ID: 1156367657

View in Genome Browser
Species Human (GRCh38)
Location 18:36444570-36444592
Sequence AGTTATCTATAGAGGATGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 224
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 206}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156367657_1156367659 -9 Left 1156367657 18:36444570-36444592 CCACTCATCCTCTATAGATAACT 0: 1
1: 0
2: 1
3: 16
4: 206
Right 1156367659 18:36444584-36444606 TAGATAACTAGTCTCCTTTCTGG 0: 1
1: 0
2: 0
3: 9
4: 98

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156367657 Original CRISPR AGTTATCTATAGAGGATGAG TGG (reversed) Intronic
903120066 1:21210388-21210410 AGTTATCCACAGAGGATGGTGGG - Intergenic
903202964 1:21758429-21758451 GGTTACCTACAGAGCATGAGTGG + Intronic
904015289 1:27415198-27415220 AGTTATCCAAAGAGGAAGTGGGG - Intronic
904372990 1:30062374-30062396 AGTTATCTACAGAAGAGGATAGG - Intergenic
904610221 1:31721724-31721746 AGTTAGCTGGAGAGGATGATGGG - Intergenic
906245435 1:44270208-44270230 ACTTATCTATTGAGTCTGAGAGG - Intronic
907597345 1:55732128-55732150 AGTTATCTGCAGAAGATGACAGG - Intergenic
907602084 1:55782149-55782171 AGTTATCTGTAGATGATGGCAGG + Intergenic
909734540 1:78941095-78941117 ACTTAGAAATAGAGGATGAGGGG - Intronic
909876014 1:80804467-80804489 AGTTGTATCTGGAGGATGAGAGG - Intergenic
910609290 1:89123892-89123914 GGATATCTATGGAGGATAAGTGG - Intronic
910613747 1:89173909-89173931 GGGTATCTATGGAGGATGGGTGG - Intronic
911989172 1:104670545-104670567 TGTTGTCTAAAGAGAATGAGAGG + Intergenic
917891642 1:179444307-179444329 AGTTATCTATAAAAGGTAAGTGG + Intronic
919124613 1:193379783-193379805 AGTTATCTACAGAAGATGGCAGG + Intergenic
919659204 1:200226925-200226947 AGTCAGCTATAGGGGATCAGAGG - Intergenic
922781048 1:228252583-228252605 AGTTATCTGCAGAAGATGACAGG + Intronic
1063712486 10:8493149-8493171 AGATATCAATGGAGGATGTGAGG - Intergenic
1064797347 10:19028279-19028301 ATGTGTCTATAGAAGATGAGGGG - Intergenic
1067150215 10:43726259-43726281 AGTTTTATAAAGAGGAGGAGAGG - Intergenic
1068181107 10:53519657-53519679 AGATACCTATAGAGGATGCAGGG - Intergenic
1069851869 10:71410650-71410672 AGTTAACTTCAGAGGATGACGGG - Intronic
1073449255 10:103600089-103600111 TGTTTTCTATAGAGGAGGAAAGG - Exonic
1073830506 10:107378011-107378033 AGTTATCTGTAGATGATGGCAGG + Intergenic
1073995875 10:109314719-109314741 AGTTATCTACAGAAGATAATGGG + Intergenic
1074122724 10:110505091-110505113 TTTTATCTCTAGAGGAAGAGAGG + Intronic
1074235655 10:111582111-111582133 AGTTATCTATAGAGAATAGCAGG + Intergenic
1074334528 10:112557744-112557766 AGTTATCTAAAGAGAAAGATGGG - Intronic
1077992165 11:7422005-7422027 AGTTATTTACTGAGGATGCGTGG + Intronic
1079488390 11:20959981-20960003 AGTTATCTCTAGTGGCTGGGAGG + Intronic
1080370500 11:31634615-31634637 AGTTATCTAGATAGGCTGATTGG - Intronic
1081609059 11:44547850-44547872 AGTTATCTGTAGAAGATGGCAGG - Intergenic
1083112258 11:60422849-60422871 AGTTATCTGAAGAGGATGGAAGG + Intergenic
1086039349 11:82456700-82456722 ATTTCTCTATAGTGGATGATAGG - Intergenic
1088618876 11:111662144-111662166 AGTAATGTATATAGGATGATTGG + Intronic
1088873716 11:113915291-113915313 AGATATCTAAAGAGCATGGGAGG - Intronic
1091371901 11:135067673-135067695 AGTTATCTTTTGAGAAAGAGAGG + Intergenic
1094642513 12:32289691-32289713 TGTTGTTTATAGAGGATGATTGG + Intronic
1095190258 12:39250137-39250159 AGCTATCTACAGAGGATGGCAGG - Intergenic
1095384703 12:41637096-41637118 ACTTATCTTTGGAGGATAAGTGG - Intergenic
1095560566 12:43560420-43560442 AGCTATTTATTGAGGCTGAGAGG - Intergenic
1096288710 12:50322933-50322955 AGTTATCTACAGAAGATGGCAGG - Intergenic
1098135831 12:67400852-67400874 ATTTAATTATAGAGGATGATTGG - Intergenic
1098749845 12:74279564-74279586 AGTTATCTGCAGAAGATGACAGG - Intergenic
1098801846 12:74970054-74970076 AGATATCTAAATAGGAAGAGAGG + Intergenic
1099995069 12:89769557-89769579 AGTTATCTGAAGAGGATGGCAGG + Intergenic
1101264129 12:103066095-103066117 AGTTATCTGCAGAAGATGACAGG - Intergenic
1102211237 12:111128712-111128734 AGTTATCTATAGATGATATAGGG + Intronic
1102428391 12:112862560-112862582 AGTTATTTCTATAGGATGATTGG - Intronic
1107983578 13:45755999-45756021 AGTTATCTGCAGAAGATGACAGG + Intergenic
1108371985 13:49779336-49779358 CGTTAACTATAGAGAATGAAGGG - Intronic
1108536375 13:51384673-51384695 AGTTAAATATGGAGGATGAGGGG - Intronic
1108978003 13:56473765-56473787 AGTTATCCAAATAGGAAGAGAGG - Intergenic
1111172092 13:84541031-84541053 AGTTATCAAAGGAGGATAAGTGG - Intergenic
1114789130 14:25636149-25636171 AGTTATCTATAGAGTTTCAGGGG + Intergenic
1115059714 14:29173867-29173889 AGTTATCTGCAGAAGATGACAGG - Intergenic
1115730263 14:36260862-36260884 AATTATATATAGAAAATGAGAGG - Intergenic
1116068091 14:40009144-40009166 AGTTATCTGAAGAAGATGGGAGG - Intergenic
1116132736 14:40878992-40879014 AGTGAGCTCAAGAGGATGAGTGG - Intergenic
1116168597 14:41368107-41368129 AGTTGTGTACAGAGGATGACAGG - Intergenic
1116730549 14:48615825-48615847 ATTTATCTTTAGAGCATGACAGG - Intergenic
1124599411 15:31119274-31119296 ACTTATCTATAGAGGAACAAGGG + Intronic
1125135858 15:36342007-36342029 TGGTGTCAATAGAGGATGAGTGG + Intergenic
1128489030 15:68127339-68127361 AGCTAACTAGAGAGGATGAATGG + Intronic
1130531743 15:84752182-84752204 AGTTATTAAGAGAAGATGAGAGG - Intronic
1131695671 15:94875532-94875554 AAATATCTATAGAGGCAGAGAGG + Intergenic
1137641176 16:50031444-50031466 AGTCATCTTTAGGGGAAGAGTGG + Intronic
1138535105 16:57655786-57655808 GGTTATCTAGAGAGGGTAAGGGG + Intronic
1143700161 17:8652942-8652964 AGTTATCTATAGGGAAAGAGAGG + Intergenic
1146083699 17:29807387-29807409 AGCTATCAATAGAGGAAAAGAGG + Intronic
1148650542 17:49247214-49247236 AGTTATACTTAGAGGATGAAGGG + Intergenic
1149631020 17:58123407-58123429 AATTATATGTGGAGGATGAGAGG - Intergenic
1153462204 18:5348381-5348403 AGTTATCCACATAGGAGGAGAGG + Intergenic
1153741318 18:8131625-8131647 AGTTCTCAAGAGAGCATGAGGGG + Intronic
1155669885 18:28357192-28357214 AGTTATCTATACAGAAAGACAGG - Intergenic
1156187450 18:34679334-34679356 CGTTATTAATAGAGGATAAGGGG + Intronic
1156367657 18:36444570-36444592 AGTTATCTATAGAGGATGAGTGG - Intronic
1156638152 18:39055988-39056010 AGTTACCTATAGATGAATAGAGG - Intergenic
1157785317 18:50476635-50476657 AGTTATATATGGAGGAAGTGAGG + Intergenic
1158424990 18:57330884-57330906 AGTTAGCCATAGAGGATGGGAGG + Intergenic
1159793992 18:72820185-72820207 ATTTATATATAGACAATGAGAGG + Intronic
1165381968 19:35488141-35488163 GTTTTTCCATAGAGGATGAGGGG + Intronic
1166440797 19:42813309-42813331 AGTTATCCAAAGTGGATGGGTGG - Intronic
1166460297 19:42982191-42982213 AGTTATCCAAAGTGGATGGGTGG - Intronic
1166477574 19:43141898-43141920 AGTTATCCAAAGTGGATGAGTGG - Intronic
1166489002 19:43241380-43241402 AGTTATCCAAAGTGGATGGGTGG - Intronic
1167951576 19:53031895-53031917 AGTTATCTGCAGAGGATGGTAGG - Intergenic
927770249 2:25854848-25854870 GGCTTACTATAGAGGATGAGTGG - Intronic
927787465 2:25983232-25983254 ATTTTTCTATAGAGGAGTAGTGG - Intergenic
927806073 2:26147947-26147969 AGGTATCTGTAGTGGAGGAGGGG - Intergenic
933265687 2:80178412-80178434 AGTTATCTGCAGAAGATGACAGG + Intronic
937224476 2:120360322-120360344 ACTTGGCTCTAGAGGATGAGAGG + Intergenic
937785210 2:125887757-125887779 AGTTATCTGCAGAGGATGGCAGG + Intergenic
938680189 2:133681694-133681716 AGTCCTATATAGAGGATGAGAGG - Intergenic
944405802 2:199381987-199382009 AGTTAACTATACAGGAAGATGGG + Intronic
945516333 2:210767308-210767330 ATTTATTTATAGAGGATAAAAGG - Intergenic
946069580 2:217021689-217021711 TGTGATCTATAGAGGATGTGGGG + Intergenic
1170092312 20:12604140-12604162 AGGTATCTGCAGAGGATGACAGG + Intergenic
1173772246 20:45670905-45670927 AGTCATCTAAATAGGAAGAGAGG + Intergenic
1178484234 21:33007214-33007236 AGTTATGACTAGAAGATGAGAGG + Intergenic
1180880209 22:19198110-19198132 AGTTATCACCAGTGGATGAGGGG - Intronic
1181420650 22:22795802-22795824 AGTTATCTGTAGAGGATGGCAGG - Intronic
1182036819 22:27205314-27205336 AGTTATGTTTAGAAGGTGAGGGG + Intergenic
1184780079 22:46643971-46643993 GGTTATCTACAGGGGAAGAGAGG - Intronic
951003616 3:17592822-17592844 AGTTATCTACAGAAGATGGCAGG - Intronic
951774099 3:26289284-26289306 AGTTATCTTGAGTAGATGAGTGG + Intergenic
954054115 3:48007647-48007669 AGTTATCTGTAGAAGATGGCAGG - Intronic
955035581 3:55264062-55264084 AGTTATCTGCAGAGGATGGCAGG - Intergenic
955077888 3:55631022-55631044 AGCTATATATAGAGAAAGAGAGG + Intronic
955542279 3:59989904-59989926 AGTTCTCTGTGGAGGAAGAGTGG - Intronic
955682172 3:61513774-61513796 AGTTATCCATAGAGGACATGTGG - Intergenic
955825153 3:62938230-62938252 AATTATCTGTTCAGGATGAGTGG + Intergenic
955847176 3:63178360-63178382 ATTTATCTATGTAGGATGAGGGG + Intergenic
956703897 3:71982917-71982939 AGTTATCTGCAGAAGATGACAGG + Intergenic
957642581 3:82875697-82875719 AGTTATCTATAGAGGAGATTAGG + Intergenic
959802205 3:110508789-110508811 AGTTCTATATTGAAGATGAGTGG + Intergenic
960704408 3:120468296-120468318 AGTTAAGTTTAGAGGAAGAGGGG + Intergenic
961960237 3:130847151-130847173 ATTTTTCTATCGAGGACGAGGGG + Intergenic
964118659 3:153161232-153161254 GGTTATTTATAGAGATTGAGCGG - Intergenic
964297669 3:155251891-155251913 AGTTATCTGCAGATGATGGGAGG - Intergenic
965376380 3:167929583-167929605 AATTATTTATAGTGAATGAGAGG + Intergenic
965463125 3:168993525-168993547 AATTAGATATTGAGGATGAGAGG - Intergenic
965708648 3:171534809-171534831 AGTTATCTGCAGAGGATGGCAGG + Intergenic
965914035 3:173819252-173819274 ATTTAGGTCTAGAGGATGAGGGG - Intronic
966504459 3:180683957-180683979 AGTGATGTATTGAAGATGAGAGG - Intronic
967983595 3:195079758-195079780 AGTCATCTAAGGAGGAGGAGGGG + Intronic
968572762 4:1350865-1350887 AGCTATCTATACAGAATGTGAGG - Intronic
970206084 4:13656933-13656955 AGTGATGTATAAAGGCTGAGTGG - Intergenic
971857654 4:32062863-32062885 AGTTATCTGCAGAAGATGACAGG + Intergenic
972201301 4:36717183-36717205 AGTTATCTGTAGAAGATGGCAGG + Intergenic
973658668 4:53079040-53079062 ACATAACTATAGAGGTTGAGAGG + Intronic
974546231 4:63310967-63310989 AGCTATCAATAAAGGATAAGAGG - Intergenic
974941156 4:68469893-68469915 AGTTATTCATAAAGTATGAGGGG - Intronic
975386719 4:73767539-73767561 AGTTATCTACAGAAGATGGCAGG + Intergenic
977031619 4:91891377-91891399 AGTTATCTACAGAAGATGGCAGG - Intergenic
977036583 4:91960760-91960782 AGTTATCTTTTGAAGATGAGAGG - Intergenic
977204714 4:94155654-94155676 AGTTATCTGCAGAAGATGACAGG - Intergenic
977846085 4:101769059-101769081 AGATATCTAAATAGGAAGAGAGG - Intronic
978360849 4:107930213-107930235 GGTTAATTATAGAAGATGAGAGG + Intergenic
979767017 4:124474565-124474587 AGTTATCTGTAGAAGATGGCAGG - Intergenic
980497528 4:133605392-133605414 AGTTATCTACAGAAGATTACAGG + Intergenic
981786715 4:148487813-148487835 AATTATTTATAGGGGATGGGAGG - Intergenic
983394635 4:167177965-167177987 AATTATCTATAGAGAAGCAGAGG + Intronic
983767667 4:171505830-171505852 TGTTTTCTTTAGAAGATGAGAGG + Intergenic
983848451 4:172548048-172548070 ATTAATCTATTGAGGATGTGAGG + Intronic
984966664 4:185145454-185145476 AGTTATTCAGAGAGGAGGAGGGG + Intronic
986573418 5:9188822-9188844 AGTTATCTGGAGGGGATGGGAGG - Intronic
987449623 5:18065580-18065602 AGTGATCAATAGAGGAATAGGGG - Intergenic
987504385 5:18749824-18749846 AGTTAACTACAGAAGATGACAGG - Intergenic
989288210 5:39729192-39729214 TGTTATCTATATAGGAAAAGAGG - Intergenic
989541479 5:42623678-42623700 AGGGATCTATAAAGGAAGAGTGG - Intronic
991471825 5:66976921-66976943 AGTTTTCTATTGATGATGATTGG + Intronic
992109883 5:73482906-73482928 AGTTATCTGCAGAAGATGACAGG + Intergenic
996650298 5:125867757-125867779 GTTTATCTATAGAGTATTAGTGG - Intergenic
1000416970 5:160993873-160993895 AGTTATCTACAGAAGATGGCAGG - Intergenic
1008374852 6:50779884-50779906 AGTTATCTCCAGAGGAAGAGTGG + Intergenic
1009390114 6:63135106-63135128 AGTTATCTGCAGAAGATGACAGG + Intergenic
1009624997 6:66127296-66127318 CTGTATCTCTAGAGGATGAGTGG - Intergenic
1011636733 6:89381491-89381513 GGTTGTCTCTAGAGGATGAGGGG - Intronic
1012033366 6:94101061-94101083 AGTTATTCATAGAGGATGGTGGG - Intergenic
1012102783 6:95112192-95112214 CCTCATCTATAAAGGATGAGGGG + Intergenic
1012730458 6:102874291-102874313 AGTTATCTGTAGAAGATGGCAGG - Intergenic
1012964129 6:105655322-105655344 AGTTATCCATAGAAGATGGCAGG - Intergenic
1013406668 6:109849774-109849796 AGTTATCTGTAGAAGATGGCAGG - Intergenic
1013654310 6:112229314-112229336 GGTTATTTAAAGAGGAGGAGAGG - Intronic
1014498509 6:122157298-122157320 AATTATCTGTACAGGTTGAGTGG + Intergenic
1015443289 6:133272593-133272615 AGTTATCTGTAGAAGATGGTTGG + Intronic
1017472186 6:154749895-154749917 ATTAGTCTAGAGAGGATGAGGGG + Intronic
1018691489 6:166347621-166347643 ATTTACCTATAGGGGATGGGTGG - Intergenic
1020509127 7:9030529-9030551 GGTCAGCTAAAGAGGATGAGTGG - Intergenic
1020625226 7:10569624-10569646 ATATTTCTATAGAGAATGAGTGG + Intergenic
1021145583 7:17084823-17084845 AGGTATCAATGGAGGCTGAGGGG - Intergenic
1022138425 7:27470900-27470922 AGCTTTCAATCGAGGATGAGGGG + Intergenic
1023885879 7:44355537-44355559 AGGCATCTATATAGGAAGAGAGG - Intergenic
1024102473 7:46046674-46046696 AGTTTTCTTTAGATGATGATGGG + Intergenic
1024714140 7:52055347-52055369 TGATATCTATAGAGGGTTAGAGG - Intergenic
1027711294 7:81604615-81604637 TGTTATGTAAAGAGGATGGGAGG + Intergenic
1029892346 7:103943890-103943912 AGTTATCTATGGATGTTGTGGGG - Intronic
1030729359 7:112967207-112967229 AGTCATTTATAAAGAATGAGGGG - Intergenic
1031236824 7:119187986-119188008 AGTTATCTGCAGAAGATGACAGG - Intergenic
1033655000 7:143367198-143367220 AGTTAGTTATAGAGGATGAGAGG + Intergenic
1034409049 7:150928478-150928500 AGTTATCTATGGGAGAGGAGGGG + Intergenic
1036527350 8:9547549-9547571 AGTTATCCACAGAGGATGGCAGG + Intergenic
1038454472 8:27663667-27663689 GGTTATCTATGGAGAATGGGAGG + Intronic
1039218523 8:35300789-35300811 AGTATTCTATAGATAATGAGAGG + Intronic
1039292313 8:36109912-36109934 AGTTATCTACAGAGGATAGCAGG + Intergenic
1039324174 8:36466555-36466577 AGTTATCTACAGAAGATGTGAGG + Intergenic
1039466494 8:37788727-37788749 AATAAAATATAGAGGATGAGGGG - Intronic
1041934551 8:63321300-63321322 AGTTATCTGCAGAAGATGACAGG - Intergenic
1042712278 8:71731483-71731505 AGTTATCTTTGGAGGATGCTAGG + Intergenic
1043718480 8:83513153-83513175 AGTTATCTATTCAGAATTAGAGG + Intergenic
1047070687 8:121339910-121339932 AGGTATCTAAAAAGGAGGAGGGG - Intergenic
1052442272 9:28512312-28512334 AGTTATCTGCAGAAGATGACAGG + Intronic
1052482611 9:29050519-29050541 GGTTACCTATAGATGGTGAGTGG + Intergenic
1055162649 9:73149386-73149408 AGTTAAATGTAAAGGATGAGGGG + Intergenic
1055342694 9:75301878-75301900 AGGTATCTATATAGGAAGAGAGG - Intergenic
1055875298 9:80934852-80934874 AATTAACTATAAAGAATGAGTGG - Intergenic
1057004945 9:91548846-91548868 AATTATCTGCAGAGGATGAGAGG + Intergenic
1058200308 9:102029901-102029923 GGTTACCTGTAGGGGATGAGGGG - Intergenic
1059893366 9:118831640-118831662 AGTTATCTGTGCAGGATGACAGG - Intergenic
1060683097 9:125583231-125583253 AGTCATGTAGAGAGGTTGAGAGG - Intronic
1188047593 X:25445367-25445389 AGTTTTCTATAGATAGTGAGAGG + Intergenic
1188633215 X:32394623-32394645 AGGTATCTGCTGAGGATGAGAGG + Intronic
1189219798 X:39361826-39361848 AGTCATCTGGAGAGGCTGAGAGG + Intergenic
1189346541 X:40246096-40246118 AATTATCTATAGAGAATGCGTGG - Intergenic
1189640236 X:43061138-43061160 AGTGATTTCTAGAGGAAGAGGGG + Intergenic
1190751970 X:53369938-53369960 AGGTATCAATAGAGAGTGAGTGG + Intergenic
1190754083 X:53385719-53385741 GGTTATCTATCGAGAAAGAGAGG + Intronic
1190996751 X:55617499-55617521 AGTTATCTACAGAAGATGGCAGG + Intergenic
1191911405 X:66155347-66155369 AGTTCTCATTAGAGTATGAGAGG + Intergenic
1191941263 X:66483896-66483918 AGTTATCTGCAGAAGATGACAGG + Intergenic
1192531689 X:71893168-71893190 AGTTATCTGCAGAGGATGGTAGG + Intergenic
1193832946 X:86310065-86310087 AGTTATCTGCAGAAGATGACAGG - Intronic
1193901197 X:87180020-87180042 AGTTTTCTATAGAAGATAGGAGG - Intergenic
1194513420 X:94822284-94822306 AGTTATCTGCAGAAGATGACAGG + Intergenic
1195886097 X:109639196-109639218 ATTTATATTGAGAGGATGAGAGG + Intronic
1197002284 X:121452889-121452911 AGTTATCTGCAGAAGATGACAGG - Intergenic
1197591864 X:128419355-128419377 AGTTATCTGCAGAAGATGACTGG - Intergenic
1198169999 X:134096222-134096244 AGTTATCTGTGGAGGATGGCAGG - Intergenic
1198761184 X:140033985-140034007 AGGTAACCATGGAGGATGAGAGG + Intergenic
1199008504 X:142730855-142730877 AGTTATCTCCAGAGGATGGCAGG - Intergenic
1200340497 X:155390672-155390694 AGTTATCTGCAGAAGATGACAGG + Intergenic
1200501688 Y:3957896-3957918 AGTCATCTTCAGAGGATGACAGG + Intergenic
1201392221 Y:13511248-13511270 AGTTATGTATATGGGAAGAGAGG - Intergenic