ID: 1156367978

View in Genome Browser
Species Human (GRCh38)
Location 18:36447152-36447174
Sequence CCTCCAGGAAGAGTTGAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156367971_1156367978 13 Left 1156367971 18:36447116-36447138 CCAGAGACAAGGGGTGCAGTATT No data
Right 1156367978 18:36447152-36447174 CCTCCAGGAAGAGTTGAGGGAGG No data
1156367973_1156367978 -10 Left 1156367973 18:36447139-36447161 CCTCAAACCACAACCTCCAGGAA No data
Right 1156367978 18:36447152-36447174 CCTCCAGGAAGAGTTGAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156367978 Original CRISPR CCTCCAGGAAGAGTTGAGGG AGG Intronic