ID: 1156368573

View in Genome Browser
Species Human (GRCh38)
Location 18:36451950-36451972
Sequence GAAAAAAAGGAGCCACATGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 350
Summary {0: 1, 1: 0, 2: 0, 3: 28, 4: 321}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156368573 Original CRISPR GAAAAAAAGGAGCCACATGC AGG (reversed) Intronic
901043878 1:6383694-6383716 AAAAAAAATTAGCCAGATGCAGG - Intronic
901272723 1:7965452-7965474 GAAACAAAGAAGCCATATGAAGG - Intronic
901631521 1:10650460-10650482 GAAAAAAAGGTGTCAGAGGCTGG + Intronic
901943795 1:12684548-12684570 GAAAGTACTGAGCCACATGCTGG + Intergenic
902910168 1:19590038-19590060 AAAAAAAAGAAGCCTCAAGCTGG + Intergenic
905015607 1:34776584-34776606 GAAAGAAATGAGGCAGATGCTGG + Intronic
905127055 1:35723055-35723077 GAAAAAAAAGCTCCAAATGCAGG + Intronic
905477560 1:38239566-38239588 GGAGAACAGGAGCCAGATGCAGG - Intergenic
905832035 1:41077354-41077376 GAGAAAAACTGGCCACATGCAGG - Intronic
907184050 1:52595552-52595574 GAAAAAGAGTAGCCACAGGAAGG - Intergenic
908800287 1:67872861-67872883 GAAAAAAAGGAAGTAAATGCAGG + Intergenic
909294348 1:73927890-73927912 GAGAACAAGGAGACACATGGTGG - Intergenic
909350807 1:74651319-74651341 GAAACCAAGGTGCCACATGAGGG + Intronic
911416289 1:97578807-97578829 GAAATATAGGAACCACATGATGG + Intronic
913512396 1:119573735-119573757 GAGAAAAGGGAACCACATTCTGG + Intergenic
913516673 1:119611244-119611266 GAGAAAAGGGAACCACATTCTGG + Intergenic
914013589 1:143797402-143797424 AAAAAAAAGTAGCCACACACTGG - Intergenic
914520611 1:148412117-148412139 GAAGAAATGGAACTACATGCAGG - Intergenic
914652213 1:149706011-149706033 AAAAAAAAGTAGCCACACACTGG - Intergenic
914909701 1:151774824-151774846 GGAAAAAAGGAGGAACATGTTGG + Intronic
915155878 1:153875699-153875721 AAAAAAAGGTAGCCACAAGCTGG + Intronic
917382566 1:174429790-174429812 GAAACAAAGGAGACACATAGAGG + Intronic
917438899 1:175048749-175048771 GACAAGTAGGAGCCAGATGCTGG - Intergenic
917720279 1:177780385-177780407 GAAAAGATGGAGACACATGATGG + Intergenic
918472188 1:184885770-184885792 GAAAAGAAGCAGCCATAGGCTGG - Intronic
923836896 1:237621447-237621469 GAAAAAATGGATCCAAAAGCTGG + Intronic
923839384 1:237651739-237651761 GAAAAAAAAGGACCACAGGCCGG + Intronic
923859899 1:237883325-237883347 GAAACAAAGGACACACCTGCAGG + Intronic
923939868 1:238809766-238809788 AAAAAAAAGGAACCACTTGGAGG + Intergenic
1064440189 10:15346446-15346468 GAAGAGATGGAGCCACAGGCAGG + Intronic
1064617913 10:17181866-17181888 GAAAAGGAGGGGCCAGATGCTGG - Intronic
1065301042 10:24321540-24321562 AAAAAAAAGGAGCCAAAGGATGG + Intronic
1065887726 10:30093623-30093645 AATAAAAAAGAGCCACATGCGGG - Intronic
1066532313 10:36354253-36354275 GTAAAAAAAGAGCCCCATGGGGG - Intergenic
1066796811 10:39131392-39131414 GAAATAAAGGAGCCAATTGGGGG + Intergenic
1067359114 10:45560655-45560677 GAAAAAATGCACTCACATGCAGG - Intronic
1068161213 10:53267098-53267120 GAAAAAGAGCAACCACATGAAGG + Intergenic
1068684715 10:59858164-59858186 GAAAAAATAAAGGCACATGCAGG - Intronic
1069381129 10:67843946-67843968 AAAAGAAAGGAGCAACATGCCGG - Intergenic
1073025911 10:100487220-100487242 GAAACAAAAGACCCACATGATGG + Exonic
1073875518 10:107917445-107917467 GAAAAAAATTAGCAAAATGCAGG + Intergenic
1074912572 10:117924793-117924815 GAAGAAAAGCCACCACATGCTGG - Intergenic
1077763639 11:5133071-5133093 TAAAGAAAGGATCCACAGGCCGG + Intergenic
1082645741 11:55722044-55722066 GAAAAAAAAGAGAAAAATGCTGG - Intergenic
1083228079 11:61297014-61297036 GCAAAAATGTAGCCACAAGCCGG - Intergenic
1085637027 11:78166820-78166842 GAGAAAAAGGAGTGACATGTAGG + Intergenic
1086620094 11:88877358-88877380 GAAAAAAAGAAACTAAATGCTGG + Intronic
1088500434 11:110477551-110477573 GGAAAAAAGGAGCCAAATGGGGG + Intergenic
1088875639 11:113933954-113933976 GAAAAATAGAAACCACAGGCAGG + Intronic
1089743875 11:120603629-120603651 GAAAATAAAGAAACACATGCCGG + Intronic
1091033728 11:132214456-132214478 GACAAAAAGGAGACGCATGCAGG - Intronic
1093482139 12:19615101-19615123 GAAAGAAATGAACCATATGCAGG + Intronic
1093703997 12:22254696-22254718 GAAAAACAGGAGGCCCCTGCGGG - Intronic
1095525930 12:43125573-43125595 GAAATAATGGAGGCAGATGCAGG - Intergenic
1095711670 12:45295517-45295539 GAGTAAAAGCAGCCACATACAGG - Intronic
1096446680 12:51699318-51699340 GGAAGAAAGGAGCCACATGTTGG + Intronic
1097483549 12:60163732-60163754 AAAAAAAAGGAACAACATGAAGG + Intergenic
1099294194 12:80809260-80809282 GAAAAGAAGAAGCTACAGGCTGG - Intronic
1100204493 12:92333449-92333471 GATAAAAAGGAGCAAAATGAGGG - Intergenic
1101469345 12:104982009-104982031 GATAAAATGGAGCCATAGGCCGG - Intergenic
1102090258 12:110181085-110181107 GAAAAAAAAAAGCCAAATGAAGG - Intronic
1103200037 12:119080580-119080602 GGGAAGAAGGAGCCACATGGTGG - Intronic
1104191395 12:126485240-126485262 GGTAAAAATGAGCCACATGAGGG - Intergenic
1104650030 12:130524847-130524869 GAAAAGAAGGTGCCACATTCTGG + Intronic
1105430848 13:20336091-20336113 AAAAATAAGGAGCCACAGGCAGG - Intergenic
1106973921 13:35182562-35182584 GAAAAAAAGGAGATACATCATGG - Intronic
1107104994 13:36633533-36633555 GAAAAAAAGGAGGCCAATGATGG + Intergenic
1107149290 13:37092942-37092964 GAAGAAAAGGAGCCCCATTATGG - Intergenic
1107566060 13:41605902-41605924 GATAAAAAGGAGCAGCATACTGG - Intronic
1108857147 13:54808214-54808236 GAAAAAGAGGAAGCAGATGCAGG + Intergenic
1110320555 13:74155657-74155679 TAAAAATAGGAGCTACAGGCTGG - Intergenic
1110494812 13:76155071-76155093 TAAAAAAAGAAGCCAGGTGCTGG - Intergenic
1111197239 13:84891216-84891238 AAAAAAAAATAGCCTCATGCAGG + Intergenic
1111462051 13:88558258-88558280 GAAGAACTGTAGCCACATGCAGG + Intergenic
1111607048 13:90552949-90552971 GAAAAAAAGTAGAGAAATGCTGG - Intergenic
1111781352 13:92729813-92729835 GAAAACAAGGTGCCACACACTGG - Intronic
1112809762 13:103204084-103204106 GTTAAAAGGTAGCCACATGCTGG + Intergenic
1113518112 13:110918672-110918694 AAAAAAAAAAATCCACATGCAGG - Intergenic
1113616749 13:111685681-111685703 GAAAAAAAGGTGGCAGCTGCCGG - Intergenic
1113622279 13:111770952-111770974 GAAAAAAAGGTGGCAGCTGCCGG - Intergenic
1117501621 14:56358059-56358081 GGAAAAGAGGAGCCACAGCCAGG - Intergenic
1118484319 14:66199575-66199597 GAAAAAAAAAACCCACATGTAGG - Intergenic
1118544746 14:66873741-66873763 GAAAGACAGGAGCCCCAGGCAGG + Intronic
1119214687 14:72859701-72859723 GCAAATACGGAGCCAGATGCTGG + Intronic
1119621776 14:76136955-76136977 GAGAGAAAGGAGCGAGATGCAGG + Intergenic
1120407259 14:84104683-84104705 GAAAAAAGGGAGCGAGGTGCTGG - Intergenic
1120447624 14:84620725-84620747 GAAAAGAAAAAGACACATGCTGG - Intergenic
1120869259 14:89322552-89322574 GAAAAGAGGGAGCAACATGGTGG + Intronic
1121487194 14:94326246-94326268 TAAAAAAAGAAGGCACAGGCCGG - Intergenic
1121776148 14:96592528-96592550 GAGAAAACGGAGGCACCTGCAGG + Intergenic
1122421949 14:101583242-101583264 GAAAACAAGAAGCCACAGGTAGG - Intergenic
1123020209 14:105394428-105394450 GATGAGAAGGAGCCCCATGCTGG - Intronic
1123537410 15:21248513-21248535 TAAAAAAAACAGCAACATGCTGG + Intergenic
1123674709 15:22698955-22698977 GAATAAAATCAGCCATATGCAGG + Intergenic
1124326721 15:28771937-28771959 GAATAAAATCAGCCATATGCAGG + Intergenic
1126309409 15:47298789-47298811 GAAAAGTAGTAGCAACATGCTGG - Intronic
1126551442 15:49935121-49935143 GTAAAATTGGAGCCACATGTAGG + Intronic
1126667394 15:51087636-51087658 GAAAAAAAGGAGACACTTGGTGG - Intronic
1127599149 15:60517944-60517966 GAAAGAAAGGTGACAGATGCTGG - Intronic
1132713870 16:1280971-1280993 GAAAAAAAGTTGCAACATTCTGG + Intergenic
1135247629 16:20870574-20870596 AAAAAACAGGAGGCAAATGCTGG + Intronic
1135877335 16:26215117-26215139 GAATAAAAGGAGCCGCCTCCAGG - Intergenic
1138209521 16:55151776-55151798 TAGAGAAAGGAGCCACATGCTGG + Intergenic
1138343743 16:56307379-56307401 CACAAAAAGGAGAGACATGCAGG - Intronic
1139831287 16:69800419-69800441 GGAAAAAAGGACCCTCATGCTGG - Intronic
1140113994 16:72026095-72026117 GGGCAAAAGGAACCACATGCTGG + Intronic
1140766414 16:78163536-78163558 GGAAAAAAGCTGCCAAATGCTGG + Intronic
1142209769 16:88803542-88803564 GAAAAGTGGGAGCCACACGCGGG + Exonic
1142932118 17:3294359-3294381 GAAAAAAATTAGACAGATGCAGG + Intergenic
1143351842 17:6294418-6294440 TAAAAAAAGGAAACACATGTTGG + Intergenic
1145278837 17:21454092-21454114 GAGTGGAAGGAGCCACATGCAGG + Intergenic
1145399024 17:22516398-22516420 GAGTGAAAGGAGTCACATGCTGG - Intergenic
1146301276 17:31691651-31691673 GACAGGAAGGAGCCACAGGCAGG - Intergenic
1146950242 17:36900414-36900436 GAAAAAAAGAAGCAACATTTCGG + Intergenic
1147050290 17:37789444-37789466 TAAAAAAAGGACCCAGAGGCTGG - Intergenic
1148209402 17:45799152-45799174 GAGAAAAAGGTGCCCCATGAGGG + Intronic
1149032419 17:52099158-52099180 GAAAAAAAAGGGTCACAGGCAGG + Intronic
1149179801 17:53921803-53921825 GGTAAATAGGAGCCACATCCTGG + Intergenic
1150099159 17:62406944-62406966 GCAAAACAGGCACCACATGCTGG + Intronic
1150889530 17:69131502-69131524 TAGAAAAAGGAACCACTTGCAGG + Intronic
1152057986 17:78046525-78046547 TAAAAAAACAAGCCACAGGCAGG - Intronic
1152375923 17:79919028-79919050 GAAGCCAGGGAGCCACATGCTGG - Intergenic
1152501508 17:80713392-80713414 GAAAACAAGCAGCCACAAACTGG - Intronic
1153143630 18:2002899-2002921 GAAAGAAAGAAGCAACATGGAGG + Intergenic
1153927714 18:9849082-9849104 GAAGAGAATTAGCCACATGCAGG - Intronic
1154038193 18:10827487-10827509 GAAAAAAAGGAGGCAAATGTTGG - Intronic
1155780254 18:29822944-29822966 GAAAATAAGTAGACACATCCTGG - Intergenic
1156196134 18:34776193-34776215 GAGAAAAAGGAACCAAAGGCAGG + Intronic
1156307788 18:35894854-35894876 GAAAAAAACAAGCCACAGACTGG + Intergenic
1156368573 18:36451950-36451972 GAAAAAAAGGAGCCACATGCAGG - Intronic
1156722754 18:40090221-40090243 GAAAAAAAAAACCCACATGTTGG + Intergenic
1156804131 18:41156093-41156115 GAAAAAAAGGAGTGACATTATGG + Intergenic
1156869582 18:41930117-41930139 GAAAAAAAGGAAAAACATTCTGG + Intergenic
1156914055 18:42444661-42444683 GAAATAAATGAGCTACATGTTGG + Intergenic
1157162729 18:45329076-45329098 GAAAAAAAGGAGACAAGTGAGGG + Intronic
1157190884 18:45580704-45580726 GAAAAAATGGAGGCACAGGGAGG + Intronic
1157490922 18:48123261-48123283 GAGAAAAATGAGTCACATCCAGG + Intronic
1157556507 18:48616249-48616271 GCTGAAAAGGAGCCACCTGCAGG - Intronic
1159578256 18:70205904-70205926 GAAAAAAAAAAGCAACAAGCAGG + Exonic
1159774454 18:72586725-72586747 GAGAAAAAGGAGCCATATATTGG + Intronic
1161030873 19:2057146-2057168 AAAAAAAAGAAGCCACCTGCTGG - Intergenic
1161490611 19:4559199-4559221 AAAAAAAAAAAGCCACAAGCTGG + Intronic
1162442809 19:10703512-10703534 TAAGAAAAGAAGCCACGTGCTGG + Intronic
1163724548 19:18915221-18915243 GAAAAAAAAGAGACAAAAGCTGG + Intronic
1164694908 19:30236112-30236134 GAAGAAAAGCGGCCACATGCCGG + Intronic
1164835713 19:31353925-31353947 GAAAGAAAAAAGTCACATGCAGG + Intergenic
1166250122 19:41564139-41564161 GAAAAAAAGAACCCACAGACAGG + Intronic
1166275430 19:41750365-41750387 GAGAAACAGGAGCCACAGGAGGG - Intronic
1166280455 19:41789162-41789184 GAGAAACAGGAGCCACAGGAGGG - Intergenic
1166396286 19:42443618-42443640 GAGAAACAGGAGCCACAGGAGGG + Intergenic
1168165132 19:54541999-54542021 AAAAAAAAGGAGAGACATGGAGG - Intronic
927768502 2:25836241-25836263 GAAAAAGAGGAGGAAGATGCAGG + Intronic
927982580 2:27383609-27383631 GAAGAAAAGGAGCATCATGGGGG + Intronic
928216049 2:29362191-29362213 ACAAAAAAGGAGCCAAATACAGG + Intronic
928523214 2:32112335-32112357 AAAAAAAAAAAGCCACATTCAGG - Intronic
928612423 2:33003608-33003630 GAAGAAAAGAAGTCACAGGCAGG + Intronic
929206945 2:39306744-39306766 GAAGAAAAGGGACCAGATGCTGG - Intronic
930886999 2:56337507-56337529 GAAAGAAAGGAATCACATGACGG - Intronic
931258264 2:60594259-60594281 GAAAAGAAGGAACTACATGGAGG - Intergenic
932499324 2:72168949-72168971 GAAAAAAATGAGGGACATGGGGG - Intergenic
933651161 2:84851346-84851368 GAAAAAAATGAGCCACCAGTGGG + Intronic
936252984 2:110882404-110882426 CAAAAAGACAAGCCACATGCTGG - Intronic
937227404 2:120377663-120377685 CAAAGAGAGGAGCCAGATGCAGG - Intergenic
937272761 2:120664047-120664069 GGACAAAAGCAACCACATGCAGG - Intergenic
937301420 2:120844974-120844996 GAAAAAAAGGAGAAAGAAGCTGG + Intronic
939786854 2:146525121-146525143 TAAATAAATAAGCCACATGCAGG + Intergenic
940153206 2:150625596-150625618 GAACAATAGTAGTCACATGCTGG - Intergenic
940467858 2:154055282-154055304 GAAAAAAAAGAACTACATGTTGG - Intronic
940713836 2:157195617-157195639 GAAAAAAAGAAGACACATGGTGG + Intergenic
942675419 2:178421641-178421663 CAAAAAGAGGAGTCACATCCTGG - Intergenic
943988219 2:194651348-194651370 AAAAAAAATAAGCCACAAGCAGG + Intergenic
948374302 2:237511253-237511275 AAAAAAAAGCAGCCAGAAGCAGG - Intronic
948450953 2:238071138-238071160 GAAAAAAAGGTACCAGAGGCTGG - Intronic
949021877 2:241745377-241745399 GCAAGAAAGGAGCCGCAGGCAGG - Intronic
1169816838 20:9665826-9665848 GAAAAATAGGGGCCAAGTGCAGG - Intronic
1174249922 20:49211491-49211513 GAAAAAAAGGAGGCTGAGGCAGG - Intergenic
1174755947 20:53158606-53158628 TAAAAACAGGAGCCACTTTCTGG - Intronic
1174890068 20:54382438-54382460 GAGAAAGAGGAGCCTCATTCAGG - Intergenic
1176022074 20:62967061-62967083 GGAAAATGGGAGCCACAGGCCGG - Intronic
1176364813 21:6026424-6026446 GAAGAAAAGTAGAAACATGCAGG - Intergenic
1177291185 21:19114034-19114056 GCAAAACAGGAGCCATATGGGGG + Intergenic
1179758705 21:43512121-43512143 GAAGAAAAGTAGAAACATGCAGG + Intergenic
1181867000 22:25866450-25866472 GAGGAAAAGCAGCCCCATGCAGG - Intronic
1182004426 22:26947597-26947619 GGAAGAAAGGAGACACATGCTGG + Intergenic
1182474468 22:30569088-30569110 AAAAAAAAAGAGGGACATGCAGG + Intronic
1182838348 22:33363067-33363089 GAAAAGCGGGAGCCCCATGCTGG - Intronic
1183033344 22:35121806-35121828 AAAAAAAAAGAGGCACATGTGGG - Intergenic
1183664942 22:39241855-39241877 GAAAAAAAGGAGTCACAGATGGG + Intronic
1183777887 22:39979636-39979658 GAAAGAAATGTGCCAGATGCTGG + Intergenic
949284310 3:2383246-2383268 TATAAAAAGGATTCACATGCTGG - Intronic
949458275 3:4262565-4262587 GTAAGAATGGAGCCACATGGGGG - Intronic
950519139 3:13485932-13485954 GAACAAAAGGAGAAACATGATGG + Intronic
951272222 3:20640164-20640186 AAAATAAAGGAGCCACATTTGGG + Intergenic
952334908 3:32395296-32395318 TAAAAAAAAGAGTCTCATGCAGG - Intronic
953189531 3:40670558-40670580 AAAAAAAACAAGCCACAGGCTGG + Intergenic
953608190 3:44425494-44425516 GAAAAAAAAGATGCACATGAGGG - Intergenic
953666971 3:44932378-44932400 AAAAAAAAGGAGGCCCATGGAGG + Intronic
954186276 3:48919174-48919196 GAAAAAAGGCAGACACACGCTGG - Exonic
954607318 3:51922692-51922714 GAAAAAAAAGACCAAAATGCTGG + Intergenic
955027798 3:55187276-55187298 TAAAGAAAGGAGCCACATTTAGG - Intergenic
955296794 3:57742933-57742955 GAAAAAATGGAGACACATGAGGG + Intergenic
956067413 3:65411832-65411854 GAGAAAAAGAAGCCTCAGGCAGG - Intronic
956501212 3:69887444-69887466 CAATAAAAGGAGACACATTCAGG - Intronic
957931032 3:86878592-86878614 GAATAAAAGGAGACAGATCCAGG + Intergenic
958724793 3:97891698-97891720 GAAAAAAAGAAGCCAGAAGGAGG + Intronic
958905454 3:99937088-99937110 CAAAAAAATTAGCCACATGATGG - Intronic
959865118 3:111258429-111258451 GAAAAAAAGAAGCCACAGGTTGG - Intronic
959926430 3:111926523-111926545 GAAAAAAAATAGCCTCAAGCTGG - Intronic
960611997 3:119563137-119563159 AAAAAAAAAGAGTCACAGGCAGG - Intergenic
961080327 3:124021416-124021438 GGAAAACAGGTGCCAAATGCTGG + Intergenic
961189511 3:124946234-124946256 TAAAGAAAGGAGCCTCATGAGGG - Intronic
962658703 3:137578195-137578217 GAAAATGAGAAGCCACATACTGG + Intergenic
963928837 3:150980594-150980616 GAAAAAAACAAGCCACAGACTGG + Intergenic
964052421 3:152411790-152411812 GAAAAAAAGGAAACAGAAGCAGG - Intronic
964196387 3:154069544-154069566 GAAAAAAAGAAAACACATCCTGG + Intergenic
965091098 3:164163471-164163493 GCAGAAAAGGAGCTACCTGCAGG - Intergenic
966202394 3:177370574-177370596 GAAGAAAATGAGACAGATGCAGG - Intergenic
966242622 3:177771521-177771543 GCAAAAGAGGACCCACAGGCTGG - Intergenic
967109111 3:186277709-186277731 GAAAGGAAAGAGCCACATGATGG - Intronic
968788862 4:2645454-2645476 GAAACAAAAGACACACATGCAGG - Intronic
968790197 4:2655024-2655046 CAAAAAAAGGGGACAAATGCTGG - Intronic
969687746 4:8685582-8685604 GCACAAAAGCAGCCACATGCCGG + Intergenic
970644683 4:18106812-18106834 GAAAAAAAGAAACGACCTGCTGG + Intergenic
971792220 4:31184395-31184417 AAAACAAAGGTGCCACATGGTGG + Intergenic
972765447 4:42149727-42149749 GAAAAAAAAAACCCACATGAAGG + Intronic
973075789 4:45924200-45924222 GAGCAAAAGGAGCCAGAGGCAGG - Intergenic
974136583 4:57825828-57825850 GAAAAAAAGCAGCCCCATAGTGG + Intergenic
975929136 4:79496865-79496887 GAAAAAAAGGAGATAGATTCAGG + Intergenic
977415419 4:96726484-96726506 AAATTAAAGGAGTCACATGCTGG + Intergenic
978868686 4:113547911-113547933 GAACAAATGGACCCACATTCTGG - Intronic
980042845 4:127959369-127959391 AAAAACCAGGAGCCATATGCAGG - Intronic
983236235 4:165182949-165182971 GTTGAAAAGGAGCCACATGTAGG - Intronic
983937195 4:173510188-173510210 GAATAAATGGAGCCAGATCCTGG - Intergenic
984490508 4:180429421-180429443 AAAACAAAAGAGCCACAGGCAGG - Intergenic
984738867 4:183139443-183139465 GAAAAGAAAGAGCCAAATGTGGG - Intronic
985371551 4:189290461-189290483 GAAAGAAAGGAGCCCGAAGCTGG + Intergenic
985687973 5:1292134-1292156 GAAAAAAAAGAGCCCCAAGAAGG + Intronic
986124195 5:4870035-4870057 GCAAAAGAGAAGCCACGTGCAGG + Intergenic
986677180 5:10196242-10196264 GAACAAGAGGAGCCACACCCAGG - Intergenic
987205896 5:15625355-15625377 AAAAAAACTGAGCCACAGGCTGG + Intronic
987257836 5:16175023-16175045 GAAAAGCAGCAGCCACATGGAGG + Intronic
987758760 5:22131600-22131622 GAGAGAAAAGAGCCACATTCAGG - Intronic
988450347 5:31336125-31336147 TCAAAAGAGGACCCACATGCAGG - Intergenic
988487730 5:31680596-31680618 CAGAAACGGGAGCCACATGCAGG - Intronic
988723278 5:33900497-33900519 GAGAAAAAGGAGCCAATGGCCGG + Intergenic
989507386 5:42243216-42243238 GAAAAAAAGGAGCCAAACCCAGG + Intergenic
990939919 5:61191475-61191497 GAAGAAATGGAGGCACATCCGGG + Intergenic
991008242 5:61853560-61853582 GAAAAACATGAGGCACATGGTGG + Intergenic
991893462 5:71365038-71365060 GAGAGAAAAGAGCCACATTCAGG - Intergenic
992398301 5:76387590-76387612 GAAGAAGAAGAGCCTCATGCTGG - Intergenic
993371246 5:87095289-87095311 GAAAACTAGAAGCCACATGAAGG + Intergenic
994088401 5:95785073-95785095 GCTAAAATGGAGCCACATGATGG + Intronic
995422006 5:111978259-111978281 GAAGAAAAGGACACAGATGCTGG - Intronic
995478708 5:112573746-112573768 GAGAAAAAAGAGACACTTGCAGG - Intergenic
997429944 5:133830625-133830647 GAAAAAACCGAGCCTCAGGCAGG + Intergenic
998192740 5:140041757-140041779 AAAAAACTGGAGCCACATGGAGG + Intronic
998719231 5:144924795-144924817 GAAAAAAAAGAGAAACTTGCAGG + Intergenic
1000185734 5:158856055-158856077 GAAAAGAAGAAGCTACAGGCAGG + Intronic
1000967785 5:167680250-167680272 GAAAAAAAATAGCCACAAGTAGG + Intronic
1003151336 6:3552769-3552791 TAAAAAGACAAGCCACATGCTGG - Intergenic
1006319069 6:33309096-33309118 AAAAAAAAAGATCCACAGGCTGG + Intronic
1007398783 6:41591932-41591954 GAAAAATGGGAGACAGATGCTGG + Intronic
1011253026 6:85393060-85393082 GAGAGAAAGGAGCAACATTCAGG + Intergenic
1012197017 6:96355509-96355531 GAAAAAAAGGAGCAAAATAATGG - Intergenic
1012463952 6:99496281-99496303 AAAAAAAAGGTGATACATGCTGG - Intronic
1014223510 6:118822776-118822798 GAAAGAAAGGAGCCCCAGTCAGG - Intronic
1014917497 6:127169197-127169219 GAAAAAAAAAACCCAGATGCTGG - Intronic
1015393752 6:132712657-132712679 GAAAAAGAGGAGCCACAAACTGG + Intronic
1017216977 6:151919835-151919857 GAAGAAAAGAAGACACATGAAGG + Intronic
1018694190 6:166377928-166377950 GAGAAAAGGGAGACATATGCAGG + Intronic
1019136201 6:169909581-169909603 CAAAACAAGGGTCCACATGCAGG - Intergenic
1020415200 7:7937684-7937706 GAAAAAGATGAGCCACAAACTGG + Intronic
1021355556 7:19650465-19650487 TGAAAAAAGGAGCCAAATCCTGG + Intergenic
1021821165 7:24498814-24498836 GAAAAGAAGGAACAACAAGCTGG + Intergenic
1023249118 7:38238562-38238584 GAAAAAAATAAGCCAAAAGCTGG + Intergenic
1023637518 7:42227557-42227579 GAAAGAAAAGACCCACCTGCAGG - Intronic
1023776622 7:43613885-43613907 CAAAAAAAGTAGCCAGAAGCTGG + Intronic
1025112598 7:56231866-56231888 AAAAAAAAGGAACAACATACTGG - Intergenic
1025955620 7:66180639-66180661 GAAAAAAAGTAGCCAGGTGCAGG - Intergenic
1027240911 7:76328096-76328118 AAAAAAAAGAATGCACATGCGGG + Exonic
1028266898 7:88736843-88736865 GAAAGAAAGGGGACAAATGCGGG + Intergenic
1028862822 7:95672848-95672870 GAAAAAAAAGAGAAACATGCAGG + Intergenic
1030015909 7:105220804-105220826 GAAACAAATGAGACACATCCTGG - Intronic
1031642272 7:124179965-124179987 GGTAAAAAGGAGCAATATGCAGG + Intergenic
1032805121 7:135346431-135346453 GGAAAAAAGGAGCCATAAGTGGG - Intergenic
1033087686 7:138357412-138357434 CAAAAAAAGCAGACACAGGCAGG - Intergenic
1036496959 8:9278381-9278403 GAAGAAATGGAGGCACAGGCGGG - Intergenic
1037732541 8:21540080-21540102 GAAAAAGAGAAGCTACAGGCTGG - Intergenic
1037814544 8:22104986-22105008 GAGGAAAAGGAGCCAGATGTTGG + Intergenic
1038580064 8:28740250-28740272 AAAAACGAGGAGCCACAGGCAGG - Intronic
1038913370 8:31992474-31992496 TAAAACTAGGAGCCAAATGCAGG + Intronic
1039593807 8:38772535-38772557 GAAGAGAAGGAGGCACATGTGGG + Intronic
1040292254 8:46131515-46131537 GCAAAAAAGGAGCCACAGGGTGG - Intergenic
1040303796 8:46201775-46201797 GCAAAAATGGAGCCACAGGGTGG + Intergenic
1040316337 8:46262853-46262875 GATAAAAAGGGGCCACAGGGTGG + Intergenic
1041165018 8:55083070-55083092 GAAAAAATGAAGACACATGCTGG + Intergenic
1042697183 8:71568058-71568080 GGAAAAAAGAAGCCACTTTCAGG + Intronic
1043286823 8:78542580-78542602 GAAAAAAAGCAAACATATGCTGG - Intronic
1043320019 8:78972882-78972904 GAAGAAAAGGAGGAAAATGCTGG + Intergenic
1043551577 8:81379049-81379071 AAAAATCAGGTGCCACATGCAGG + Intergenic
1044898225 8:96915809-96915831 GAAAAAGAGGAGGCAGATTCTGG - Intronic
1045228573 8:100276744-100276766 GAAAAAAAGGAGTAAAATGAGGG + Intronic
1045387659 8:101687066-101687088 AAGAAAAGTGAGCCACATGCAGG - Exonic
1046418270 8:113943655-113943677 GAAAAAAAGAACCCACTTCCAGG + Intergenic
1046800959 8:118426007-118426029 GAAAAAAAGGAGACAGAAGGAGG + Intronic
1047313000 8:123708198-123708220 GAAAAGAAGGAGCCACACACTGG + Intronic
1048259132 8:132930864-132930886 GAAAAAAGAGAGCCACATCAAGG + Intronic
1049652011 8:143774255-143774277 GAAGAAAAGAAGCCACAGGCAGG + Intergenic
1050292642 9:4172133-4172155 GAAAAAAATGAATCACATTCAGG + Intronic
1050553277 9:6766891-6766913 GTAAAAAGGGAGCCAAATGAAGG - Intronic
1052978582 9:34430375-34430397 CAAAAAAAGAAAACACATGCTGG + Intronic
1053263058 9:36687606-36687628 CACAAAAAGAAGCCACAGGCTGG - Intergenic
1054821763 9:69529238-69529260 GATTAAAAGCAGCCACATTCAGG + Intronic
1055583267 9:77730457-77730479 GAAAAAAAGAAGACATATTCAGG - Intronic
1055815575 9:80201076-80201098 GAAAGAAAGGTGACACAGGCTGG + Intergenic
1056429494 9:86513363-86513385 GAGGAAAAGGAACCAAATGCTGG - Intergenic
1056662491 9:88554760-88554782 GAAAAAGAGGAGCCTCATTCAGG - Intronic
1057254547 9:93534381-93534403 GAAGAAAAGGAGCCACAGGATGG - Intronic
1057315596 9:93966456-93966478 GAGAACAAGGGGCCACATTCTGG + Intergenic
1058286153 9:103181552-103181574 CAAAACAAGCAGCCACATGAAGG - Intergenic
1058553879 9:106145180-106145202 TAAAAAAATGAGGCACAGGCAGG + Intergenic
1059940052 9:119349942-119349964 GAGAAAAAGGAAGCAAATGCTGG - Intronic
1060322290 9:122573680-122573702 TAAAAAAATAAGCCACATACTGG - Intergenic
1185585568 X:1240063-1240085 GAAAAAAAAGAGCCAAACTCTGG + Intergenic
1185749703 X:2600956-2600978 GAAAAACAGGAGCAACACGGGGG - Intergenic
1186160289 X:6770261-6770283 GAAGAAAAGCAGCCACAGACAGG - Intergenic
1186560274 X:10604373-10604395 GAAAATAATGAGCCACAGGGAGG + Intronic
1187083659 X:16019184-16019206 GAAGAAAAGCAGCCAAATGATGG - Intergenic
1187095495 X:16143430-16143452 GAAGAAAAGGAGCCAAAAGATGG + Intronic
1187163175 X:16783062-16783084 GAATAAATGGAGCCATATTCAGG + Intergenic
1187590769 X:20714636-20714658 GCAACAAAAGAGCCACATCCTGG - Intergenic
1187621816 X:21063913-21063935 GATAAAAATGAGCCAGATGAGGG - Intergenic
1188606737 X:32040716-32040738 GGAAAAATGTAGCCACTTGCTGG - Intronic
1189116100 X:38344286-38344308 GAAAAAAAGGAGCCAGCTAATGG + Intronic
1189982671 X:46526918-46526940 GAAAAAAAGAAGCCATAATCTGG + Intronic
1190499959 X:51064979-51065001 GAAAAAAAGGAGGCACAAAGAGG - Intergenic
1194112613 X:89853967-89853989 GAAGGAAAGGAGCCAAATTCTGG + Intergenic
1194949318 X:100106060-100106082 GAAAAAAAGTATCCACATTAAGG - Intergenic
1194965579 X:100285103-100285125 GAAAAATAGGTGCGATATGCAGG - Intergenic
1195583842 X:106539622-106539644 GAAAAAAAGGAAACACAGGAAGG + Intergenic
1197071250 X:122300242-122300264 GAAAAAATGCAGCCCCATTCAGG - Intergenic
1197841487 X:130752226-130752248 AAAAAGAGGGAGTCACATGCAGG - Intronic
1200168047 X:154050814-154050836 GAGAAGCAGGAGCCACATGAGGG + Intronic
1200227541 X:154427212-154427234 GAATAAAAGCAGCCACAGGTGGG + Intergenic
1200687426 Y:6268801-6268823 GACAACAAGGAGGCACATTCAGG - Intergenic
1201047848 Y:9905909-9905931 GACAACAAGGAGGCACATTCAGG + Intergenic
1201440172 Y:14000147-14000169 GGAAAACAGAAGCCACATACTGG + Intergenic
1201444399 Y:14042561-14042583 GGAAAACAGAAGCCACATACTGG - Intergenic
1202073137 Y:21013457-21013479 GACAAAAGGGTGCCACATGAGGG - Intergenic
1202077837 Y:21055311-21055333 GACAAAAGGGTGCCACATGAGGG - Intergenic