ID: 1156363147

View in Genome Browser
Species Human (GRCh38)
Location 18:36401770-36401792
Sequence TGTGAGGGATAGAACATGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 167}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156363147_1156363156 27 Left 1156363147 18:36401770-36401792 CCCCTCATGTTCTATCCCTCACA 0: 1
1: 0
2: 0
3: 17
4: 167
Right 1156363156 18:36401820-36401842 TACTGGCTAAGCAGACCTGAAGG 0: 1
1: 0
2: 2
3: 12
4: 108
1156363147_1156363154 10 Left 1156363147 18:36401770-36401792 CCCCTCATGTTCTATCCCTCACA 0: 1
1: 0
2: 0
3: 17
4: 167
Right 1156363154 18:36401803-36401825 CACAGAGTGGCCGTCATTACTGG 0: 1
1: 0
2: 0
3: 3
4: 90
1156363147_1156363153 -3 Left 1156363147 18:36401770-36401792 CCCCTCATGTTCTATCCCTCACA 0: 1
1: 0
2: 0
3: 17
4: 167
Right 1156363153 18:36401790-36401812 ACACGGTATGTAGCACAGAGTGG 0: 1
1: 0
2: 0
3: 4
4: 107

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156363147 Original CRISPR TGTGAGGGATAGAACATGAG GGG (reversed) Intronic
900681771 1:3920413-3920435 TGAGAGGGAGAGAAAAAGAGAGG - Intergenic
900864213 1:5255721-5255743 GGTGGGGGATGGCACATGAGTGG + Intergenic
902225117 1:14991853-14991875 GGAGAGAGACAGAACATGAGAGG + Intronic
902784909 1:18726682-18726704 TGTGAGGGAGAGACCCTGGGAGG - Intronic
903008327 1:20312959-20312981 TGTTGGGGATCGAACATGGGAGG - Exonic
905996433 1:42385251-42385273 TGTGTGGGGGAGATCATGAGGGG + Intronic
906588269 1:47000192-47000214 GGTGAGGGACAGAGCATGAAAGG - Intergenic
907359067 1:53900274-53900296 TGGGAGGTGTAGAACAGGAGGGG - Intronic
908418884 1:63939953-63939975 TGTGAAGGAAGAAACATGAGTGG + Intronic
908489108 1:64625155-64625177 AGTGAGGGATAGGGGATGAGTGG + Intronic
908497322 1:64707647-64707669 TGTGGGGGAGAGAACATGTTTGG + Intergenic
909474691 1:76069727-76069749 TGTGAGGGCTAGACCATTAGAGG + Intergenic
909742535 1:79048737-79048759 TGTTAGGGAAAAAACATTAGTGG + Intergenic
910350795 1:86295234-86295256 AGTGAGGGTTGGTACATGAGTGG - Intergenic
910446490 1:87303351-87303373 TCTGAGGGAGGGAAAATGAGGGG + Intergenic
911439980 1:97913829-97913851 GGTGAGGAATAAAACATGGGGGG + Intronic
911674879 1:100647567-100647589 TGTCAGTGGTAGAACATGGGTGG - Intergenic
918805102 1:189030802-189030824 TGGGAGGCAGAGATCATGAGTGG - Intergenic
919636431 1:200007750-200007772 GGAGAGGGATAGAAAATGAGAGG + Intergenic
923467856 1:234265222-234265244 TGAGAGGAATAGAACATGAAGGG - Intronic
924374074 1:243387630-243387652 TATGATGGATAGATCATGTGGGG + Intronic
924636909 1:245797114-245797136 TGTGAGATACAGAATATGAGGGG + Intronic
1067008570 10:42689579-42689601 TGGGAGGGAAATAACATGAAGGG + Intergenic
1067856621 10:49799198-49799220 TGAAAGGGAAAGAACAAGAGAGG - Intergenic
1069224951 10:65931528-65931550 TGTGAGGCATAGAATATGTCAGG + Intronic
1070665061 10:78336887-78336909 TGTCAAGGCTAGCACATGAGGGG - Intergenic
1071036656 10:81255678-81255700 TGTGAGAGAGAAAGCATGAGTGG + Intergenic
1071471849 10:85989015-85989037 TGTGAGGGAAGAAACAGGAGAGG + Intronic
1071566220 10:86672747-86672769 TGTGAGGGATCCAAAAGGAGAGG + Intronic
1075801215 10:125154724-125154746 GGTGAGGGTTAGAAAGTGAGGGG + Intronic
1077357357 11:2124610-2124632 TCACAGGGATAAAACATGAGTGG - Intergenic
1077647691 11:3940385-3940407 TGTGGGGAATAGATCATAAGGGG + Intronic
1080054065 11:27887071-27887093 TGTGAGGCAGAGAACAAGTGAGG + Intergenic
1080448158 11:32356219-32356241 TGTGTGGGTTAGAATATAAGGGG + Intergenic
1081158622 11:39726438-39726460 TGTGGGAGAGAGAAGATGAGTGG - Intergenic
1081765303 11:45606284-45606306 TGCCAGGGAAAGAACTTGAGAGG - Intergenic
1083727013 11:64633966-64633988 TGTGAAGGAAGGAGCATGAGGGG - Intronic
1085042491 11:73334778-73334800 AGGGAGGGAGAGAACAAGAGGGG + Intronic
1086686539 11:89740127-89740149 TGTAAGGGAAAGAACCTGACAGG + Intergenic
1086885545 11:92201113-92201135 GGTGGGGGATAGAGTATGAGTGG + Intergenic
1086940874 11:92797142-92797164 AGAGAGGGGTAGAGCATGAGTGG + Intronic
1089118955 11:116118400-116118422 TGTGAGGGTCACAACAAGAGAGG + Intergenic
1090090234 11:123690296-123690318 TGAGAGGGAGACCACATGAGAGG - Intergenic
1090354437 11:126130355-126130377 AGGGAGTGACAGAACATGAGTGG + Intergenic
1093841500 12:23908001-23908023 TGGGAGGGAGAGAGCAAGAGTGG - Intronic
1095328958 12:40933821-40933843 TGTGAGGCTGAGAACATTAGAGG + Exonic
1095602276 12:44027596-44027618 TATGAGGAATACTACATGAGAGG + Intronic
1096802112 12:54117535-54117557 TGTGTGGGAGGGACCATGAGAGG - Intergenic
1097747505 12:63316781-63316803 TGTGAGGGAGAGAACAAAAAAGG + Intergenic
1098007358 12:66011868-66011890 TGACAGGGCTAGAACATGTGGGG + Intergenic
1101437018 12:104672567-104672589 TTTCAGGAATAGAACATGTGAGG + Intronic
1103432713 12:120902932-120902954 TTTGGGGGAAGGAACATGAGGGG - Intronic
1104350378 12:128040098-128040120 TGTGAGGGATATAAGAAGAAGGG - Intergenic
1106296707 13:28420826-28420848 TGTTAGGGATAGATCATTTGGGG - Intronic
1106722221 13:32447075-32447097 TGTGAGGGTTTGAAAATGAGAGG - Intronic
1106728107 13:32507111-32507133 TTTGATGGATTGAATATGAGGGG + Intronic
1108733059 13:53255209-53255231 TCCTAGGGATAGAACATAAGAGG - Intergenic
1110738546 13:78966938-78966960 TATGAGCAAGAGAACATGAGGGG + Intergenic
1112450075 13:99500108-99500130 TTTGAGGGAGAGGACATGAAAGG + Intergenic
1113224106 13:108140454-108140476 AGAGAGGGAGAGAACAGGAGAGG - Intergenic
1113300388 13:109012686-109012708 TGTGGGGGATGGAAGATTAGAGG + Intronic
1115233773 14:31188829-31188851 TGTGAGGGATTGGGCATGTGTGG - Intronic
1117337201 14:54765758-54765780 TGGAAGGGTGAGAACATGAGAGG - Intronic
1117456920 14:55907176-55907198 TGAGAGAGATACAACATGAGAGG - Intergenic
1125402797 15:39322020-39322042 TTAGAGGGATAGATCATTAGAGG - Intergenic
1126126133 15:45296176-45296198 GGTGAGGGAGGGAACAAGAGAGG + Intergenic
1127351533 15:58157677-58157699 TGTGTGAGAGAGAACAAGAGAGG + Intronic
1128983173 15:72200812-72200834 TGTGGGGGATATAGGATGAGGGG - Intronic
1129360715 15:75022171-75022193 TGTGAAGGCTAGAAAATGAAGGG + Intergenic
1134340108 16:13337081-13337103 TGGGAGGGATAGTTCATTAGTGG + Intergenic
1135238890 16:20785194-20785216 TTTGAGGGATAGGAGTTGAGTGG + Intronic
1139316149 16:66070756-66070778 AGTGAGGGAGAGAGCAAGAGAGG + Intergenic
1146305553 17:31727346-31727368 TGGGATGGGGAGAACATGAGTGG - Intergenic
1146473614 17:33144313-33144335 AGAGAGGGAAAGAACAAGAGTGG + Intronic
1147792958 17:43024947-43024969 TCTTAGGGGTAGAATATGAGCGG - Intronic
1148150296 17:45393086-45393108 TGTAAGGGACAGAGCATGTGGGG - Intergenic
1150302876 17:64060710-64060732 TGTGAGTTAGAGAAAATGAGTGG + Intronic
1151618603 17:75231239-75231261 TTTGAGGGACAGGACATGTGGGG + Intronic
1153364012 18:4233219-4233241 GGCCAGGGATAGAACATAAGTGG - Intronic
1155182450 18:23359622-23359644 TTTGAGGGCGAGAACATGAGAGG - Intronic
1156363147 18:36401770-36401792 TGTGAGGGATAGAACATGAGGGG - Intronic
1158351414 18:56568148-56568170 TGTGAGAGAGAGAAATTGAGAGG + Intergenic
1160902288 19:1434548-1434570 TTTGAGGGAGAGAACATGCCCGG + Intronic
1163725662 19:18921821-18921843 TCTGGGGGACAGAGCATGAGAGG - Exonic
1166259445 19:41627461-41627483 TCTGTGGGATAGAAAATGGGGGG + Intronic
1166321036 19:42019030-42019052 GATGAGGGAGGGAACATGAGTGG + Intronic
1166348159 19:42179502-42179524 TGAGAGGGAGGGAACAGGAGGGG + Intronic
925600905 2:5607921-5607943 TGTGAAGGAGAGAACCTGAGTGG + Intergenic
929090269 2:38209783-38209805 TGTCAGGAATAGATAATGAGTGG + Intergenic
929123380 2:38501576-38501598 TGAGAGGGATAGTCCAGGAGTGG + Intergenic
929167717 2:38900395-38900417 TTTGAGGGATAGAAGATGGGAGG + Intronic
931239822 2:60442206-60442228 AGTGAGGTATAGACCTTGAGTGG - Intergenic
931494372 2:62786180-62786202 TGGTTGGGGTAGAACATGAGGGG + Intronic
932772002 2:74505674-74505696 TGTGAGGGAAGGACCATGGGAGG + Intronic
932894200 2:75622923-75622945 TTTGGGGGATATAAGATGAGAGG - Intergenic
934581171 2:95440665-95440687 TGTAAGGGAAAGAACCTGAGAGG + Intergenic
934598279 2:95636049-95636071 TGTAAGGGAAAGAACCTGAGAGG - Intergenic
935186181 2:100735196-100735218 TGTGAGGTTTATAACATAAGTGG + Intergenic
942303545 2:174585297-174585319 TGTGATGGATAGTACAAGGGTGG - Intronic
942914019 2:181280618-181280640 TGTGAGGCATAGATCAAAAGAGG + Intergenic
943661431 2:190563334-190563356 CGTGAAGGAGAGAAGATGAGTGG - Intergenic
946162389 2:217843527-217843549 TGTGGGGGATTGAGGATGAGTGG - Intronic
948813724 2:240499317-240499339 TGTGAGGGTGGGAACATGAGGGG + Intronic
1169275186 20:4228955-4228977 TGGGAGGGGTGGAACATGTGGGG - Intronic
1171794599 20:29556928-29556950 TGTGTGGGAGGGACCATGAGAGG + Intergenic
1175548593 20:59800132-59800154 TATGAGGTTTATAACATGAGTGG - Intronic
1177125263 21:17185895-17185917 GGGGTGGGACAGAACATGAGTGG - Intergenic
1178727145 21:35063827-35063849 TGTGTGGGATTAAACACGAGTGG - Intronic
1179190744 21:39119761-39119783 GGTGAGGCAGAGAACAAGAGGGG + Intergenic
1181911923 22:26245135-26245157 GGTGAGGGATGGAGCATCAGGGG + Intronic
1182458188 22:30465908-30465930 TGTGAGGGCTACAACAAAAGTGG + Intronic
1182783488 22:32886897-32886919 TGTAAGGGCTTGAACATGAGAGG - Intronic
1183348487 22:37320786-37320808 TGAGAGGGATGGAAAAGGAGAGG - Intergenic
1183381800 22:37493954-37493976 TGTGAGGGTTCCAACAGGAGTGG - Intronic
1184193412 22:42910171-42910193 TGTGAGGGATAGGCCAGGAGAGG - Intronic
952775487 3:37041984-37042006 AGGTAGGGACAGAACATGAGTGG + Intronic
955010564 3:55010534-55010556 TCTGAGAAATAGCACATGAGTGG - Intronic
955636169 3:61032028-61032050 TTTGAGCTATAGAACATAAGAGG + Intronic
958463725 3:94432023-94432045 TGTGAGAAGTGGAACATGAGAGG - Intergenic
959710124 3:109377442-109377464 TGTGAAGGCTAGAACAGAAGTGG + Intergenic
961507024 3:127376815-127376837 TGAGAGGCATGGAACAAGAGAGG + Intergenic
967467438 3:189823979-189824001 TGTGAGAGAGAGAGCATGAAAGG - Intronic
970003232 4:11385480-11385502 TGGGAGTGAGAGAACATGAGGGG - Intergenic
970229134 4:13891102-13891124 AGTGGGGGGTAGAACAAGAGGGG - Intergenic
971686460 4:29775770-29775792 TTTGAGGCATAGAAGGTGAGTGG - Intergenic
971780990 4:31034215-31034237 AGTAAGGGATAGAAGATGAAAGG - Intronic
973748486 4:53987763-53987785 TGTGAGGAGCAGAAGATGAGAGG - Intronic
976008597 4:80460074-80460096 TGTGAGAGAGAGAAGAAGAGAGG + Intronic
978750823 4:112245372-112245394 TGTGATGGATTGAACATGGAGGG + Intronic
979847512 4:125534721-125534743 TGTGATGGATTAAACAGGAGCGG - Intergenic
983951374 4:173646567-173646589 TGAGAGGGATGCAACGTGAGAGG + Intergenic
986258213 5:6119672-6119694 TGTGAGGGATTGAGCCTGTGAGG - Intergenic
993072072 5:83177773-83177795 TGTGAGAGATAAAGCTTGAGAGG + Intronic
993571488 5:89545298-89545320 TGTGGGGGATAGAGCTAGAGTGG - Intergenic
994557189 5:101318974-101318996 TATGATGGAAAGAAAATGAGAGG - Intergenic
1001299126 5:170521153-170521175 TGGGAGGGATAGCACATGCCAGG - Intronic
1003624513 6:7728933-7728955 TTTGAGGGAGAGAACATGGGGGG + Intronic
1004552382 6:16661465-16661487 TGTCAGGAATAGACCATAAGGGG + Intronic
1005847068 6:29790241-29790263 TGAGAGGGATTCAGCATGAGGGG + Intergenic
1005863902 6:29923977-29923999 TGAGAGGGATTCAGCATGAGGGG + Intergenic
1005874987 6:30004198-30004220 TGAGAGGGATTCAGCATGAGGGG + Intergenic
1006285323 6:33088929-33088951 TGTGAGGGGTAGAAAATGAAGGG - Intergenic
1006290423 6:33131175-33131197 TGTGAGGGGCAGAAAATGAAGGG - Intergenic
1009341636 6:62561926-62561948 GGTGGGGGAAAGCACATGAGAGG - Intergenic
1010104496 6:72150793-72150815 TTTGAGGAAAAGAGCATGAGGGG - Intronic
1011027076 6:82880933-82880955 TGTGAGGGAAAGAAGACAAGAGG + Intergenic
1013051434 6:106539300-106539322 TGAGAGGAAAAGAACAGGAGAGG - Intronic
1014776271 6:125513268-125513290 TGTAAGGGAGAGAACACTAGTGG - Intergenic
1020354966 7:7265950-7265972 TGTTAGGGACACAACATCAGCGG - Intergenic
1020798839 7:12708714-12708736 TGTGAGGGAGAGAAAAAGAGAGG - Intergenic
1024343745 7:48292230-48292252 TCTGAGGGAAAGAACACCAGGGG - Intronic
1024985689 7:55191675-55191697 TGTGAGGGACAGATCATCATGGG - Intronic
1025248103 7:57332872-57332894 TGTGATGGCCAGAACCTGAGTGG - Intergenic
1026228446 7:68462899-68462921 GGGGAGGGAAAGAACAGGAGGGG - Intergenic
1028421051 7:90633213-90633235 TTTGATTCATAGAACATGAGAGG + Intronic
1036272301 8:7317717-7317739 TGGGAGGTATAGAAGGTGAGAGG + Intergenic
1036349047 8:7992625-7992647 TGGGAGGTATAGAAGGTGAGAGG - Intergenic
1039968807 8:42304528-42304550 TGTGAGGGACATAAAATAAGGGG - Intronic
1041623455 8:59999534-59999556 TGTCAGCCAAAGAACATGAGTGG - Intergenic
1044919712 8:97155908-97155930 TGTGGGAGTTAGAACAAGAGAGG + Intergenic
1044922268 8:97179140-97179162 TATGATGGAAAGAAAATGAGAGG - Intergenic
1046278897 8:111998805-111998827 TGTGAGGGTGAGAACACTAGAGG + Intergenic
1046398822 8:113676643-113676665 TGTGAAGGGTAGAACACGGGAGG + Intergenic
1047087566 8:121535717-121535739 TGTCAGGGACTGAAAATGAGAGG - Intergenic
1047644267 8:126853127-126853149 TCTGAGGGATAGAATTGGAGAGG - Intergenic
1047778349 8:128091953-128091975 TGTGAGGGTGGGAATATGAGAGG + Intergenic
1049384290 8:142333468-142333490 TGTGAGGGCTAGAAGATGCTAGG + Intronic
1051182307 9:14424227-14424249 TGTAAGGGAGAAAAGATGAGTGG - Intergenic
1051705273 9:19872511-19872533 AGTGAAGGACAGAAAATGAGAGG - Intergenic
1052228136 9:26114625-26114647 TATGAGTTATAGAATATGAGAGG + Intronic
1054740593 9:68802417-68802439 TGTGATGGATAGAAAATGGATGG + Intronic
1056053703 9:82798235-82798257 TGTGAGTGAGAGAGAATGAGAGG - Intergenic
1057314288 9:93958774-93958796 TCTGAGGGGCAGAACATGGGTGG - Intergenic
1057811496 9:98260384-98260406 TGTTAGGGATAAGTCATGAGTGG + Intergenic
1059023284 9:110598882-110598904 TGTTAGCCTTAGAACATGAGCGG + Intergenic
1061314903 9:129788997-129789019 TGACAGGGAGAGAACGTGAGGGG + Intergenic
1061523176 9:131134323-131134345 TGTTAGGGATAGATGATGACTGG + Intronic
1187281923 X:17864003-17864025 TGTGAGGAATAGTAGAGGAGGGG + Intergenic
1187622477 X:21073272-21073294 TGTCAGAGTCAGAACATGAGGGG + Intergenic
1189520673 X:41763964-41763986 AGTGAGTGAAAGAACATTAGAGG - Intronic
1189868157 X:45352863-45352885 GGTGAGGGAGAGAGGATGAGGGG + Intergenic
1194697946 X:97079049-97079071 AGTGAGGGAGAGAAAGTGAGAGG - Intronic
1194733388 X:97482581-97482603 TGTGAGGGACAGAGATTGAGAGG + Intronic
1197700151 X:129593618-129593640 TGTTAGGGAGAGAACCTTAGTGG + Intergenic
1201327986 Y:12786308-12786330 TGTTAGGTATAGAACTTGGGAGG - Exonic