ID: 1156364899

View in Genome Browser
Species Human (GRCh38)
Location 18:36416716-36416738
Sequence CCTGCAAAGCATATGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 178}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156364899_1156364905 8 Left 1156364899 18:36416716-36416738 CCTTCCTCCATATGCTTTGCAGG 0: 1
1: 0
2: 1
3: 12
4: 178
Right 1156364905 18:36416747-36416769 TCTGAAATGCAGATCTGATTGGG 0: 1
1: 0
2: 8
3: 36
4: 393
1156364899_1156364904 7 Left 1156364899 18:36416716-36416738 CCTTCCTCCATATGCTTTGCAGG 0: 1
1: 0
2: 1
3: 12
4: 178
Right 1156364904 18:36416746-36416768 TTCTGAAATGCAGATCTGATTGG 0: 1
1: 0
2: 4
3: 28
4: 256

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156364899 Original CRISPR CCTGCAAAGCATATGGAGGA AGG (reversed) Intronic
901732531 1:11290541-11290563 CCTGCAAAGCGTAGAGAAGAAGG - Intronic
905306858 1:37025620-37025642 TCTGCAAAGCAGATGCAGAAAGG + Intronic
905376862 1:37527710-37527732 CCTGAAAAGCATATGCAGTACGG - Intergenic
905446494 1:38031181-38031203 CCTGCTGAGCATCTGGAGAATGG + Intergenic
906737583 1:48146299-48146321 ACTGCAAAACCTGTGGAGGAGGG + Intergenic
907014631 1:50999987-51000009 CATGCAATGCATATAGAAGATGG - Intergenic
907870099 1:58435358-58435380 CATGGAAAGCATATAGAGTAAGG - Intronic
908986540 1:70030639-70030661 ACTGCAAAGGATATGGAAGAGGG + Intronic
911680557 1:100710635-100710657 CCTGCAAAGCAGAAGAAGGCAGG - Intergenic
911878604 1:103203304-103203326 CCTGCAAATCATATGCAGGTGGG + Intergenic
912700010 1:111870813-111870835 TGTGCAAAGCATATGTGGGATGG + Intronic
912814652 1:112819355-112819377 ACAGCAAAGCATATTAAGGAAGG + Intergenic
915744035 1:158142417-158142439 CCTGAAAAGCTGATGGATGAGGG - Intergenic
916337081 1:163685016-163685038 GCTGCATAACATATGCAGGATGG - Intergenic
916639473 1:166711642-166711664 CCTGCAAGGGGAATGGAGGAAGG - Intergenic
920666663 1:207967713-207967735 CCTCCAAAGCCTATAGGGGAAGG - Intergenic
922762128 1:228139849-228139871 CCTGCAGTGTAGATGGAGGACGG + Intergenic
923014186 1:230113124-230113146 GCTGCACAGCATCTGGAGGGAGG + Intronic
923123921 1:231019400-231019422 GCTGCAGAGCATATTGAGGAAGG + Exonic
923517069 1:234706958-234706980 CTTGGGAAGCATATGTAGGAAGG - Intergenic
1063975470 10:11412199-11412221 CCAGCAATGCAACTGGAGGAGGG - Intergenic
1064299590 10:14111850-14111872 CCTGCAGGGCAGGTGGAGGAGGG + Intronic
1066074601 10:31860496-31860518 CCTGCAAGAGGTATGGAGGAAGG + Intronic
1067776970 10:49170927-49170949 TCTGCAAAGTAGCTGGAGGATGG + Intronic
1072237858 10:93468726-93468748 CATGCACAGCATAGGAAGGAGGG - Intronic
1073136253 10:101222254-101222276 GCTACAAAGCATGTGGAAGAAGG - Intergenic
1076879422 10:133232495-133232517 CCAGAAAAGCATGTGCAGGAGGG - Intergenic
1077239490 11:1503117-1503139 CCTGCAGAGCCTGTGGAGAAGGG + Intergenic
1077452112 11:2654509-2654531 CCTGGAAAGCTTGTGGAAGAGGG + Intronic
1078462873 11:11528610-11528632 CCTGACAAGCATGTGGATGATGG + Intronic
1083138924 11:60705429-60705451 CCTGCAGAGCAAAAGGAGGAAGG - Intronic
1086464458 11:87038371-87038393 CCTGCAAGGGAGAAGGAGGAGGG + Intronic
1087712963 11:101575560-101575582 CCTACAAAGCACTTGGAGAAGGG + Intronic
1088360851 11:108988257-108988279 CTTGCAGTGTATATGGAGGAAGG + Intergenic
1089742790 11:120596621-120596643 TCTATAAAGCATATGGAGAAGGG + Intronic
1091288904 11:134425913-134425935 CCTTCACAGCACATAGAGGAGGG - Intergenic
1092326793 12:7540961-7540983 CCTGCAAATCATATGCAAGGAGG + Intergenic
1096239754 12:49953522-49953544 CCTGCACATCCTATGGAGGTTGG - Intronic
1097736389 12:63186263-63186285 ACTGGAAAGGAGATGGAGGATGG + Intergenic
1098971244 12:76859028-76859050 CCTACAAAGGAAAGGGAGGAAGG + Exonic
1100669568 12:96795786-96795808 CCTGGACAGAATCTGGAGGAGGG - Intronic
1103783597 12:123415753-123415775 CCTTCAAAGCAGACTGAGGAGGG - Exonic
1107532298 13:41295044-41295066 CCTGCAAATCACATGCAGCAAGG - Intergenic
1108568683 13:51728281-51728303 CCTGAAAAGGATATGAAGGAAGG - Intronic
1109097647 13:58139037-58139059 TTTGCAAAGCATATGGATGAGGG - Intergenic
1117109063 14:52429802-52429824 CCTGAAAAGGATACAGAGGATGG + Intergenic
1118169004 14:63366983-63367005 CCTGAAAAGCATATTCTGGAGGG + Intergenic
1120775535 14:88432714-88432736 TCTGCAAAGCATTTGCAAGAAGG - Intronic
1121508136 14:94492032-94492054 CCAGCAAAGGAGATTGAGGAGGG + Intronic
1123189929 14:106559296-106559318 CCAGCATCTCATATGGAGGAGGG + Intergenic
1127888164 15:63222371-63222393 GCTGCAAACCATATTGGGGATGG - Intronic
1128883099 15:71261348-71261370 CCTCCAAAGTCTCTGGAGGAAGG - Intronic
1129231153 15:74197818-74197840 CCTGCAGAGCAAATGAAGGCTGG + Exonic
1129946477 15:79543119-79543141 CCTGCCAATCATAGGGAGAATGG + Intergenic
1132427742 15:101733540-101733562 CATACAAAGCATTTGAAGGATGG + Intergenic
1134081603 16:11328551-11328573 GCTGCAAAGGGTCTGGAGGACGG - Intronic
1134326681 16:13214128-13214150 CCAACAAAGCATATGGAGAAGGG - Intronic
1136134208 16:28244924-28244946 CCTGTAAAGGGGATGGAGGAAGG - Intergenic
1141774773 16:86115974-86115996 CCTGCAAAGCAGAGGGAGGATGG - Intergenic
1142133131 16:88439935-88439957 CCCGCAGAGCAAATGGAGGCTGG - Exonic
1143160849 17:4869722-4869744 GCTGCCAAGGATATGGAGAAAGG - Intronic
1143617619 17:8063216-8063238 CCTGCATAGCCTGAGGAGGAGGG + Intergenic
1144850044 17:18239488-18239510 ACAGCAAAGAATGTGGAGGAGGG - Intronic
1147745443 17:42691783-42691805 CTAGAAAAGCAGATGGAGGAAGG - Intronic
1148956665 17:51359894-51359916 GCTGCAAAGCATCTGGAAAATGG - Intergenic
1151563371 17:74882933-74882955 TCTGCAAAGCATTTGGGGGTGGG + Intronic
1153520908 18:5953162-5953184 CCTGCAGAGCATCAGGAGAAGGG + Intergenic
1154136415 18:11783878-11783900 ACTGCAGAGAATATGGAGAAAGG + Intronic
1155072884 18:22331667-22331689 ACTGCATATCATTTGGAGGATGG - Intergenic
1155250400 18:23948316-23948338 CCTGAAAAGGATATGTGGGAGGG - Intronic
1155553340 18:26990867-26990889 CCTGAAGAGCAGAAGGAGGAAGG - Intronic
1156364899 18:36416716-36416738 CCTGCAAAGCATATGGAGGAAGG - Intronic
1158045542 18:53150694-53150716 GCAGCAAAGCAATTGGAGGAAGG + Intronic
1158568211 18:58573936-58573958 CCTGGAAAACATGTGGTGGATGG - Intronic
1159627698 18:70714011-70714033 CCTGTAAAGGAGATGGAGGGAGG + Intergenic
1161420560 19:4174236-4174258 CCTGCAGGGCCCATGGAGGAGGG + Exonic
1164767274 19:30781613-30781635 CCTGCAAAGCACAGCCAGGATGG + Intergenic
1165948410 19:39458870-39458892 CCTGCAAAACCTCTGGAGGTGGG + Exonic
925027858 2:623748-623770 CCTCTAAAGCAAATGGAGGATGG + Intergenic
926716526 2:15928580-15928602 CCTGGACAGCATCTGGCGGAGGG + Intergenic
926925192 2:17980331-17980353 CCTGCTAAGTATTTGGAGGCTGG - Intronic
927865191 2:26583530-26583552 CCTGGAAAGGACTTGGAGGAAGG + Intronic
928534558 2:32227455-32227477 GCTGGGAAGCATATGGAGAAGGG - Intronic
928764666 2:34629962-34629984 GCTGGAAAGCATGTGGAGAAAGG + Intergenic
932542627 2:72672048-72672070 GCTGGCAAGGATATGGAGGACGG + Intronic
932616781 2:73236844-73236866 CCTGCAAAGCATAGGGAACCTGG + Intronic
933009478 2:77041074-77041096 GCTGGAAAGTATAAGGAGGAAGG - Intronic
933286754 2:80392927-80392949 ACTGCTAAGCGTCTGGAGGAGGG + Intronic
936666549 2:114603651-114603673 CCAGTAAAGGATGTGGAGGATGG + Intronic
938792173 2:134686279-134686301 CCTCCACAGCAGGTGGAGGAAGG + Intronic
940088964 2:149895129-149895151 CCGGAAAGGCATAAGGAGGAAGG - Intergenic
941513914 2:166448109-166448131 CCTGCAAAGGGTATGTATGAGGG - Intronic
942396175 2:175551989-175552011 CTAGCAAAGCAGATGGGGGAGGG + Intergenic
942601983 2:177650814-177650836 CCTGCAGACCATCTGTAGGAGGG - Intronic
943505139 2:188746119-188746141 CATGCGAAGCATATGGAATATGG + Intronic
944497078 2:200317624-200317646 AATGCAAAGCATAGGGAGAATGG - Intronic
946305340 2:218853859-218853881 GCTGCAAAGGAGATAGAGGAGGG - Intergenic
947903274 2:233740478-233740500 ACTGGAAAGCATCTGGAAGAGGG - Intronic
948226092 2:236310278-236310300 GATGCTAAGCATTTGGAGGATGG + Intergenic
948855061 2:240726312-240726334 CATTAAAAGCACATGGAGGATGG + Intronic
1170301133 20:14885772-14885794 CCAGCAAAGGGAATGGAGGATGG - Intronic
1172099515 20:32476777-32476799 GCTGCAAAGCACATGGAAGCAGG + Intronic
1172900928 20:38334408-38334430 CCTGGAAATCAGAGGGAGGATGG - Exonic
1173210093 20:41025643-41025665 CCTGGAAAGCAAATGCAGGCTGG + Intergenic
1174138112 20:48394419-48394441 CCTGCTCAGCAAATGAAGGATGG - Intergenic
1174695571 20:52553180-52553202 CCTGAAGAGCATATGGATAAAGG + Intergenic
1178624199 21:34201980-34202002 CCTGCAAAGCCCACTGAGGAGGG + Intergenic
1179308251 21:40174388-40174410 ACTGCAAAGCTTAGTGAGGAAGG - Intronic
1179594212 21:42431192-42431214 CCTGCACAGCATGGGGAGAAGGG + Intronic
1182719708 22:32387225-32387247 CCTGCAAGGCATGTGTAGGAGGG + Intergenic
1183102525 22:35592673-35592695 CCTGTAAAGCATGTGCGGGAAGG + Intergenic
1184730866 22:46370209-46370231 GCTCCAAAACAGATGGAGGACGG + Intronic
1184887314 22:47354299-47354321 ACTTCAAGGCATATTGAGGAGGG + Intergenic
949961598 3:9316841-9316863 CCTGCTAAGCATCTGAAGGCGGG + Intronic
950405528 3:12801966-12801988 TCTGCCAAACAGATGGAGGAGGG - Intronic
953551028 3:43903137-43903159 CCTGCAAAGCAAAAGGGGCATGG + Intergenic
953758106 3:45665334-45665356 CCAGCAAAGCATTTGGTGGCAGG - Intronic
954592960 3:51799694-51799716 CCTGCAATGCAGAGGGAAGATGG + Intergenic
954600816 3:51866734-51866756 CCTGATTAGCATATGCAGGAGGG - Intergenic
954894171 3:53961635-53961657 CCTGCAAAGTTTCTGGAGGAAGG + Intergenic
955323578 3:57992511-57992533 CCAGCCCAGCATTTGGAGGAAGG + Intergenic
955341331 3:58127770-58127792 CCCCCAAAACAAATGGAGGAGGG - Intronic
955709179 3:61760908-61760930 CCTGCAAAGGATGTGAATGAAGG + Intronic
956783651 3:72624417-72624439 CCTGAAGAGCTTAGGGAGGAAGG - Intergenic
957938074 3:86969341-86969363 CAAGCAAAGCAAATGGAGGGAGG - Intronic
958662307 3:97086968-97086990 CCTGCAAAGCATGTTGAATATGG + Intronic
969858163 4:10016431-10016453 CATGAAAAGTACATGGAGGAGGG + Intronic
970422825 4:15920947-15920969 CTTGCAAAGAAAGTGGAGGAAGG - Intergenic
972742138 4:41897372-41897394 TATGCAAAGTAGATGGAGGATGG - Intergenic
972969620 4:44557186-44557208 GCAGCAAAACAAATGGAGGAAGG - Intergenic
975245678 4:72118036-72118058 AGTGAAAAACATATGGAGGAAGG + Intronic
978440628 4:108729925-108729947 GGGGCAATGCATATGGAGGAAGG + Intergenic
978996818 4:115167145-115167167 CTTGCAAAACATATAGATGAAGG + Intergenic
980878509 4:138686261-138686283 CCTGGAAGGCACAGGGAGGACGG + Intergenic
984274655 4:177595535-177595557 CCTGCAAAGAATAAGAGGGAAGG - Intergenic
990257231 5:53983438-53983460 TCTCCAAAGCATGTGGGGGAAGG + Intronic
990715431 5:58631270-58631292 TTTGTAAAGCAAATGGAGGATGG - Intronic
990752684 5:59035088-59035110 CATGGAAAGTATATTGAGGATGG - Intronic
991258997 5:64646490-64646512 CATGCAAAGCAGCAGGAGGAGGG + Intergenic
996014839 5:118521682-118521704 CCTGCACAGCACTTGGAGAAGGG + Intergenic
996813616 5:127548100-127548122 CCTGGAAAACAAAAGGAGGAAGG - Intronic
997592493 5:135084180-135084202 ACTGGAAAGCAGATGGATGAGGG - Intronic
1000128956 5:158276231-158276253 CCTGCAAAGCATTTAGAAGGAGG - Intergenic
1000852357 5:166356049-166356071 CCTGCAGAGCATATGGGTGTGGG - Intergenic
1007515416 6:42406766-42406788 CCTGCAAAGGCTGGGGAGGAGGG - Intronic
1010414016 6:75593296-75593318 CCTGCAAATCACATGTAGCAAGG + Intergenic
1011415183 6:87111583-87111605 CCTGCAAATCACATGCAGCAAGG - Intergenic
1011847379 6:91582899-91582921 CATGCATAGCATACTGAGGATGG + Intergenic
1013467716 6:110431853-110431875 CCTGCACAGCAGATGAAGAATGG - Intronic
1017082171 6:150680543-150680565 CCTGCAAAGGAGATTGAAGAGGG + Intronic
1017640096 6:156484594-156484616 CCTGCAAACCATGTGCAGCAAGG + Intergenic
1018051891 6:160016389-160016411 CCAGCAAGGCAGATTGAGGAAGG - Intronic
1018638346 6:165884404-165884426 CCTGGACAGCAGCTGGAGGAAGG + Intronic
1019794563 7:3040281-3040303 CCTGCAAAGCAGATAGTGCAGGG + Intronic
1019834696 7:3371128-3371150 CCTTCAATGCATGTGGAGGCAGG - Intronic
1023956894 7:44893750-44893772 GCTGCAAAGCATTTGCAGCACGG - Intergenic
1026859883 7:73778917-73778939 CGTGCAAAGCCCATGGAGAAAGG + Intergenic
1027619404 7:80464992-80465014 CTTGCAAAATAAATGGAGGAAGG + Intronic
1032258906 7:130318735-130318757 CCTATAAAGAATATGGAAGATGG - Intronic
1033229406 7:139584542-139584564 CTGGCAAAGCTTATGCAGGAGGG + Intronic
1036298628 8:7555535-7555557 CTTGCAATTCAGATGGAGGAAGG + Intergenic
1036299933 8:7563185-7563207 CTTGCAATTCAGATGGAGGAAGG + Intergenic
1036641543 8:10587394-10587416 CCTCCAAAGCAAGTGGAGCAAGG - Intergenic
1037618022 8:20537452-20537474 CCTGCAACACACTTGGAGGAAGG + Intergenic
1038996351 8:32927697-32927719 CATGCAAAGCACCTGGAAGAGGG + Intergenic
1040055168 8:43051516-43051538 CCTCCAAATCTTATGGAGGTGGG + Intronic
1040386142 8:46916235-46916257 TCTGCAAAGCCTGAGGAGGAAGG + Intergenic
1042315180 8:67418816-67418838 CCTGCAAAGGATCTGGATGCAGG + Intergenic
1042532914 8:69833169-69833191 CCTGCAAAGCAGAAAGAGGGCGG + Exonic
1044715915 8:95099383-95099405 CAGGCAGAGAATATGGAGGAAGG - Intronic
1044834739 8:96285225-96285247 CCTGCAAAGATTCTGGGGGAGGG + Intronic
1045117157 8:98995205-98995227 CTGGGAAAGCATATGGAAGAAGG - Intergenic
1048857292 8:138695778-138695800 CCTGCAATTCATATGGAACAAGG + Intronic
1050073474 9:1840350-1840372 CGTGCAGAGGAAATGGAGGAAGG + Intergenic
1053285336 9:36846620-36846642 CCACCAAAGCATCTGGGGGAGGG + Intronic
1055959422 9:81806069-81806091 CTTGCAAAACATATTGAGGTTGG - Intergenic
1057230729 9:93319890-93319912 CCTGCAATGCACACGCAGGAGGG - Intronic
1057686952 9:97243335-97243357 CCTGTGAAGAATTTGGAGGAAGG + Intergenic
1057810528 9:98253705-98253727 CCAGAAAGGCATCTGGAGGAGGG - Intronic
1057859011 9:98625011-98625033 CCAGCAAAGCCTCTGGAGGCTGG - Intronic
1062367530 9:136218382-136218404 CCTGGAGAGTAGATGGAGGAGGG - Intronic
1062402049 9:136377021-136377043 CCTGGAAAGCATGTGGAGCTGGG - Intronic
1062455239 9:136633694-136633716 CCTGAAAAGCAAATAGAGGCCGG + Intergenic
1185623948 X:1469475-1469497 CCTGCAAAGCATAAGAAAAAGGG - Intronic
1190057624 X:47190979-47191001 TCTGGACAGCATTTGGAGGAGGG + Intronic
1190397629 X:50000819-50000841 CAGGCAAAGCATATGGATTAAGG - Intronic
1191820399 X:65300147-65300169 CCTGGACAGAATATGGGGGAAGG + Intergenic
1194232763 X:91344784-91344806 GCTGCTAATCATATCGAGGATGG - Intergenic
1195243999 X:102979764-102979786 CCTGCAATGCCTATGGAGAAAGG - Intergenic
1195992675 X:110698196-110698218 CCTGCAAAGGATATTCAGAAGGG + Intronic
1199794274 X:151179749-151179771 CCTGAAAAACATATCGAGGGAGG - Exonic
1200076941 X:153555960-153555982 CCTGCAGATCTGATGGAGGAAGG + Intronic