ID: 1156370867

View in Genome Browser
Species Human (GRCh38)
Location 18:36470164-36470186
Sequence CATACCCTTGTGAAGTCTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 112}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156370861_1156370867 17 Left 1156370861 18:36470124-36470146 CCTTGTCCTCTGGAGCAGGTCCT 0: 1
1: 0
2: 4
3: 34
4: 343
Right 1156370867 18:36470164-36470186 CATACCCTTGTGAAGTCTGGAGG 0: 1
1: 0
2: 1
3: 4
4: 112
1156370865_1156370867 -3 Left 1156370865 18:36470144-36470166 CCTAGGAACGTGGCAGTTAGCAT 0: 1
1: 0
2: 0
3: 5
4: 83
Right 1156370867 18:36470164-36470186 CATACCCTTGTGAAGTCTGGAGG 0: 1
1: 0
2: 1
3: 4
4: 112
1156370863_1156370867 11 Left 1156370863 18:36470130-36470152 CCTCTGGAGCAGGTCCTAGGAAC 0: 1
1: 0
2: 1
3: 30
4: 266
Right 1156370867 18:36470164-36470186 CATACCCTTGTGAAGTCTGGAGG 0: 1
1: 0
2: 1
3: 4
4: 112
1156370859_1156370867 26 Left 1156370859 18:36470115-36470137 CCTGGGCTGCCTTGTCCTCTGGA 0: 1
1: 0
2: 3
3: 55
4: 376
Right 1156370867 18:36470164-36470186 CATACCCTTGTGAAGTCTGGAGG 0: 1
1: 0
2: 1
3: 4
4: 112

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156370867 Original CRISPR CATACCCTTGTGAAGTCTGG AGG Intronic
902570629 1:17344940-17344962 TCTACCCTTCTGGAGTCTGGAGG - Intronic
912223032 1:107699503-107699525 CCTACCATTGTGGAATCTGGAGG + Intronic
915705433 1:157839199-157839221 CAAACCCTTCTAAATTCTGGAGG + Intronic
918249477 1:182688894-182688916 CATTCCCTTCTGGAGGCTGGAGG - Intergenic
921114713 1:212078245-212078267 CAAACCTTTGTGAAGTCAGATGG - Exonic
922235148 1:223717153-223717175 CATACCCTTTTGAGGGCAGGCGG - Intronic
923687418 1:236162946-236162968 TATACCATTCTGAGGTCTGGAGG - Intronic
1067792729 10:49299985-49300007 CATACCCTGTGGGAGTCTGGTGG - Intronic
1070078549 10:73162799-73162821 TATACCCTTAAGTAGTCTGGTGG - Intronic
1070224136 10:74482971-74482993 CCTACCATTTTGAGGTCTGGAGG + Intronic
1070364570 10:75723827-75723849 GATGCCTTTGTGAAGTATGGGGG + Intronic
1071043053 10:81337376-81337398 TCTACCATTGTGGAGTCTGGAGG - Intergenic
1071699571 10:87915692-87915714 TATGTCTTTGTGAAGTCTGGCGG - Intronic
1073127083 10:101157961-101157983 CATATCCTTGAGAGATCTGGAGG - Intergenic
1075564666 10:123494685-123494707 CAAACCCTTAGGAAGTCTGGAGG + Intergenic
1077338944 11:2017551-2017573 CATACCCCCGTGGGGTCTGGGGG + Intergenic
1078632318 11:13013888-13013910 CATACCCTTCTTAAGTTTGCTGG - Intergenic
1078989908 11:16636096-16636118 TTTACCATTCTGAAGTCTGGAGG - Intronic
1082947960 11:58780367-58780389 CCTACCATTTTGGAGTCTGGAGG + Intergenic
1089306230 11:117528020-117528042 AACGGCCTTGTGAAGTCTGGAGG - Intronic
1091281112 11:134382291-134382313 CACACACTTGGGAAGTCTTGGGG - Intronic
1202821928 11_KI270721v1_random:72733-72755 CATACCCCCGTGGGGTCTGGGGG + Intergenic
1091644034 12:2260011-2260033 CACACCAGTGTGCAGTCTGGTGG - Intronic
1093324715 12:17759840-17759862 CCTACCATTCTGGAGTCTGGAGG + Intergenic
1096069472 12:48766990-48767012 CAGTCCCTTGTGAAGCCTTGAGG - Exonic
1097923552 12:65103687-65103709 CCTACCCTTGTGTAATATGGAGG + Intronic
1100674848 12:96855789-96855811 TCTACCCTTCTGGAGTCTGGAGG + Intronic
1109280765 13:60352284-60352306 CATACCCTCGTGAAGGCTGGGGG + Intergenic
1109286049 13:60409359-60409381 TCTACCATTCTGAAGTCTGGAGG - Intronic
1109658547 13:65427900-65427922 AATTCCCTTATGAGGTCTGGAGG + Intergenic
1113468496 13:110528569-110528591 CACACTCTTGTGAAATCTGGTGG - Intronic
1117758276 14:58998966-58998988 TCTACCCTTCTGGAGTCTGGAGG - Intergenic
1119150884 14:72358326-72358348 CCTACCATTCTGGAGTCTGGAGG - Intronic
1119934041 14:78574329-78574351 TCTACCATTCTGAAGTCTGGAGG - Intronic
1128427827 15:67560289-67560311 CATACCCATGAGAAGACTGGTGG - Intronic
1130097852 15:80869380-80869402 CACACCCTTGTGAATTCTCTTGG - Intronic
1140066831 16:71618537-71618559 CATACCCTTTCCAAGTCAGGTGG - Intergenic
1149101265 17:52909488-52909510 TCTACCATTCTGAAGTCTGGAGG - Intergenic
1154252926 18:12759000-12759022 GTTACCCTGGTGAAGGCTGGAGG + Intergenic
1156370867 18:36470164-36470186 CATACCCTTGTGAAGTCTGGAGG + Intronic
1157114339 18:44849061-44849083 CATAGCCTTGTAAAGGCTGTGGG + Intronic
1162088586 19:8262854-8262876 CTAACCCTTGGGAAGTCTGTGGG - Intronic
925689453 2:6506219-6506241 CAAAGACATGTGAAGTCTGGAGG - Intergenic
926143735 2:10384348-10384370 CATCCCCGTGGGATGTCTGGAGG + Intronic
931590259 2:63875322-63875344 CATACCCTTGTGAAGCATACAGG + Intronic
937761099 2:125604315-125604337 CATACCATTCTGGTGTCTGGAGG - Intergenic
937862342 2:126720861-126720883 CACAGCCTGGGGAAGTCTGGAGG + Intergenic
938768850 2:134482795-134482817 CAGACCATTTTGATGTCTGGAGG + Intronic
941424812 2:165329297-165329319 CACACCTTTGTGAAGGATGGTGG + Intronic
943297899 2:186161248-186161270 CCTACCATTCTGGAGTCTGGAGG - Intergenic
945407937 2:209472427-209472449 TATACCCTTCAGAACTCTGGTGG - Intronic
1169146528 20:3256106-3256128 GATACGCTTTTGGAGTCTGGTGG + Exonic
1170083506 20:12503171-12503193 ATTTCCTTTGTGAAGTCTGGAGG + Intergenic
1170941636 20:20853174-20853196 CCTACCATTCTGGAGTCTGGAGG + Intergenic
1174712971 20:52726839-52726861 CATACAGTTGAGAAGTCTAGGGG - Intergenic
1174965349 20:55208006-55208028 CCTACCATTCTGAGGTCTGGAGG - Intergenic
1176920476 21:14681835-14681857 ATTACCATTGTGAAATCTGGTGG - Intergenic
1182813539 22:33138016-33138038 TCTACCCTTCTGGAGTCTGGAGG - Intergenic
952139186 3:30459330-30459352 TATACCCTTCTGGGGTCTGGGGG - Intergenic
956558022 3:70542939-70542961 AATACCATGGAGAAGTCTGGGGG + Intergenic
959267920 3:104167620-104167642 TCTACCATTCTGAAGTCTGGAGG + Intergenic
961059730 3:123818101-123818123 CATTCCCTTATGATGTCAGGGGG + Intronic
962630153 3:137267575-137267597 TTTAGCCTTGTGAAGTATGGAGG - Intergenic
963496218 3:146064752-146064774 CATACCATTGTGAACCCAGGTGG - Intergenic
966743095 3:183252188-183252210 CATACACATGTGATGGCTGGGGG + Intronic
967088476 3:186115106-186115128 CCTACCCCTGAGAAATCTGGGGG + Intronic
969363707 4:6681617-6681639 CTTATCCGTGTGCAGTCTGGGGG + Intergenic
970591678 4:17565470-17565492 CAAACCCGTCTGATGTCTGGTGG - Intergenic
974101526 4:57422597-57422619 TCTACCATTCTGAAGTCTGGAGG - Intergenic
974171791 4:58276263-58276285 CAGTCACTTGTGAAGACTGGTGG - Intergenic
975259234 4:72276673-72276695 CAGCCCCTTGAGAAGTTTGGTGG + Intergenic
975772522 4:77742692-77742714 CATATCCTTCTGAACTATGGTGG + Intronic
976119914 4:81768636-81768658 CATGCCCTTGGGAAGTTTGCTGG + Intronic
976202688 4:82595447-82595469 CTTAACGATGTGAAGTCTGGTGG - Intergenic
977191847 4:94010758-94010780 TATACCCTTGTATTGTCTGGGGG - Intergenic
978814571 4:112888915-112888937 CAGAACCTTGTTAACTCTGGTGG + Intronic
978918587 4:114153833-114153855 CATACCATTGTGTTATCTGGTGG - Intergenic
984503193 4:180582335-180582357 CCTACCCTTCTGCAGTCTCGAGG - Intergenic
987494830 5:18630231-18630253 CATACCATTCCGGAGTCTGGAGG + Intergenic
988054244 5:26072782-26072804 CATAACCTAGTGAAGTTTGATGG - Intergenic
993390941 5:87319237-87319259 TCTACCCTTGTGGGGTCTGGAGG + Intronic
993723943 5:91347638-91347660 CCTACCATTCTGGAGTCTGGAGG + Intergenic
994267832 5:97738893-97738915 CATACCAGTGTGAAGTCTGAAGG + Intergenic
1003912875 6:10758565-10758587 CTTGCCCTTCTGGAGTCTGGTGG + Intronic
1006219439 6:32476060-32476082 CAAACACTGGTGAATTCTGGGGG + Intergenic
1007082163 6:39115236-39115258 CCTCCGTTTGTGAAGTCTGGCGG + Intergenic
1008137650 6:47795302-47795324 CATGCCCTTGGTAGGTCTGGGGG + Exonic
1008867226 6:56227384-56227406 CATACGCTTGTTAAGCCTGTGGG + Intronic
1010860140 6:80900148-80900170 TATACCATTGTGGGGTCTGGAGG + Intergenic
1020174304 7:5869974-5869996 AATACTCTTGTCAAGGCTGGAGG - Intergenic
1022500674 7:30880723-30880745 CATTCCTTAGTGAAGTGTGGGGG - Intronic
1024023870 7:45394899-45394921 TATTCCCTTGTGAAAGCTGGAGG + Intergenic
1024438530 7:49388030-49388052 TATACCATTCTGAGGTCTGGAGG + Intergenic
1027463980 7:78491607-78491629 TTGACCCTTGTAAAGTCTGGTGG + Intronic
1029084454 7:98000399-98000421 AATACTCTTGTCAAGGCTGGAGG + Intergenic
1031645615 7:124221800-124221822 TCTACCATTCTGAAGTCTGGAGG - Intergenic
1033198641 7:139349301-139349323 CATACACTTCTGAAGACTGATGG - Intronic
1033555589 7:142486174-142486196 CTTTACCTTATGAAGTCTGGTGG + Intergenic
1033559968 7:142521818-142521840 CAAACCATTGAGGAGTCTGGTGG - Intergenic
1033560434 7:142525706-142525728 CTTTACCTTGTGAAGACTGGTGG + Intergenic
1040934527 8:52768589-52768611 GAGTCCCTTGTGAAGACTGGAGG - Intergenic
1042133408 8:65611238-65611260 CTTACCCTTTTGATGTCTGTAGG + Intronic
1042149582 8:65767605-65767627 CATACCCTGGGGGAATCTGGGGG + Intronic
1045351464 8:101344586-101344608 CATACACTTTTCAAGACTGGAGG + Intergenic
1052294592 9:26882670-26882692 TATACCCTTCTGGGGTCTGGGGG - Intronic
1052969391 9:34367804-34367826 TATACCATTCTGATGTCTGGAGG + Exonic
1056423549 9:86453803-86453825 CATACCCTTGAAGATTCTGGAGG - Intergenic
1061011226 9:127955779-127955801 CAAAGCCTTGTGGAGCCTGGAGG - Intronic
1187652753 X:21427473-21427495 CATACCATTATGAAATCAGGAGG + Intronic
1189417930 X:40831510-40831532 CATACCCAGGTGCAGGCTGGGGG + Intergenic
1193891004 X:87045992-87046014 TATACCATTCTGAGGTCTGGAGG - Intergenic
1196645832 X:118116789-118116811 CACACCCTGGTGAGGTCAGGCGG - Intronic
1197189653 X:123631824-123631846 GATACCCTGGTGCAGTTTGGTGG - Exonic
1199151670 X:144494314-144494336 CATACCTTTGTGGAGTCAGAAGG + Intergenic
1200944892 Y:8824917-8824939 CCTACCATTCTGAGGTCTGGAGG + Intergenic
1201727136 Y:17166334-17166356 CCTACCCTTGTGACTTCTTGTGG + Intergenic
1202358628 Y:24079841-24079863 CTAACCATTCTGAAGTCTGGAGG - Intergenic
1202512150 Y:25590272-25590294 CTAACCATTCTGAAGTCTGGAGG + Intergenic