ID: 1156364469

View in Genome Browser
Species Human (GRCh38)
Location 18:36413087-36413109
Sequence GCACCCTGGTTTTCAGCAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 141}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156364464_1156364469 8 Left 1156364464 18:36413056-36413078 CCTTTCCCAGAAACACAGTTGTG 0: 1
1: 0
2: 1
3: 20
4: 249
Right 1156364469 18:36413087-36413109 GCACCCTGGTTTTCAGCAAAAGG 0: 1
1: 0
2: 1
3: 12
4: 141
1156364463_1156364469 26 Left 1156364463 18:36413038-36413060 CCAGAGCAGAGAACTGCACCTTT 0: 1
1: 0
2: 1
3: 7
4: 158
Right 1156364469 18:36413087-36413109 GCACCCTGGTTTTCAGCAAAAGG 0: 1
1: 0
2: 1
3: 12
4: 141
1156364466_1156364469 2 Left 1156364466 18:36413062-36413084 CCAGAAACACAGTTGTGTCATTT 0: 1
1: 0
2: 0
3: 18
4: 263
Right 1156364469 18:36413087-36413109 GCACCCTGGTTTTCAGCAAAAGG 0: 1
1: 0
2: 1
3: 12
4: 141
1156364465_1156364469 3 Left 1156364465 18:36413061-36413083 CCCAGAAACACAGTTGTGTCATT 0: 1
1: 0
2: 1
3: 26
4: 247
Right 1156364469 18:36413087-36413109 GCACCCTGGTTTTCAGCAAAAGG 0: 1
1: 0
2: 1
3: 12
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156364469 Original CRISPR GCACCCTGGTTTTCAGCAAA AGG Intronic
900926213 1:5707811-5707833 GCTGCCTGGTACTCAGCAAATGG + Intergenic
903754114 1:25648700-25648722 TGGCCCTGGCTTTCAGCAAATGG + Intronic
904361153 1:29972779-29972801 GCACTAGGGTTTCCAGCAAAAGG + Intergenic
905330209 1:37189443-37189465 GCACTCTGTTTGTCAGCTAAGGG + Intergenic
905362235 1:37429212-37429234 GCACCCTGGGTTTCAAGAATTGG + Intergenic
909427175 1:75538974-75538996 GCACCATGGTTTTAAGCATCAGG + Intronic
909486423 1:76179274-76179296 GCAAGCTTCTTTTCAGCAAATGG + Intronic
910441333 1:87255449-87255471 GCACCCTTATTTTCAGCCAAAGG + Intergenic
912119982 1:106459134-106459156 GCACCATGCTTTTCAGAAAGAGG + Intergenic
912323800 1:108738939-108738961 ACACCCTGGTCTTCAGTGAAAGG + Intronic
913066727 1:115262706-115262728 GCACCCTGTTTTCCAGCCACAGG + Intergenic
914863206 1:151403718-151403740 GCACGCTGGATTTCAACAAGTGG + Exonic
914863413 1:151405501-151405523 CCACCCTGGTTTTCTACAGAGGG - Exonic
915611799 1:156999675-156999697 GTTTCCTGGTTTTCAACAAAGGG + Intronic
916488015 1:165276532-165276554 TCACCCTGGTTTGGAGCATATGG - Intronic
918263838 1:182821726-182821748 CCACCCAGTTTTTCAGCATAAGG + Intronic
920510551 1:206548596-206548618 TCACACTGGTTTTGAGCAATTGG + Intronic
921564764 1:216703504-216703526 GTAGCCTGATTTTCAGGAAAAGG + Intronic
922042733 1:221912734-221912756 ACACCATAGTTTTCAGCACAGGG + Intergenic
924093826 1:240530064-240530086 GCACCCGGTTTTTCAAGAAAAGG + Intronic
924740550 1:246792086-246792108 GCACCCTAGATTTCAGCCAGAGG + Intergenic
1065697148 10:28390299-28390321 GAACACTGGATTTGAGCAAAAGG + Intergenic
1068695613 10:59965290-59965312 ACACCCTGCTATCCAGCAAAGGG - Intergenic
1069950099 10:72012707-72012729 GAGCCCTGGATTTCAGCAGATGG - Exonic
1070627860 10:78063873-78063895 GCAGGATGGTTTTCAGGAAAAGG + Intergenic
1074091409 10:110261719-110261741 GCATCCATATTTTCAGCAAAGGG - Intronic
1075566763 10:123510668-123510690 GCTCCCAGCTTTGCAGCAAAAGG + Intergenic
1081879757 11:46438595-46438617 GCCCCCTGGATTTCAGAATAAGG + Intronic
1083543279 11:63529901-63529923 GGAGCCAGGTTTTCAGCAATTGG + Intergenic
1083722572 11:64610735-64610757 GCACCCTGGTCTCCAGGTAAGGG + Intronic
1084862217 11:72026763-72026785 GCAGCCTAGTTCTCAGCAGAAGG - Intronic
1091951309 12:4595492-4595514 GCTCCCTAGTTTCCAGCATAGGG + Intronic
1094329799 12:29278866-29278888 GCACTCAGGAATTCAGCAAATGG + Intronic
1101466099 12:104950768-104950790 GCACCCTGGTTTCCACCCACTGG + Intronic
1106735133 13:32581571-32581593 GCAGCCTGTTTTTGAGCATAGGG - Intergenic
1107029856 13:35839432-35839454 GGACCCCGATTTTGAGCAAAAGG - Intronic
1112140055 13:96631165-96631187 GCACCTTGGTTTCAAGCACAGGG + Intronic
1116334423 14:43639304-43639326 GCACCCTGGGTTCTTGCAAAGGG - Intergenic
1117531023 14:56660996-56661018 GCACTCTGGTTTGCAGCTGAAGG + Intronic
1118387030 14:65264569-65264591 TCACCCTGGGTTTCAGTCAAGGG + Intergenic
1125394334 15:39230717-39230739 GCATCCTGGAGTTCAGCCAAGGG + Intergenic
1127567445 15:60205677-60205699 ACACAGTGGTTTTCAGAAAACGG - Intergenic
1129595661 15:76962192-76962214 GCACCCTGGAGTTGTGCAAATGG + Intergenic
1130130163 15:81134306-81134328 GCTCCCTGCTGTTCAGCAAGTGG - Exonic
1131230429 15:90654981-90655003 GCATGCTGGCTTTCAGGAAAGGG - Intergenic
1132199887 15:99944087-99944109 GCACCCTGCATTCCAGCAAATGG - Intergenic
1133639357 16:7701916-7701938 GCACCCTGGTTTGCTGCAACAGG - Intronic
1134833654 16:17344030-17344052 GGACCGTGGTTTTCAGCTCAGGG + Intronic
1136470880 16:30479192-30479214 GCGCCCTGGTTTTCAGGGTAAGG + Exonic
1136508691 16:30722730-30722752 TCACCCTGGTTAGCAGCAAGCGG - Exonic
1138473933 16:57259495-57259517 GGTCCCTGGTTGTCAGCAGAGGG - Intronic
1138751276 16:59424670-59424692 GCACCCTGTTTGACAGCAATTGG - Intergenic
1141785083 16:86194067-86194089 GCAGCCTGGTCTTCAGCGATGGG + Intergenic
1142219806 16:88848597-88848619 GCATCCTGGTTTTCTGCAGATGG + Intronic
1142434918 16:90050174-90050196 TGACCCTGGTTTTCAGAAAGGGG - Intergenic
1144009618 17:11134241-11134263 GCACCCTGGCTTTCATCAATTGG - Intergenic
1144397613 17:14860388-14860410 GCAGCCTGGTTTTCAGACATTGG + Intergenic
1145718950 17:27050142-27050164 GCTCCCTGCTTTTCACCAGACGG + Intergenic
1145779168 17:27550713-27550735 GCAAGCTGGTTCTCAGCATAGGG + Intronic
1147506818 17:41026619-41026641 GCAAACTGGCTTTCAGCAAGTGG + Exonic
1147616673 17:41833021-41833043 GCTCCCTGGACTTCACCAAATGG - Intronic
1149232773 17:54554629-54554651 GCACCCTGCCTCTCAGGAAAGGG - Intergenic
1149707771 17:58711058-58711080 GCACTATGCTTTTCAGCATATGG - Intronic
1150975165 17:70077750-70077772 TTACCATGGTTTCCAGCAAAGGG - Intronic
1153213381 18:2792807-2792829 GCACTCTGGCTTTCAGGGAAAGG + Intronic
1156364469 18:36413087-36413109 GCACCCTGGTTTTCAGCAAAAGG + Intronic
1158196250 18:54888152-54888174 GCACACTGCTGTTCAGCAAATGG + Intronic
1158404807 18:57151619-57151641 GCACCCTGGTTTCCTGCATGGGG - Intergenic
1158617504 18:59001677-59001699 GCACCCTTCCTTTCAGCCAAGGG - Intergenic
1159037573 18:63292583-63292605 CCACCCAGGTGCTCAGCAAATGG + Intronic
1162087302 19:8256519-8256541 GTATCCTGGTTTTGAGCAAACGG + Intronic
1163321766 19:16578673-16578695 GCATCCTGGGTTTCAGCAGGTGG - Intronic
1166740121 19:45109502-45109524 TCAGCCTGGTGCTCAGCAAATGG - Intronic
925653261 2:6115493-6115515 ACACACTATTTTTCAGCAAAAGG + Intergenic
926087441 2:10029073-10029095 CCTCCCTGGGTTCCAGCAAATGG - Intergenic
938275483 2:130017336-130017358 GCACTCAGGAATTCAGCAAATGG - Intergenic
938326433 2:130408070-130408092 GCACTCAGGAATTCAGCAAATGG - Intergenic
938363505 2:130713389-130713411 GCACTCAGGAATTCAGCAAATGG + Intergenic
938439881 2:131319959-131319981 GCACTCAGGAATTCAGCAAATGG + Intronic
939888774 2:147710767-147710789 ACACCCTGGTTATCAGCACTCGG + Intergenic
942673136 2:178398490-178398512 GCACCCTGGGTGACAGCATATGG - Intronic
942706660 2:178781033-178781055 GCAACAGGTTTTTCAGCAAACGG + Intronic
943099084 2:183466120-183466142 GCACCCTTGTTTACTGCATAAGG - Intergenic
948740709 2:240044013-240044035 GGAGCCTGGTGTTCACCAAAGGG - Intergenic
1168792731 20:590775-590797 GCATGCTGGTGTTCAGTAAATGG - Intergenic
1171363495 20:24607436-24607458 GCACCCTGGTTCTGGCCAAAGGG + Intronic
1172750654 20:37248652-37248674 ACACCCTGTCTATCAGCAAATGG + Intergenic
1173096649 20:40037584-40037606 GCTCAATGGGTTTCAGCAAATGG - Intergenic
1177374560 21:20252839-20252861 GTACTCTGGTTTTCAGAATATGG - Intergenic
1177973613 21:27820554-27820576 GAAGCCTGGTTTGCATCAAAAGG + Intergenic
1178464379 21:32833356-32833378 GCACCCTGGCAGTCAGGAAATGG - Intergenic
1179939249 21:44627599-44627621 GCACACAGGTTTGCAGCAGACGG - Exonic
1180168175 21:46040734-46040756 GCTCCCTTGTTCTCAGCAGAGGG + Intergenic
1184212933 22:43047249-43047271 GCAGTGTGGGTTTCAGCAAAAGG + Intronic
1185151140 22:49164555-49164577 GCACTGTGGCTTTCAGCTAACGG + Intergenic
950839527 3:15953794-15953816 GTACCCTGTTTTTCTGCAATAGG + Intergenic
951077583 3:18415022-18415044 GCTCCCTGGTTTAAAGCAACTGG - Intronic
955398873 3:58577105-58577127 GCACCCTGGGTTTCGGAAAAGGG - Intronic
955631191 3:60977328-60977350 GAACCCTGGTGTTCAGTCAATGG + Intronic
955966119 3:64391009-64391031 GCACACTGGTTATCAGCTATAGG + Intronic
959038679 3:101395422-101395444 GCCAGCTGATTTTCAGCAAAAGG - Intronic
966862661 3:184239290-184239312 CCACCCAGGGTTTCAGAAAAGGG + Intronic
969530004 4:7725361-7725383 GGCCCCAGGTTTTCAGCAGAAGG + Intronic
975439519 4:74394980-74395002 TCACCCTGAGTTTCAGGAAAGGG + Intergenic
975491495 4:74994160-74994182 GCAAGCTGGTTTTCTTCAAAAGG - Intronic
979093485 4:116516995-116517017 GAAGCCTGTTTTTCAGCTAACGG + Intergenic
988785458 5:34562472-34562494 GCAGTCTGGATTTCAGGAAAAGG - Intergenic
989423667 5:41270587-41270609 GCACCCTGGTGGTAAGCAAAGGG - Intergenic
990042650 5:51391420-51391442 TCAGCCTGCTTTTCAGCAACTGG + Exonic
994326452 5:98452036-98452058 GCAAACTGATTTTCAGAAAAAGG + Intergenic
997194486 5:131969087-131969109 GCTGAGTGGTTTTCAGCAAAAGG - Intronic
1001399707 5:171439241-171439263 GCACCTTGGTATTCTGCAAGAGG + Intronic
1001401449 5:171448820-171448842 GCACACTGGTGTTCAGCCACAGG + Intronic
1003626699 6:7747613-7747635 GACACCTGGTTTTCAGCACAGGG + Intronic
1004111176 6:12720468-12720490 GCCTTCTGGTTTTCAGCAGATGG + Intronic
1005503988 6:26454093-26454115 GTTCCCTGGTTTTTAGCTAAGGG + Intergenic
1007369317 6:41415834-41415856 ACACCCGGGTGTTCAGCACAGGG - Intergenic
1007803959 6:44423485-44423507 GCACACTGGTTTTACTCAAAGGG - Intronic
1015400324 6:132781173-132781195 TCACCCTGGATTTTAGGAAAAGG - Intronic
1017135532 6:151144140-151144162 GCATCAGGGTTTTCAGGAAAGGG + Intergenic
1018440558 6:163808443-163808465 TCACCCGAGTTTACAGCAAAGGG + Intergenic
1018866439 6:167750229-167750251 GCACCCTCATTTTCCACAAAAGG - Intergenic
1018965879 6:168488537-168488559 GTGCCCTGGCTTTCAGCAGATGG - Intronic
1020019113 7:4851881-4851903 TCTTCCTGGGTTTCAGCAAAGGG - Intronic
1022090711 7:27106404-27106426 TCACCCAGGTCTCCAGCAAACGG - Exonic
1023590936 7:41779811-41779833 GCACCCTGGTATTTAGCATGAGG + Intergenic
1024551219 7:50564021-50564043 CCACCCTGGTCTCCAGGAAAGGG - Intronic
1024711195 7:52016830-52016852 GCAGCCTGGTTTCCAGCTTATGG - Intergenic
1027627461 7:80563789-80563811 GCACCCTGCTTTTGTGCTAATGG - Intronic
1031425135 7:121595955-121595977 ACTCCATGGTTTTCAGTAAAAGG + Intergenic
1033499071 7:141929481-141929503 GCTGCCTGGTTTTCTTCAAAGGG + Exonic
1034553998 7:151838350-151838372 GCACCCTCGTCTCCAGCAGACGG + Intronic
1036008270 8:4692105-4692127 GCACCCTGGTACTCAGCCCAGGG + Intronic
1038200499 8:25408522-25408544 CCACCCTGATTCTCAGGAAAAGG - Intronic
1038206277 8:25468888-25468910 GCACCCTGATTTCCATCAGAAGG - Intronic
1040328286 8:46373398-46373420 GAACCCTGGGCTTCAGCCAAGGG - Intergenic
1040828103 8:51645872-51645894 GCACCATGGTTTTCAACACTGGG - Intronic
1040952439 8:52950960-52950982 ACAGCCTGCTTTTAAGCAAATGG - Intergenic
1041769273 8:61455736-61455758 GCACCCTGGGTGTCAGGAAAAGG - Intronic
1042461697 8:69076666-69076688 CCTCCCTGGATTTCAGCAATAGG + Intergenic
1043344909 8:79287557-79287579 GAAGCCTGTTTTTCAGCTAACGG + Intergenic
1047634447 8:126744771-126744793 GCACCCAGGTTTTCAGCAGATGG - Intergenic
1050120011 9:2298523-2298545 GCACACTTGTTTTCTGTAAAAGG + Intergenic
1052071328 9:24085001-24085023 TCACCCTGTCTATCAGCAAAGGG - Intergenic
1055410102 9:76020049-76020071 ACAGCCTGGTGTTCACCAAAGGG - Intronic
1059434397 9:114267441-114267463 GCCCCCTGGTTGTAAGCAAGGGG - Intronic
1059693544 9:116709249-116709271 GCACCATGGTATTTAGCAAGGGG - Intronic
1061433730 9:130547469-130547491 GCACGCTGGTGTTCAGAAAACGG + Intergenic
1185699731 X:2221820-2221842 ACACCCTGGTTTTCTGCAGTGGG + Intronic
1186379528 X:9043353-9043375 GGACCCTCCTATTCAGCAAATGG + Intronic
1187562779 X:20418406-20418428 GGAGACTGGTGTTCAGCAAAGGG - Intergenic
1188010733 X:25053045-25053067 GCCACCTGGTCCTCAGCAAATGG + Intergenic
1194217666 X:91150517-91150539 GCACCCTTGTGTCCAGTAAATGG + Intergenic
1200554175 Y:4614312-4614334 GCACCCTTGTGTCCAGTAAATGG + Intergenic
1201525732 Y:14931952-14931974 TAACCCTGGTTTTCAGCAACAGG + Intergenic