenic
1054047242 9:45047547-45047569 GTTTCTGCACTACCTGGAAGTGG + Intergenic
1054051366 9:45116608-45116630 GTTTCTGCACTACCTGGAAGTGG + Intergenic
1057642010 9:96833735-96833757 TATGCTCCACTTCCTTGAAGAGG + Intronic
1059440568 9:114304544-114304566 GGTTCTCCACACCCATCAAGTGG - Intronic
1059518470 9:114917685-114917707 GCTTCTCCAATACCTTGATGAGG + Intronic
1062208951 9:135352919-135352941 ATTTCTCCATTCTCTTGAAGTGG - Intergenic
1185538596 X:883975-883997 GATTCTCCAGTGTCTTGGAGGGG - Intergenic
1187260666 X:17682549-17682571 TTTTCTTCCCTCCCTTGAAGGGG + Intronic
1187273805 X:17801527-17801549 GGTCCTCCGCTCCCTGGAAGAGG + Exonic
1191166361 X:57396395-57396417 GTTTTTCTACTTCCTTGAAGTGG + Intronic
1191953389 X:66618289-66618311 GATTCTGGACTCTTTTGAAGAGG + Intronic
1198381054 X:136083955-136083977 GATTCTCCAGTCCATTTATGGGG - Intergenic