ID: 1156369233

View in Genome Browser
Species Human (GRCh38)
Location 18:36457780-36457802
Sequence TAGCTCAGGATGTCACAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 214
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 199}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156369229_1156369233 1 Left 1156369229 18:36457756-36457778 CCCCAGAGCTTAGTAGAGTTCAC 0: 1
1: 0
2: 1
3: 8
4: 98
Right 1156369233 18:36457780-36457802 TAGCTCAGGATGTCACAGCCTGG 0: 1
1: 0
2: 1
3: 13
4: 199
1156369231_1156369233 -1 Left 1156369231 18:36457758-36457780 CCAGAGCTTAGTAGAGTTCACTT 0: 1
1: 0
2: 0
3: 5
4: 104
Right 1156369233 18:36457780-36457802 TAGCTCAGGATGTCACAGCCTGG 0: 1
1: 0
2: 1
3: 13
4: 199
1156369230_1156369233 0 Left 1156369230 18:36457757-36457779 CCCAGAGCTTAGTAGAGTTCACT 0: 1
1: 0
2: 0
3: 9
4: 103
Right 1156369233 18:36457780-36457802 TAGCTCAGGATGTCACAGCCTGG 0: 1
1: 0
2: 1
3: 13
4: 199

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156369233 Original CRISPR TAGCTCAGGATGTCACAGCC TGG Intronic
900679845 1:3910758-3910780 TTGCTCAGGATCACACAGCAAGG + Intergenic
900726524 1:4219897-4219919 TTGCTCTGGAGGTCACAGCATGG + Intergenic
901113070 1:6814946-6814968 TAGATCAGGATGTTACACACAGG - Intronic
901848596 1:12000664-12000686 AACCCCAGGATGTCAGAGCCAGG + Intronic
902384072 1:16066456-16066478 TAGCTCAGGGTCACACAGCAGGG - Intronic
902534642 1:17112483-17112505 AAGAGCAGGATGTCACACCCAGG - Intronic
902968643 1:20030647-20030669 TAGCTCAGGCTGTCTCAGTGGGG + Intronic
903300262 1:22373820-22373842 TGGCTAAGGATGTCAGAGCTGGG - Intergenic
903384528 1:22917693-22917715 TTGCTCAGGGTAACACAGCCAGG + Intergenic
903459868 1:23513344-23513366 TATCTCAGAATGTCAGAGCCTGG + Intronic
903828762 1:26162456-26162478 TTGCCCAGGATCACACAGCCGGG - Exonic
904381943 1:30117394-30117416 TTACTCAGGGTCTCACAGCCAGG + Intergenic
905206480 1:36345504-36345526 GAGCCTAGGATGACACAGCCTGG - Intronic
908480915 1:64538130-64538152 TTTTTCAGGCTGTCACAGCCAGG - Intronic
909942606 1:81627847-81627869 CAGCACAAGATGCCACAGCCTGG + Intronic
910081234 1:83344247-83344269 TTGCCCAGGATGTCACAGAATGG - Intergenic
911949826 1:104158262-104158284 TAGCTCAGGATGTCATAAATTGG + Intergenic
912418923 1:109530502-109530524 GAGCTCATTATGTCACAGCTGGG - Intergenic
915286677 1:154857678-154857700 TTGCTCAGGGTCTCACAGCTGGG - Intronic
917817993 1:178730149-178730171 GAGGTCAGGAGTTCACAGCCTGG - Intronic
918300779 1:183201694-183201716 GAGGTCAGGAGTTCACAGCCTGG + Intronic
920369967 1:205472755-205472777 TTGCTCTGGAGGTCACAGTCAGG + Intergenic
920722718 1:208402568-208402590 AAGATCAGGATCTCAGAGCCTGG - Intergenic
924811351 1:247405298-247405320 TATCACAGAATGGCACAGCCAGG + Intergenic
1072435047 10:95407138-95407160 CAGCTCAGGAGCTCACAGCCTGG + Intronic
1073469373 10:103713354-103713376 GACCTCAGAATGTCAGAGCCAGG + Intronic
1074159657 10:110827161-110827183 GAACTCAGGATTTCTCAGCCTGG + Intronic
1074765869 10:116699597-116699619 TAGGTCAGGATGCCACAGACGGG - Intronic
1075615619 10:123889195-123889217 CATCTCAGAAAGTCACAGCCTGG - Intronic
1077328914 11:1975452-1975474 TGGCTCAGGGTTTCCCAGCCTGG - Intronic
1077447050 11:2600264-2600286 TAGCTCAGCAGGTCACAACTGGG - Intronic
1079101623 11:17545371-17545393 TAGATCAAAATGTCACTGCCAGG - Intergenic
1079896279 11:26122485-26122507 TAGCACAGTCTGTCACAGCCTGG + Intergenic
1080750523 11:35146128-35146150 TACCTCAGGAGGACACACCCAGG - Intronic
1084209205 11:67613221-67613243 TGGCTCAGCATGTCAAGGCCAGG + Intergenic
1087212412 11:95457492-95457514 TGGCTCAGGAGGGGACAGCCAGG - Intergenic
1089067998 11:115676609-115676631 TGGGTCAGGCTGTCACAGGCAGG + Intergenic
1202811893 11_KI270721v1_random:30631-30653 TGGCTCAGGGTTTCCCAGCCTGG - Intergenic
1094622769 12:32096130-32096152 TAGCACAGTATTCCACAGCCTGG - Intergenic
1097160108 12:57040067-57040089 TACCTGAGAATGTCCCAGCCTGG - Intronic
1100850548 12:98705415-98705437 TAGCTCTGTATGTCCCAGCTTGG + Intronic
1101436366 12:104668101-104668123 TAGCTCAAGGTCACACAGCCAGG - Intronic
1101638052 12:106562844-106562866 GAGCTCAGGATGTTACAGTTTGG - Intronic
1102056653 12:109901238-109901260 TTGCTCAGGATCACAGAGCCAGG - Intronic
1103598471 12:122038747-122038769 TAGCCCAAGATCACACAGCCAGG - Intronic
1111136492 13:84052001-84052023 TAGCTCAGGATATAACAATCAGG - Intergenic
1111297386 13:86298980-86299002 TAACTCATGATGACACAACCTGG + Intergenic
1111654736 13:91138505-91138527 CAGCATAGGATGTCACAGGCTGG - Intergenic
1112291333 13:98145651-98145673 GAGATCAGGATTTCCCAGCCTGG + Intronic
1112999781 13:105620805-105620827 TATTTGAGGATGTCACAACCTGG + Intergenic
1113681099 13:112245658-112245680 GAGCTCTGGATCACACAGCCGGG + Intergenic
1114841000 14:26261634-26261656 TAGCTAAGGATATTACAGACAGG - Intergenic
1115776080 14:36716742-36716764 TAGCTCATGAGATCACAGGCAGG + Intronic
1117227979 14:53682845-53682867 TAGCCCAAGATGTCATAGCTCGG - Intergenic
1117434737 14:55705144-55705166 TAGCTAAGCTTGTCCCAGCCAGG + Intergenic
1121311082 14:92935397-92935419 TTGCTCAAGATCCCACAGCCAGG - Intergenic
1121436094 14:93921179-93921201 TACCTCAAGATCACACAGCCAGG + Intronic
1121942086 14:98080661-98080683 TAGCTCAGGAGTGCACTGCCTGG + Intergenic
1122532449 14:102438052-102438074 AAGCTGAGGATGCCATAGCCGGG - Exonic
1122689566 14:103525536-103525558 TATCTCAGGCTGTCTCAGTCGGG + Intergenic
1122885881 14:104710068-104710090 TAGCTGGGGATGGCACAGACAGG - Exonic
1124654152 15:31495077-31495099 TAGCTCAGGAGGGGACAGGCAGG + Intronic
1127467242 15:59256173-59256195 CAGCTACTGATGTCACAGCCTGG - Intronic
1128330807 15:66754281-66754303 TGGCTCTGGGTGTCACTGCCTGG + Intronic
1131761372 15:95626630-95626652 TCACTCAGGCTGTCACAGCTGGG - Intergenic
1132274385 15:100554205-100554227 TAGCTGAAGAGCTCACAGCCCGG + Intergenic
1133364532 16:5200322-5200344 ATACTCAGGCTGTCACAGCCTGG - Intergenic
1133844951 16:9444932-9444954 TACTTCAGCATGACACAGCCTGG - Intergenic
1134212295 16:12287974-12287996 TAGATATTGATGTCACAGCCTGG + Intronic
1135656861 16:24257436-24257458 TAGCTCAGAATGTGCCAGACCGG - Intronic
1136565018 16:31064605-31064627 GAACGCAGGATGTCAGAGCCAGG - Exonic
1137506315 16:49056885-49056907 GAGCTTAGCATGTCACAGCAGGG + Intergenic
1139427221 16:66889508-66889530 GAGCTCAGGAGTTCGCAGCCTGG - Exonic
1140035534 16:71368603-71368625 TTGCTCAGGACCACACAGCCAGG - Intronic
1140684317 16:77418604-77418626 TAGCTCAGGGTTTCTCAGTCGGG - Intronic
1141153433 16:81580295-81580317 TAGCTCACCATGTCACAAACAGG - Intronic
1142712591 17:1731382-1731404 TTGCTCAGGGTCACACAGCCGGG - Intronic
1144861155 17:18303309-18303331 TATCTCAGGCTGTCTCAGTCGGG - Intronic
1144947739 17:18978383-18978405 TAGCCCAGGATGTCGCTGCCAGG + Exonic
1146476394 17:33166090-33166112 TAGCACAAGGTCTCACAGCCTGG - Intronic
1146642766 17:34553671-34553693 AAGCTTAGGATGTCAGAGCCAGG + Intergenic
1147056062 17:37836186-37836208 TAGATCAGGATTTCTCAACCCGG - Intergenic
1147236541 17:39061791-39061813 TAGCTGAGGAAGTTAGAGCCAGG + Intergenic
1150627555 17:66851230-66851252 TAGCTCAGGATTTCTCCCCCTGG - Intronic
1153704518 18:7732216-7732238 TAGCTGAGGATGTGATGGCCAGG - Intronic
1155580979 18:27306064-27306086 TGGCTCTGGTTGTGACAGCCAGG - Intergenic
1156369233 18:36457780-36457802 TAGCTCAGGATGTCACAGCCTGG + Intronic
1158154028 18:54405218-54405240 AAGCTCAGTTTGTCACAGTCTGG + Intergenic
1158582766 18:58699389-58699411 TTGCTCAGGATGTGACAACTGGG - Intronic
1160727091 19:622123-622145 CAGCTCAGGAGGGCACTGCCTGG + Intronic
1161245772 19:3250981-3251003 TAGGTGAGGAAGGCACAGCCTGG - Exonic
1163222988 19:15935005-15935027 CAGCTCAGGGTGACACAGCATGG + Intergenic
1163676066 19:18655919-18655941 TAGGGCAGGACATCACAGCCCGG + Intronic
1164436819 19:28237538-28237560 TGGCTCAAGATTACACAGCCAGG + Intergenic
1164584286 19:29456595-29456617 TTGCTCATAATGTCTCAGCCAGG + Intergenic
1166703683 19:44896571-44896593 TTGCCCAGGGTGACACAGCCAGG + Intronic
1167336928 19:48892221-48892243 TATCTCAGGCTGTCTCAGTCGGG + Intronic
1167573569 19:50305981-50306003 TAGCTGAAGAAGTCTCAGCCGGG + Intronic
1167820705 19:51925249-51925271 TATCTCAGGCTGTCTCAGCAGGG - Intronic
925343694 2:3154643-3154665 ACGCTCAAGATGTCAGAGCCTGG - Intergenic
927735038 2:25512769-25512791 TAGCTCATGATGTCCCAGCCCGG - Intronic
928137047 2:28695572-28695594 TATCTCAGCTTGTCACAGTCAGG - Intergenic
929645651 2:43624570-43624592 TAGCACATGGTGTCACAGCTAGG - Intergenic
931058493 2:58500257-58500279 TAGCTCAGGATGTAAATGCATGG + Intergenic
935202652 2:100871274-100871296 TAGCTCAGGACCTTAAAGCCAGG - Intronic
936276426 2:111101755-111101777 TCAGTCAGGATGACACAGCCAGG - Intronic
937566988 2:123306025-123306047 TAGCTGAAGATGTCACAGGGTGG - Intergenic
937932311 2:127216776-127216798 TGGCTCAGCATGACACAGACAGG + Intronic
939476684 2:142695715-142695737 TATCTCAGGCTGTCTCAGTCGGG + Intergenic
940833806 2:158498199-158498221 GAGCTCAGGAATTCAAAGCCTGG - Intronic
941217971 2:162737739-162737761 AAGCACAGGATGATACAGCCTGG + Intronic
941676340 2:168346959-168346981 TGCCTCTGGATGACACAGCCAGG - Intergenic
942151479 2:173080364-173080386 TAGAGCAGTCTGTCACAGCCTGG + Intronic
946581592 2:221133882-221133904 TACATCGGGATCTCACAGCCTGG + Intergenic
948545785 2:238727788-238727810 TTGCTGAGGGTGTCACAGCTGGG + Intergenic
1169742542 20:8910755-8910777 TTGCTCACCATGTCACAGCTAGG + Intronic
1170123399 20:12935810-12935832 AAGCTCAGGATTTGCCAGCCAGG - Intergenic
1172125466 20:32622831-32622853 AAGCACAGGAGGCCACAGCCAGG - Intergenic
1172337297 20:34127884-34127906 TATCTCAGGCTGTCTCAGTCCGG - Intergenic
1172338428 20:34135937-34135959 TATCTCAGGCTGTCTCAGTCGGG - Intergenic
1172648115 20:36484094-36484116 TAGCCCAGGATTACACAGACAGG - Intronic
1174125541 20:48302142-48302164 TTGGCCAGGATCTCACAGCCTGG - Intergenic
1174545399 20:51321458-51321480 TCCCTGAGGATGTCAGAGCCCGG - Intergenic
1174845307 20:53937657-53937679 TTGCTCAAGACCTCACAGCCTGG + Intronic
1176044846 20:63087219-63087241 GAGCTCTGGATGCCACAGACAGG - Intergenic
1177020021 21:15842697-15842719 CAGCTGAGGAAATCACAGCCTGG - Intronic
1178116557 21:29423655-29423677 GACCTCATGCTGTCACAGCCAGG - Intronic
1178470602 21:32889188-32889210 TAGCACTGGATGTCACACTCTGG + Intergenic
1178721562 21:35015147-35015169 GTGCCCAGGATCTCACAGCCAGG - Intronic
1180156378 21:45979361-45979383 GAGCTCAGGATGCTGCAGCCTGG + Intergenic
1180867407 22:19127352-19127374 TTTCTCAGGATGTCCCACCCGGG - Intergenic
1180983665 22:19891570-19891592 TTGCTCAGGATGCCCCAGCCTGG + Intronic
1181271059 22:21658619-21658641 TTGCTCAGGATCACACAGCCAGG - Intronic
1183165666 22:36145418-36145440 GAGATCAGGATGGCATAGCCGGG + Intronic
1184747093 22:46462315-46462337 GAGCGCAGGAAGTCAGAGCCGGG + Intronic
1184873986 22:47260978-47261000 CAGCCCAGTGTGTCACAGCCAGG + Intergenic
949117283 3:342253-342275 TAGCTCTGTCTCTCACAGCCAGG + Intronic
950497671 3:13343694-13343716 CAGCTCAGGATGTGGCATCCTGG - Intronic
950944153 3:16927582-16927604 TAGCACAGGGTTTCTCAGCCTGG + Intronic
950985888 3:17365858-17365880 TAGCTCAAGAGTTCAAAGCCTGG + Intronic
952159173 3:30676584-30676606 TTGCTCAGGTTGCCACAGCTTGG + Intronic
954843259 3:53531806-53531828 TTGCTCAAGATTACACAGCCTGG - Intronic
961162130 3:124736596-124736618 TAGCTCAGAAAGTCTCAGCTGGG - Intronic
961340049 3:126211929-126211951 TAGGTCAGGATGTCAAAAACAGG + Intergenic
961432922 3:126895989-126896011 TAGCTCAGCAAGTCCCACCCCGG + Intronic
966467224 3:180243699-180243721 TTGCTCAGATTGTCACAGCAGGG - Intergenic
966773049 3:183520977-183520999 TATCTCAGGCTGTCTCAGTCGGG + Intronic
967830823 3:193918677-193918699 GAGGTCAGGAGTTCACAGCCTGG + Intergenic
968439991 4:618463-618485 GAGCTCAGGTTGTTAGAGCCTGG - Intergenic
969593603 4:8135669-8135691 TCTCACAGGATATCACAGCCCGG - Intronic
970483443 4:16501066-16501088 GAGCTCAGGCTGTTTCAGCCAGG - Intergenic
971262971 4:25073876-25073898 TAGCACAGGGGGTTACAGCCAGG + Intergenic
971309747 4:25515094-25515116 CTGCTCAGGATGGCACAGGCTGG - Intergenic
974444939 4:61967834-61967856 TATCACAGAATGTCACAGACTGG + Intronic
975995943 4:80315014-80315036 GAGTTCTGGAGGTCACAGCCTGG + Intronic
979601353 4:122589671-122589693 TAGCTCAGGATTATACAGACTGG + Intergenic
980530515 4:134046616-134046638 TATCTCAGGCTGTCTCAGTCGGG + Intergenic
981158999 4:141474498-141474520 TAGCTCATGTTTCCACAGCCTGG - Intergenic
983845811 4:172515833-172515855 GAACTCAGGATGGCACAGCACGG + Intronic
985868607 5:2536334-2536356 TAACTCAGGGTTCCACAGCCTGG + Intergenic
987153608 5:15065067-15065089 GAGCTGAGGAAGTCAAAGCCAGG - Intergenic
987575565 5:19723922-19723944 GAGGTCAGGAGTTCACAGCCTGG - Intronic
988670475 5:33375911-33375933 CAGCTAATGATGACACAGCCAGG + Intergenic
988958660 5:36347142-36347164 CATCTCAGGAGCTCACAGCCAGG - Intergenic
990329921 5:54715356-54715378 TGGCTCAGGAAGTCACAGGCTGG + Intergenic
990346089 5:54873140-54873162 GAGCTCAGCATTTCATAGCCAGG - Intergenic
991551587 5:67842868-67842890 TATCTGGGGATTTCACAGCCTGG + Intergenic
994853446 5:105086418-105086440 TATCTCAGGATGTTACATTCTGG - Intergenic
996771890 5:127095081-127095103 TTGCTCAGGATCACAGAGCCAGG + Intergenic
998421405 5:141990568-141990590 GAGCTCAGGAGTTCACAACCTGG - Intergenic
998511318 5:142716793-142716815 TAATTCAGGATGTCTCAACCTGG - Intergenic
999361657 5:150991105-150991127 TATCTCAGGATGTCTCAGTGGGG + Intergenic
1000174245 5:158735225-158735247 CATCTCAGCATCTCACAGCCAGG + Intronic
1000278456 5:159761297-159761319 TAGCACAAGATGTCACTGCGAGG - Intergenic
1001048848 5:168397895-168397917 TAGCACTGGCTGTCATAGCCTGG - Intronic
1002181159 5:177431770-177431792 TAGCTCAGTGTCACACAGCCGGG - Intronic
1003327282 6:5101524-5101546 TTGCTCAGGATCTCACCACCAGG + Intergenic
1004540362 6:16544046-16544068 TTGCTCAGGATGGCACACCCAGG - Intronic
1006055398 6:31380118-31380140 GAGCTGAGGATGACACATCCTGG - Intergenic
1008609001 6:53168628-53168650 AAGCTCAGGATGTTCCAGCAGGG + Intergenic
1011239499 6:85255936-85255958 TAGCTCAGGCTGACATAGGCTGG - Intergenic
1016266526 6:142238814-142238836 TGGCTCATGATGGCAGAGCCTGG - Intergenic
1017626694 6:156356563-156356585 TAGCTCAGGATGCTCCATCCTGG - Intergenic
1018219076 6:161560650-161560672 TTTCTCAGGATGACAGAGCCTGG - Intronic
1021937686 7:25647239-25647261 CTGCTCAGCATGTCAGAGCCAGG + Intergenic
1023136611 7:37059005-37059027 TGGCTCAGGATGTCCCACTCGGG + Intronic
1023484094 7:40665791-40665813 GAGCACAGGATGTGACAGCAAGG + Intronic
1024001316 7:45191028-45191050 TTCCACAGGCTGTCACAGCCAGG - Intergenic
1024301445 7:47890297-47890319 TAGCTAAAGCTGGCACAGCCGGG - Intronic
1027298715 7:76806501-76806523 TTGCCCAGGATGTCACAGAATGG - Intergenic
1030925833 7:115453207-115453229 TAGGTCAGGATGTCAAAGTCTGG - Intergenic
1032630813 7:133649391-133649413 TAGCTAAGCATTTCACAGGCTGG + Intronic
1034343831 7:150373709-150373731 GAGCTCAGCATGTCACGGCAAGG + Intronic
1041796129 8:61750706-61750728 TAGCTCAGGGGGTTAGAGCCAGG + Intergenic
1042558510 8:70054428-70054450 TTGCTCAGGGTGGCACAGCTAGG + Intronic
1045271450 8:100665263-100665285 TTATTCAGGATGTCTCAGCCAGG - Intergenic
1045328305 8:101133723-101133745 TGGCTCCAGATGTCACAGTCAGG - Intergenic
1051531654 9:18110527-18110549 AAGCTCAGGATGTCTCAGATAGG - Intergenic
1052476106 9:28961364-28961386 TGGCTTAGGATTTCATAGCCAGG + Intergenic
1055411769 9:76038045-76038067 CAGCTCAGGATGTCACCACAAGG - Intronic
1056210471 9:84360370-84360392 TATCTCAGTAAGTGACAGCCAGG - Intergenic
1056773287 9:89495224-89495246 TAGCTGGGGGTGTCACAGCAGGG - Intronic
1059429706 9:114242531-114242553 TAGCTCGACATCTCACAGCCAGG + Intronic
1060033041 9:120232043-120232065 TAGATCCGGATGTCAAAACCAGG + Intergenic
1062159261 9:135070670-135070692 TAGCTCAGGATCTCAGAGCTGGG + Intergenic
1062331622 9:136047431-136047453 TGGCTCTGGATGCCACAGTCTGG - Intronic
1062345091 9:136110857-136110879 TGAGTCAGGAAGTCACAGCCGGG - Intergenic
1186066453 X:5771245-5771267 TAGCTAAGAAGGTCAGAGCCAGG + Intergenic
1193862798 X:86691778-86691800 TAGCTAAGGCTGCCACAGACAGG - Intronic
1195580604 X:106496836-106496858 TAGCTCATGGTTTCACAGGCTGG - Intergenic
1195967147 X:110439088-110439110 TAGCCCAGGATGACAAAGCCAGG - Intronic
1197246552 X:124172682-124172704 TTGGTCAGGAGGTCCCAGCCTGG - Intronic
1199530121 X:148837233-148837255 AAGCTGAGAATGTCTCAGCCTGG + Intronic
1200078281 X:153562717-153562739 TAGATCAGGAAGAAACAGCCTGG + Intronic