ID: 1156375883

View in Genome Browser
Species Human (GRCh38)
Location 18:36515033-36515055
Sequence GCCTGCAGGCCGCTGGTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 921
Summary {0: 1, 1: 0, 2: 2, 3: 67, 4: 851}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156375883_1156375891 2 Left 1156375883 18:36515033-36515055 CCTCCCACCAGCGGCCTGCAGGC 0: 1
1: 0
2: 2
3: 67
4: 851
Right 1156375891 18:36515058-36515080 TTGAGGGAATCCTTGTGCATGGG 0: 1
1: 0
2: 0
3: 14
4: 139
1156375883_1156375894 17 Left 1156375883 18:36515033-36515055 CCTCCCACCAGCGGCCTGCAGGC 0: 1
1: 0
2: 2
3: 67
4: 851
Right 1156375894 18:36515073-36515095 TGCATGGGCAGGTTAAACACAGG 0: 1
1: 0
2: 1
3: 10
4: 447
1156375883_1156375895 23 Left 1156375883 18:36515033-36515055 CCTCCCACCAGCGGCCTGCAGGC 0: 1
1: 0
2: 2
3: 67
4: 851
Right 1156375895 18:36515079-36515101 GGCAGGTTAAACACAGGTCCTGG 0: 1
1: 0
2: 1
3: 10
4: 113
1156375883_1156375892 6 Left 1156375883 18:36515033-36515055 CCTCCCACCAGCGGCCTGCAGGC 0: 1
1: 0
2: 2
3: 67
4: 851
Right 1156375892 18:36515062-36515084 GGGAATCCTTGTGCATGGGCAGG 0: 1
1: 0
2: 0
3: 2
4: 116
1156375883_1156375896 26 Left 1156375883 18:36515033-36515055 CCTCCCACCAGCGGCCTGCAGGC 0: 1
1: 0
2: 2
3: 67
4: 851
Right 1156375896 18:36515082-36515104 AGGTTAAACACAGGTCCTGGTGG 0: 1
1: 0
2: 0
3: 13
4: 166
1156375883_1156375890 1 Left 1156375883 18:36515033-36515055 CCTCCCACCAGCGGCCTGCAGGC 0: 1
1: 0
2: 2
3: 67
4: 851
Right 1156375890 18:36515057-36515079 TTTGAGGGAATCCTTGTGCATGG 0: 1
1: 0
2: 0
3: 11
4: 206

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156375883 Original CRISPR GCCTGCAGGCCGCTGGTGGG AGG (reversed) Intronic
900101822 1:965196-965218 GGCTGCAGGCCTCTGGTGGTAGG - Exonic
900486260 1:2924214-2924236 GCCCGAAGCCAGCTGGTGGGAGG - Intergenic
900548125 1:3239919-3239941 GCCTGGAGGCTGGGGGTGGGCGG + Intronic
900562097 1:3312291-3312313 GCCTGCAGGCCGCTGAGTGCTGG - Intronic
900730788 1:4258275-4258297 GCCTCCAGGCCTGTGATGGGAGG - Intergenic
900738363 1:4314504-4314526 GCCTCCAGGCCTGTGATGGGAGG + Intergenic
901014690 1:6221812-6221834 GCTTGCAGGCCGCTGCTGAGTGG - Exonic
901138031 1:7010152-7010174 GCCTGCAGGACACTGCTGCGAGG + Intronic
901195770 1:7439062-7439084 GGCTGCAGGCAGGTGGTCGGTGG + Intronic
901767437 1:11512102-11512124 GCCTTCAGGCCTCTGATGGGAGG + Intronic
901925429 1:12563271-12563293 GCCTCCAGGCCTATGATGGGAGG - Intergenic
902348916 1:15838910-15838932 GCCTGTAGTCCGGTGGTTGGAGG + Intergenic
904033993 1:27549474-27549496 GCAGGCAGGGCACTGGTGGGTGG + Exonic
904049485 1:27630546-27630568 GCAGGCAGGGCGCAGGTGGGGGG + Intronic
904057442 1:27680658-27680680 GCCTCCAGGCCTGTGATGGGAGG + Intergenic
904958984 1:34316133-34316155 GCCTCCAGGCCTGTGATGGGAGG - Intergenic
905091298 1:35433326-35433348 CCCTGCCTGCCACTGGTGGGTGG - Intergenic
905245342 1:36609410-36609432 GACTGCAGTCCGCATGTGGGTGG - Intergenic
906530948 1:46523731-46523753 CTCTGCAGGCCCCTGGTGGCTGG - Intergenic
907291651 1:53417424-53417446 GCGTGCAGGCACCGGGTGGGAGG - Intergenic
907555852 1:55343865-55343887 GCCTGCAGGCTTGTGATGGGAGG - Intergenic
908006876 1:59736902-59736924 GCCTCCAGGCCTGTGATGGGAGG - Intronic
908020047 1:59889671-59889693 GCCTCCAGGCCTGTGATGGGAGG + Intergenic
908663379 1:66462501-66462523 GCTTGCAGGCCTGTGATGGGAGG - Intergenic
908746887 1:67384463-67384485 GCCTCCAGGCCTGTGATGGGAGG + Intronic
909436330 1:75647066-75647088 GCCTCCAGGCCTGTGATGGGAGG - Intergenic
911331372 1:96529471-96529493 GCCTCCAGGCCTCTGATGGGAGG - Intergenic
911515828 1:98866799-98866821 GCCTCCAGGCCTGTGATGGGAGG + Intergenic
911848479 1:102784142-102784164 GCCTCCAGGCCTGTGATGGGAGG + Intergenic
912279501 1:108298011-108298033 GCCTCCAGGCCTGTGATGGGAGG + Intergenic
912288725 1:108396346-108396368 GCCTCCAGGCCTGTGATGGGAGG - Intronic
914349834 1:146831408-146831430 GCCTGCAGGACAAGGGTGGGAGG - Intergenic
914694820 1:150067592-150067614 ATCTTCAGGCCGCAGGTGGGTGG + Exonic
915858575 1:159418289-159418311 GCCTCCTGGCCTGTGGTGGGAGG - Intergenic
916286394 1:163109806-163109828 GCCTCCAGGCCTATAGTGGGTGG + Intergenic
916736003 1:167607691-167607713 GCCTCCAGGCCTCTGATGAGAGG - Intergenic
916959179 1:169872127-169872149 GCCTGCAGGCCTGTGATGGGAGG - Intronic
917035495 1:170743300-170743322 GCCTCCAGGCCTGTGATGGGAGG + Intergenic
917396674 1:174601249-174601271 GCCTCCAGGCCTGTGATGGGAGG + Intronic
918139856 1:181711082-181711104 GGCTGCAGGAGGCTGGTGAGTGG + Intronic
918591956 1:186249933-186249955 GCCTCCAGGCCTGTGATGGGAGG + Intergenic
918718190 1:187818360-187818382 GCCTCCAGGCCTGTGATGGGAGG + Intergenic
919175112 1:194010227-194010249 GCCTCCAGGCCTGTGATGGGAGG - Intergenic
919233529 1:194807354-194807376 GCCTCCAGGCCTCTGATGGGAGG - Intergenic
919978831 1:202629851-202629873 CCCAGCAGGCAGCTGGTGGGGGG + Intronic
921424310 1:214984681-214984703 GCCTCCAGGCCTGTGATGGGAGG - Intergenic
921531211 1:216285182-216285204 GCCTCCAGGCCTGTGATGGGAGG - Intronic
921621476 1:217330386-217330408 GCCTCCAGGCCTGTGATGGGAGG + Intergenic
921996631 1:221426225-221426247 GCCTCCAGGCCTGTGATGGGAGG + Intergenic
922465868 1:225845376-225845398 GCCTGGAGGGCACTTGTGGGGGG - Exonic
922726753 1:227926355-227926377 GCCAGCAGCCAGCTGGGGGGAGG - Intronic
922745188 1:228039325-228039347 GGCTGCTGGCAGCTGGTGGCTGG - Intronic
923088703 1:230722014-230722036 GCCTCCAGGCCTGTGATGGGAGG - Intergenic
923198045 1:231686592-231686614 GCCTCCAGGCCTGTGATGGGAGG + Intronic
923339206 1:232993697-232993719 GCCTCCAGGCCTGTGATGGGAGG - Intronic
924050770 1:240078020-240078042 GCCTCCAGGCCTGTGATGGGAGG - Intronic
924052773 1:240093580-240093602 GCCCGCACGCCCCGGGTGGGAGG + Exonic
924378769 1:243440860-243440882 GCATGCAGGCTGCTGGTGATGGG + Intronic
924806545 1:247366228-247366250 GCCTCCAGGCCTGTGATGGGAGG - Intergenic
924940727 1:248811225-248811247 GCCTGCAGGAAGCTGGTGTCAGG - Exonic
1063340688 10:5260750-5260772 ACATGGAGGTCGCTGGTGGGAGG - Intergenic
1063401705 10:5752429-5752451 GCCTGCAGGCCCCTCATGTGTGG - Intronic
1063448396 10:6134671-6134693 GGCAGCAGGCTGCTGGTGGGGGG - Intergenic
1064913949 10:20435414-20435436 GTCTCCAGGCTGCTGGAGGGTGG - Intergenic
1065347794 10:24765214-24765236 GCCTCCAGGCCTGTGATGGGAGG + Intergenic
1065408089 10:25390871-25390893 GCCTCCAGGCCTGTGATGGGAGG - Intronic
1065974884 10:30833550-30833572 GCTTGCAGGCTGCTGGGGGGAGG + Intronic
1066083445 10:31954970-31954992 GCCTCCAGGCCTGTGATGGGAGG - Intergenic
1068011329 10:51455289-51455311 GCCTCCAGGCCTGTGATGGGAGG + Intronic
1068128383 10:52868481-52868503 GCCTCCAGGCCGGTGATGGGAGG - Intergenic
1068235491 10:54227503-54227525 GCCTCCAGGCTGGTGGTGGGAGG + Intronic
1068519082 10:58059596-58059618 GCCTCCAGGCCTGTGATGGGAGG - Intergenic
1068519519 10:58063067-58063089 GCCTCCAGGCCTGTGATGGGAGG + Intergenic
1069754586 10:70765904-70765926 GCCTCCAGGCCTGTGATGGGAGG - Intergenic
1071159257 10:82727299-82727321 GCCTCCAGGCCTGTGATGGGAGG - Intronic
1071506932 10:86238237-86238259 GCCTCCAGGCCTGTGATGGGAGG - Intronic
1071962715 10:90822715-90822737 GCCTCCAGGCCTGTGATGGGAGG - Intronic
1071981066 10:91004630-91004652 GCCTCCAGGCCTGTGATGGGAGG + Intergenic
1072647444 10:97267876-97267898 GCCTCCAGGCCTGTGATGGGAGG + Intronic
1073133660 10:101207204-101207226 GCATGCAGGCAGATGGAGGGTGG - Intergenic
1073363513 10:102918599-102918621 TCCTGCAGGCGGCTGCGGGGCGG + Exonic
1073441443 10:103555172-103555194 GCCGGCTGGCCGCGGGCGGGCGG + Intronic
1073964857 10:108977731-108977753 GCCTGCAGGCCTGTGATGGGAGG - Intergenic
1074041462 10:109793546-109793568 GCCTCCAGGCCTGTGATGGGAGG + Intergenic
1074069102 10:110048950-110048972 GCCTCCAGGCCTGTGATGGGAGG - Intronic
1074161862 10:110842208-110842230 GGCTGGTGGCAGCTGGTGGGTGG + Intergenic
1075530597 10:123225650-123225672 GCCTCCAGGCCTGTGATGGGAGG + Intergenic
1076117037 10:127907683-127907705 GGGTGCAGGCCGCGCGTGGGGGG + Intronic
1076199598 10:128547499-128547521 GCCTGCTGGTCCCTGTTGGGAGG - Intergenic
1077740878 11:4843624-4843646 GCCTCCAGGCCTGTAGTGGGAGG + Intronic
1077879128 11:6334194-6334216 TCCTGCAGAACCCTGGTGGGGGG - Intergenic
1078516004 11:12023174-12023196 GCCTCCAGGCCTGTGATGGGAGG - Intergenic
1079452616 11:20610291-20610313 TCCTGCCGCCCGGTGGTGGGAGG + Intronic
1079521127 11:21328147-21328169 GCCTCCAGGCCTGTGATGGGAGG - Intronic
1079537024 11:21526861-21526883 GCCTCCAGGCCTGTGATGGGAGG + Intronic
1080151417 11:29056644-29056666 GCCTCCAGGCCTGTGATGGGAGG - Intergenic
1080746005 11:35109375-35109397 GCCTCCAGGCCTGTGATGGGTGG - Intergenic
1081101455 11:39007234-39007256 GCCTCCAGGCCTGTGATGGGAGG + Intergenic
1081309496 11:41553373-41553395 GCCTCCAGGCCTGTGATGGGAGG - Intergenic
1082119054 11:48358110-48358132 GCCTCCAGGCCTGTGATGGGAGG + Intergenic
1082615023 11:55349234-55349256 GCCTCCAGGCCTGTGTTGGGAGG - Intergenic
1082766234 11:57169944-57169966 GCCTCCAGGCCTGTGATGGGAGG + Intergenic
1082857724 11:57824032-57824054 GCCTGCAGGGCAGTGGTGGTAGG + Intergenic
1082948038 11:58780780-58780802 GCCTCCAGGCCTGTTGTGGGAGG + Intergenic
1083008095 11:59367793-59367815 GGCTGCAGGCCCCAGTTGGGAGG - Intergenic
1083136156 11:60678440-60678462 GCCTCCAGGCCTGTGATGGGAGG + Intergenic
1083853113 11:65379209-65379231 GGCTGCAGGCCTCTGGGGGAGGG - Intronic
1084431813 11:69115526-69115548 GGCTGCTGACCGCTGGTGAGGGG - Intergenic
1084433323 11:69123473-69123495 GGCTGCAGCCCGCTGGCGTGAGG - Intergenic
1084438003 11:69155350-69155372 GCCTGGATGCCGCTGGGAGGAGG + Intergenic
1084963044 11:72727224-72727246 CCATGCAGGCTGCTGGTGAGGGG - Intronic
1085236450 11:75019329-75019351 GCCTCCAGGCCTGTGATGGGAGG - Intergenic
1085600905 11:77855166-77855188 GCCTCCAGGCCTGTGATGGGAGG + Intronic
1086049788 11:82576966-82576988 GCCTCCAGGCCACTCCTGGGTGG - Intergenic
1086620622 11:88883692-88883714 GCCTCCAGGCCTGTGATGGGAGG - Intronic
1086750679 11:90490019-90490041 GCCTCCAGGCCTGTGATGGGAGG - Intergenic
1086764282 11:90675640-90675662 GCCTCCAGGCCTGTGATGGGAGG - Intergenic
1086820675 11:91433035-91433057 GCCTGAAGACCCCTGTTGGGGGG + Intergenic
1086826785 11:91508118-91508140 GCCTCCAGGCCTGTGATGGGAGG + Intergenic
1087474581 11:98620215-98620237 GCCTCCAGGCCTGTGATGGGAGG - Intergenic
1087541857 11:99531560-99531582 GCCTCCAGGCTGGTGATGGGAGG - Intronic
1087763622 11:102127270-102127292 GCCTCCAGGCCTGTGATGGGAGG - Intronic
1087793593 11:102432717-102432739 GCCTCCAGGCCTGTGATGGGAGG - Intronic
1088048336 11:105480370-105480392 GCCTCCAGGCCTGTGATGGGAGG - Intergenic
1088399450 11:109407255-109407277 GCATGCAGGCCGGTGATGGGAGG + Intergenic
1088426999 11:109714991-109715013 GCCTCCAGGCCTCTGATGGGAGG + Intergenic
1088435277 11:109805142-109805164 GCCTACAGGCCTGTGATGGGAGG + Intergenic
1090756391 11:129795303-129795325 GCCTCCAGGCCTGTGATGGGAGG + Intergenic
1091244574 11:134081348-134081370 GCCTCCAGGCCTGTGATGGGAGG - Intronic
1091644299 12:2262201-2262223 GTCTGCAAGCCCCTGATGGGAGG - Intronic
1091837488 12:3595936-3595958 GCCTGCAGGTCCTGGGTGGGGGG - Intergenic
1092184331 12:6467701-6467723 GCCTCCAGGCCTGTGATGGGAGG - Intronic
1093038139 12:14352274-14352296 GCCTCCAGGCCTGTGATGGGAGG + Intergenic
1093141893 12:15518379-15518401 GCCTCCAGGCCTGTGATGGGAGG + Intronic
1093351050 12:18103463-18103485 GCCTCCAGGCCTGTGATGGGAGG + Intronic
1094037019 12:26082260-26082282 GCCTCCAGGCCTGTGATGGGAGG + Intergenic
1094221621 12:28000050-28000072 GCCTGCATGCAGCTGGTCAGAGG - Intergenic
1094706025 12:32915317-32915339 GCCTCCAGGCCTGTGATGGGAGG - Intergenic
1094785819 12:33847001-33847023 GCCTCCAGGCCTGTGATGGGAGG + Intergenic
1095516818 12:43015531-43015553 GCCTCCAGGCCTATGATGGGAGG - Intergenic
1095803492 12:46293325-46293347 GCCTCCAGGCCCGTGATGGGAGG + Intergenic
1096215907 12:49797212-49797234 GCCTGGAGGCCGCCAGGGGGTGG + Exonic
1096524987 12:52205156-52205178 GCCTGCAGGCCGCTCCTGGGTGG - Intergenic
1096875536 12:54627456-54627478 GCCTCCAGGCCTGTGATGGGAGG - Intergenic
1097445589 12:59667792-59667814 GCCTCCAGGCCTGTGATGGGAGG - Intronic
1097501584 12:60410208-60410230 GCCTCCAGGCCTATGATGGGAGG + Intergenic
1097571304 12:61335381-61335403 GCCTCCAGGCCTGTGATGGGAGG + Intergenic
1097575630 12:61389261-61389283 GCCTCCAGGCCTGTGATGGGAGG + Intergenic
1097654735 12:62344967-62344989 GCCTCCAGGCCTGTGATGGGAGG + Intronic
1097955842 12:65484367-65484389 GCCTCCAGGCCTGTGATGGGAGG + Intronic
1098163935 12:67673729-67673751 GCCTCCAGGCCTGTGATGGGAGG + Intergenic
1098774846 12:74600094-74600116 GCCTCCAGGCCTGTGATGGGAGG - Intergenic
1098836770 12:75433121-75433143 GCCTCCAGGCCTGTGATGGGAGG + Intergenic
1099096367 12:78379284-78379306 GCCTCCAGGCCTGTGATGGGAGG + Intergenic
1099407412 12:82281471-82281493 GCCTCCAGGCCTGTGATGGGAGG - Intronic
1099525326 12:83711331-83711353 GCCTGCAGGCCTGTGATGGTAGG + Intergenic
1099635160 12:85203982-85204004 GCCTTCAGGCCTGTGATGGGAGG - Intronic
1099675439 12:85755391-85755413 GCCTCCAGGCCTGTGATGGGAGG - Intergenic
1099892138 12:88602952-88602974 GCCTGCAGGGGGGTGGGGGGAGG - Intergenic
1099932606 12:89091442-89091464 GCCTCCAGGCCTATGATGGGAGG - Intergenic
1102025952 12:109714416-109714438 GGCTGCAAGCCGCGGGCGGGCGG + Exonic
1102148015 12:110669313-110669335 GGCTGCAGGCAGGTGGAGGGAGG - Intronic
1102189017 12:110971941-110971963 GCCTGGAGACCGAGGGTGGGAGG - Intergenic
1102286854 12:111664708-111664730 GCCACCAGGCCACTTGTGGGTGG + Intronic
1102668903 12:114600733-114600755 GCCTCCAGGCCTGTGATGGGAGG - Intergenic
1103072233 12:117954402-117954424 GCCTGCCGGCCACTGATGGGAGG + Intronic
1103264536 12:119617966-119617988 GCCTCCAGGCCTGTGATGGGAGG - Intronic
1104172146 12:126292209-126292231 GCCTCCAGGCCTGTGATGGGAGG + Intergenic
1104210532 12:126684186-126684208 GCCTCCAGGCCTATGATGGGAGG + Intergenic
1104240580 12:126985057-126985079 GCCTCCAGGCCTGTGATGGGAGG + Intergenic
1104347868 12:128018929-128018951 GCCTGAAAGCCCCTAGTGGGAGG + Intergenic
1104795196 12:131512269-131512291 GCCAGCAGGCCTCTGCAGGGAGG + Intergenic
1104830051 12:131744089-131744111 GCCTCCAGGCCTGTGATGGGAGG + Intronic
1105353087 13:19633538-19633560 GCCCGCGGGACGCAGGTGGGCGG - Intergenic
1105353219 13:19634234-19634256 GGCTGCAGGCAGCTGGTGAAGGG + Intronic
1106117424 13:26829642-26829664 TCCTGCAGGCAGATGGTGGAGGG + Intergenic
1106734746 13:32577815-32577837 GCCTCCAGGCCTGTGATGGGAGG - Intergenic
1107961891 13:45566409-45566431 GCCTTCAGGCCTGTGATGGGAGG - Intronic
1108088869 13:46824653-46824675 ACCTGCAGCCCCCTGGAGGGTGG - Intergenic
1109496367 13:63177839-63177861 GCCTCCAGGCCTCTGATGAGAGG - Intergenic
1109572964 13:64216418-64216440 GCCTGTCGGCCCCTGCTGGGAGG + Intergenic
1109655699 13:65387905-65387927 GCCTCCAGGCCTGTGATGGGAGG - Intergenic
1109962078 13:69644591-69644613 GCCTCCAGGCCTATGATGGGAGG - Intergenic
1110496557 13:76174440-76174462 GCCTCCAGGCCTATGATGGGAGG + Intergenic
1111207757 13:85035092-85035114 GCCTCCAGGCCAGTGATGGGAGG - Intergenic
1111253670 13:85639075-85639097 GCCTGCAGGCAGGTGCAGGGAGG + Intergenic
1112146932 13:96710341-96710363 GCCTGCAGGCAGCTGGTGCTGGG + Intronic
1112812377 13:103233815-103233837 GCCTCCAGGCCTGTGATGGGAGG - Intergenic
1112857245 13:103786736-103786758 GCCTCTAGGCCTGTGGTGGGAGG + Intergenic
1112881281 13:104109280-104109302 GCCTACAGGCCTGTGATGGGAGG - Intergenic
1113060993 13:106322777-106322799 GCCTTCAGGCCTATGATGGGAGG - Intergenic
1114380471 14:22198441-22198463 GCCTTCAGGCCTGTGATGGGAGG - Intergenic
1114795726 14:25712741-25712763 GCCTCCAGGCCTGTGATGGGAGG + Intergenic
1115021234 14:28683977-28683999 GCCTGCAGGCCTGTGATGTGAGG - Intergenic
1115199162 14:30834597-30834619 GCCTTCAGGCCTGTGATGGGAGG + Intergenic
1116147896 14:41099418-41099440 GCCTTCAGGCCTGTGATGGGAGG - Intergenic
1116263514 14:42660636-42660658 GCCTCCAGGCCTGTGATGGGAGG - Intergenic
1116387344 14:44348090-44348112 GCCTCCAGGCCTGTGATGGGAGG - Intergenic
1116415570 14:44673007-44673029 GCCTCCAGGCCAGTGATGGGAGG + Intergenic
1116617233 14:47154748-47154770 GCCTGCAGGCCGGTGCCGAGTGG - Intronic
1116762049 14:49026876-49026898 GCCTCCAGGCCTGTGATGGGAGG - Intergenic
1116854141 14:49937304-49937326 GCCTCCAGGCCTGTGATGGGAGG - Intergenic
1116931392 14:50694487-50694509 GCCTCCAGGCCTGTGATGGGAGG + Intergenic
1117198546 14:53364493-53364515 GCCTCCAGGCCTATGATGGGAGG + Intergenic
1117234289 14:53754854-53754876 GCCTCCAGGCCTGTGATGGGAGG - Intergenic
1117907464 14:60605495-60605517 GCCTCCAGGCCTGTGATGGGAGG - Intergenic
1117908272 14:60612261-60612283 GCCTCCAGGCCTGTGATGGGAGG + Intergenic
1118318099 14:64737785-64737807 TCCTGCAGGCAGCTGCGGGGGGG - Intronic
1118599868 14:67464439-67464461 GCCTGTAGGGCTCTGGAGGGTGG - Intronic
1118853910 14:69606446-69606468 CCCTGCAGGCCACTGGTCGGAGG - Intergenic
1119216400 14:72872247-72872269 GCCTCCAGGCCTGTGATGGGAGG + Intronic
1119300720 14:73569450-73569472 GCCTGCGGGCCGCTGCTGCTGGG + Exonic
1119305829 14:73607462-73607484 GCCTCCAGGCCTGTGATGGGAGG + Intergenic
1120104711 14:80480553-80480575 GCCTGCAGGCCTGTGATGGGAGG + Intronic
1120326523 14:83036670-83036692 GCCTCCAGGCCTGTGATGGGAGG + Intergenic
1120366971 14:83583357-83583379 GCCTGCTGGCCTGTGATGGGAGG - Intergenic
1120457737 14:84754305-84754327 GCCTCCAGGCCTGTGATGGGAGG - Intergenic
1120799827 14:88675553-88675575 GCCTCCAGGCCTGTGATGGGAGG + Intronic
1121369944 14:93347481-93347503 GCGTGCAGGCCTCGCGTGGGAGG + Intronic
1122063511 14:99155563-99155585 GCCCACAGCCCACTGGTGGGAGG - Intergenic
1122221251 14:100240104-100240126 GGCGGCAGGCCGCGGGGGGGAGG + Intronic
1122264816 14:100541630-100541652 GCCTGCAGCCCTCTGGTGCCAGG - Intronic
1122541444 14:102499791-102499813 GCCCCCAGGCCGCAGGTGGAGGG + Exonic
1122635138 14:103126299-103126321 GCCTGCAGGCTCCTGCGGGGTGG - Exonic
1122688042 14:103519160-103519182 GCCTGAAGGCCGAGGCTGGGAGG + Intergenic
1122801725 14:104234119-104234141 GCCTCCAGGCCTGTGATGGGAGG - Intergenic
1122838601 14:104443487-104443509 GCCTGCAGAGCCCTGCTGGGTGG - Intergenic
1122856123 14:104561054-104561076 GCCTGCTGGCCTCTGGGGGCTGG - Intronic
1123138206 14:106050250-106050272 GCCTCCAGGCCTGTGATGGGAGG - Intergenic
1123795558 15:23766932-23766954 GCCTCCAGGCCTGTGATGGGAGG - Intergenic
1124509119 15:30307081-30307103 GCCTCCAGGCCTGTGATGGGAGG + Intergenic
1124663129 15:31567677-31567699 GCCTGTAGGCCTTTGATGGGAGG - Intronic
1124734440 15:32231581-32231603 GCCTCCAGGCCTGTGATGGGAGG - Intergenic
1125066141 15:35487634-35487656 GCCTCCAGGCCTGTGATGGGAGG + Intronic
1125251752 15:37713208-37713230 GCCTCCAGGCCTGTGATGGGAGG - Intergenic
1125472137 15:40014619-40014641 GCCTCCAGGCCTGTGATGGGAGG + Intronic
1126665658 15:51074579-51074601 GCAAGCAGGCCTCTGGTAGGAGG - Intronic
1127150975 15:56075129-56075151 GCCTGCCAGTGGCTGGTGGGAGG + Intergenic
1128091789 15:64924095-64924117 GGCTGCAGTCAGCAGGTGGGTGG + Intronic
1128372219 15:67048801-67048823 GCCTTCAGGCTGCTGGAGGGTGG - Intergenic
1129410741 15:75348954-75348976 GCCTGCAGGGCGCTGGTGTTCGG + Exonic
1129620133 15:77136883-77136905 GCCTTCGGGCCTCTGATGGGAGG - Intronic
1129870511 15:78937232-78937254 GCCCGCTGGGGGCTGGTGGGTGG - Intronic
1131493675 15:92883416-92883438 GCCCGCGGGCGGCAGGTGGGCGG + Intronic
1131659475 15:94498699-94498721 GCCTTCAGGCCTGTGATGGGAGG - Intergenic
1131752670 15:95526372-95526394 GCCTCCAGGCCTGTGATGGGAGG + Intergenic
1131980140 15:97986941-97986963 GCCTCCAGGCCTGTGATGGGAGG - Intergenic
1132122756 15:99192328-99192350 GCCTCCAGGCCTGTGATGGGAGG - Intronic
1132579380 16:678098-678120 ACGTGAAGGCCCCTGGTGGGCGG - Exonic
1132611274 16:817451-817473 GCCTGGCGGGCGATGGTGGGTGG - Intergenic
1132641727 16:981237-981259 GCCCGCAGGCCGGTGGCGCGGGG - Intronic
1132695070 16:1198408-1198430 CCCTGGAGGCCGGTGGTGGTAGG + Intronic
1132800243 16:1748467-1748489 CCCTGCAGGCCGGTCGTGGATGG - Intronic
1132844360 16:1993062-1993084 GCCTGCCAGCCGCTAGTAGGCGG - Exonic
1132862208 16:2077246-2077268 GCCTGCCTTCCGCGGGTGGGTGG + Intronic
1132925375 16:2426539-2426561 GCCCGTAGGCCGCTGGGGGCTGG + Intergenic
1133072273 16:3254478-3254500 CCCTGCAGGGCGCTAGAGGGGGG - Exonic
1134077150 16:11299943-11299965 GCCTGCTGGCCTGGGGTGGGTGG - Intronic
1135034778 16:19067878-19067900 GCCTCCGGGGCGCTGGCGGGCGG + Intronic
1135298285 16:21301781-21301803 GCCCGCGGGCGGCTGGTGGTTGG + Intronic
1136233326 16:28900507-28900529 CCCTGGAGGAAGCTGGTGGGGGG - Intronic
1136642339 16:31577567-31577589 GCCTCCAGGCCTGTGATGGGAGG - Intergenic
1136662854 16:31780507-31780529 GCCTCCAGGCCTGTGATGGGAGG - Intronic
1137358712 16:47792315-47792337 GTCTTCAGGCCTGTGGTGGGAGG + Intergenic
1137593950 16:49711302-49711324 TGCAGCAGGCCCCTGGTGGGGGG - Intronic
1137638511 16:50008545-50008567 GCCTCCAGGCCTCAGATGGGAGG - Intergenic
1138327934 16:56191204-56191226 GCCGGGAGGGCGCTGGGGGGAGG + Intergenic
1138597833 16:58038592-58038614 GCCTGCAGGGAGGTGGGGGGTGG - Intronic
1139984202 16:70884123-70884145 GCCTGCAGGACAAGGGTGGGAGG + Exonic
1140724200 16:77797493-77797515 GGATGCAGGGGGCTGGTGGGAGG - Intronic
1141037863 16:80643832-80643854 GCCTCCAGGCCTGTGATGGGAGG + Intronic
1141443273 16:84042842-84042864 GCCTGCAGGGGGCTGGGGAGAGG - Intergenic
1141624245 16:85253077-85253099 GCAAGCAGCCTGCTGGTGGGGGG - Intergenic
1141699075 16:85634193-85634215 GCGTGCACGCCGCAGGCGGGAGG - Intronic
1142088545 16:88197776-88197798 GTGTGCTGGCTGCTGGTGGGAGG + Intergenic
1142312024 16:89319751-89319773 GCCTGCAGGCGGGTCCTGGGAGG - Intronic
1142745633 17:1956210-1956232 GCCTGCACCCCGCTGGGTGGTGG - Intronic
1142840268 17:2623099-2623121 GCCTCCAGGCCTGTGATGGGAGG + Intronic
1142852607 17:2711524-2711546 GCCAGCGGGCCGCTGGGCGGGGG - Intronic
1143084530 17:4405878-4405900 GCCTGCAGGCAGCGGGGTGGAGG + Intergenic
1143210895 17:5186460-5186482 GCCTCCAGGCCTGTGATGGGAGG + Intronic
1143742260 17:8963379-8963401 GCCAGCAGGCCCCTGATGGATGG + Intronic
1143935763 17:10482289-10482311 GCCTCCAGGCCTGTGATGGGAGG + Intergenic
1145077596 17:19868159-19868181 GGCTCCAGGCCGCTGGGAGGCGG + Intergenic
1145750062 17:27349238-27349260 GCCAGGAGGCCGCTGGGAGGAGG + Intergenic
1145936542 17:28717781-28717803 GCCCGCAGGCCGCTGGAGGAGGG + Intronic
1146149415 17:30454021-30454043 GCCTCCAGGCCTTTGATGGGAGG + Intronic
1146352996 17:32111510-32111532 GCCTGAAGGCGGCAGGTGGTGGG + Intergenic
1146391746 17:32429519-32429541 GCCTCCAGGCCTGTGATGGGAGG - Intergenic
1147609406 17:41792841-41792863 GGCTGCAGGGCTCTGGAGGGAGG + Intergenic
1147718464 17:42523168-42523190 CCCTGGAGGCCCCTGGAGGGAGG - Intergenic
1148209737 17:45800890-45800912 TCCTGAAGGCCACTGGAGGGAGG - Intronic
1148640712 17:49185265-49185287 GCCTCCAGGCCTGTGATGGGAGG - Intergenic
1149341084 17:55687187-55687209 GCCTCCAGGCCTGTGATGGGAGG - Intergenic
1149765388 17:59272585-59272607 CACTGCAGGCTGCTGGTTGGTGG - Intronic
1150203077 17:63377156-63377178 GCCTCCAGGCCTGTGATGGGAGG + Intronic
1150515683 17:65807521-65807543 TCCTCCAGGCCTATGGTGGGAGG - Intronic
1150941501 17:69698573-69698595 GCCTCCAGGCCTGTGATGGGAGG + Intergenic
1151040998 17:70861098-70861120 GCCTACAGGCCCCTGATGGGAGG - Intergenic
1151135789 17:71944879-71944901 GCCTCCAGGCCTGTGATGGGAGG - Intergenic
1151347158 17:73509103-73509125 ACCTTCAGGCCAGTGGTGGGGGG + Intronic
1152583308 17:81178538-81178560 GCCTGCAGGCCGGTGGGGGTGGG - Intergenic
1152717465 17:81906884-81906906 GCTTGCAGTGCCCTGGTGGGCGG - Exonic
1152866012 17:82723432-82723454 GCCTGCTGGCGGGGGGTGGGGGG + Intronic
1153017434 18:596805-596827 GCCTGCAGACGCCGGGTGGGCGG - Intergenic
1153017453 18:596856-596878 GCCTGCAGACGCCGGGTGGGCGG - Intergenic
1153017472 18:596907-596929 GCCTGCAGACGCCGGGTGGGCGG - Intergenic
1153017491 18:596958-596980 GCCTGCAGACGCCGGGTGGGCGG - Intergenic
1153556858 18:6323920-6323942 GCCTCCAGGCCTGTGATGGGAGG - Intronic
1153651911 18:7248423-7248445 GTCTGCAGGCCTGAGGTGGGAGG - Intergenic
1155632177 18:27906430-27906452 GCCTCCAGGCCTGTGATGGGAGG + Intergenic
1155988160 18:32252641-32252663 GCCTCCTGGCCTCTGATGGGAGG + Intronic
1156250971 18:35352440-35352462 GCCTCCAGGCCCATGATGGGAGG - Intergenic
1156375883 18:36515033-36515055 GCCTGCAGGCCGCTGGTGGGAGG - Intronic
1156817486 18:41328462-41328484 GCCTCCTGGCCTCTGATGGGAGG - Intergenic
1156914412 18:42448176-42448198 GCCTCCAGGCCTGTGATGGGAGG + Intergenic
1157223070 18:45840805-45840827 GCCTTCAGGGCACAGGTGGGTGG - Intronic
1157408776 18:47446477-47446499 GCCTTCAGGCCTGTGATGGGAGG - Intergenic
1157481783 18:48059896-48059918 CCCTACAGGCAGCTGGTGGGAGG + Intronic
1158833224 18:61303247-61303269 GCCTCCAGGCCTGTGATGGGAGG - Intergenic
1159717926 18:71849054-71849076 GCCTCCAGGCCTGTGTTGGGAGG - Intergenic
1159962462 18:74566209-74566231 GCCTCCAGGCCTGTGATGGGTGG + Intronic
1160599361 18:80001013-80001035 GCCTCCAGGCCTGTGATGGGAGG - Intronic
1160694888 19:478758-478780 GCCTGCAGCCGGCAGCTGGGCGG - Intergenic
1160811646 19:1015414-1015436 GCCTGCAGCACGCTGGGGCGTGG - Intronic
1160818632 19:1047724-1047746 GCCTCCAGGCCGTTTGGGGGTGG + Intronic
1160824645 19:1074020-1074042 GCCTGCCTGCCGCTGGGTGGGGG - Intronic
1161107840 19:2453453-2453475 GGGTGGGGGCCGCTGGTGGGGGG - Intronic
1161267328 19:3370280-3370302 GCCACCAGGCCCCGGGTGGGGGG - Intronic
1161699498 19:5787170-5787192 ACCTACAGGACGGTGGTGGGAGG + Exonic
1163138656 19:15331986-15332008 GCCGGCGGGGCGCGGGTGGGGGG - Intronic
1163346277 19:16744568-16744590 GCCTGCAGGACGTAGGTGGGAGG - Exonic
1164064757 19:21706382-21706404 GGCAGCAGGAAGCTGGTGGGAGG - Intergenic
1164447356 19:28329579-28329601 GCCTTCAGGCCTGTGATGGGAGG - Intergenic
1165153290 19:33773194-33773216 GGCAGCAGGCCCCGGGTGGGGGG + Exonic
1165329725 19:35134763-35134785 GCCAGCAGGCGGATGGAGGGCGG - Exonic
1165349748 19:35269207-35269229 GCCTGCAGGCCGCGGGGCCGGGG - Intronic
1166038916 19:40190958-40190980 GCCCGCAGCCCGCTGTTTGGGGG + Intergenic
1166297575 19:41896517-41896539 GCTTACTGGGCGCTGGTGGGTGG + Intronic
1166624101 19:44334546-44334568 GCCTTCAGGCCTGTGGTAGGAGG - Intronic
1166705023 19:44903761-44903783 CCCTGCAGGCGGCTGGGGGAAGG - Intergenic
1167110295 19:47456855-47456877 GCCTGGAGGCCGCCGGACGGCGG + Intronic
1167125518 19:47545762-47545784 GACCGCAGGCTGCTGGGGGGCGG + Exonic
1167455490 19:49595323-49595345 GCCTGCAGCCCCCTGGGTGGTGG + Exonic
1168496168 19:56853637-56853659 GCCTCCAGGCCTGTGATGGGAGG - Intergenic
1168588617 19:57614604-57614626 GGCAGCGGGGCGCTGGTGGGTGG + Intronic
925294836 2:2769525-2769547 GCCTGCAGGCCGATGGCGAGCGG + Intergenic
925527061 2:4814340-4814362 GCCTCCAGGCCTGTGATGGGAGG + Intergenic
926251865 2:11159396-11159418 GCCTGCAGGCAGCTGGGGGTGGG + Intronic
926468034 2:13215322-13215344 GCCTCCAGGCCTGTGTTGGGAGG + Intergenic
926508086 2:13740870-13740892 GCCTCCAGGCCTGTGATGGGAGG - Intergenic
926735522 2:16070624-16070646 GGGTGCAGGCCGTGGGTGGGGGG + Intergenic
926768971 2:16351287-16351309 GCCTCCAGGCCTGTGATGGGAGG - Intergenic
926929658 2:18024013-18024035 GCCTCCAGGCCTGTGATGGGAGG + Intronic
927007552 2:18866269-18866291 GCCTTCAGGCCTGTGATGGGAGG - Intergenic
927341939 2:21992581-21992603 GCCTCCAGGCCTGTGATGGGAGG + Intergenic
927554681 2:24023407-24023429 GCCGGCAGGGGGCTGGCGGGGGG + Intronic
928465535 2:31519465-31519487 GCCTCCAGGCCTGTGATGGGAGG - Intergenic
928749856 2:34458849-34458871 GCCTCCAGGCCTGTGGTGGCAGG - Intergenic
928821982 2:35372670-35372692 GCCTTCAGGCCTCTGATGGGAGG - Intergenic
928927404 2:36593696-36593718 GCCTCCAGGCCTGTGATGGGAGG + Intronic
929081556 2:38127422-38127444 GCCTCCAGGCCTGTGATGGGAGG - Intergenic
929358070 2:41050569-41050591 GCCTCCAGGCCTGTGATGGGAGG - Intergenic
929612780 2:43284263-43284285 GCCTCCTGGCCTTTGGTGGGAGG - Intronic
930404811 2:50941945-50941967 GCCTCAAGGCCTCTGATGGGAGG - Intronic
931949883 2:67350349-67350371 GCCTCCAGGCCTGTGATGGGAGG + Intergenic
931983716 2:67721700-67721722 GCCTCCAGGCCTGTGATGGGAGG - Intergenic
932524089 2:72444830-72444852 GCCTCCAGGCCCATGATGGGAGG + Intronic
932923269 2:75941747-75941769 GCCTCCAGGCCTGTGATGGGAGG - Intergenic
932956438 2:76356971-76356993 GCCTCCAGGCCTGTGATGGGAGG - Intergenic
933047550 2:77558029-77558051 GCCTCCAGGCCTGTGATGGGAGG - Intronic
933578145 2:84093047-84093069 GCCTCCAGGCCTGTGATGGGAGG + Intergenic
933720536 2:85394838-85394860 GCAAGCAGGCAGGTGGTGGGGGG + Exonic
933790716 2:85881926-85881948 GCCTCCAGGCCTGTGATGGGAGG - Intronic
934156754 2:89208282-89208304 GCCTCCAGGCTGCTGATGGAGGG + Intergenic
934210564 2:89974471-89974493 GCCTCCAGGCTGCTGATGGAGGG - Intergenic
934623959 2:95833161-95833183 GGCTGGAGGCCCCGGGTGGGAGG + Intergenic
934624018 2:95833363-95833385 GGCTGGAGGCCCCGGGTGGGAGG + Intergenic
934624141 2:95833884-95833906 GGTTGCAGGCCCCTGTTGGGAGG + Intergenic
934624477 2:95835319-95835341 GGCTGGAGGCCCCTGTTGGGAGG - Intergenic
934809154 2:97266306-97266328 GGCTGGAGGCCCCTGTTGGGAGG + Intergenic
934809569 2:97268022-97268044 GGCTGCAGGCCCCAGTTGGGAGG - Intergenic
934809759 2:97268838-97268860 GGCTGCAGGCCCCGGTTGGGGGG - Intergenic
934809837 2:97269157-97269179 GGCTGCAGGCCCCCGTTGGGAGG - Intergenic
934827860 2:97438828-97438850 GGCTGCAGGCCCCCGTTGGGAGG + Intergenic
934827936 2:97439147-97439169 GGCTGCAGGCCCCGGTTGGGGGG + Intergenic
934828351 2:97490863-97490885 GGCTGGAGGCCCCTGTTGGGAGG - Intergenic
935293698 2:101630371-101630393 GCCTGCAGACCGCAGGTGAAGGG - Intergenic
937008884 2:118543919-118543941 GCCTCCAGGCCTGTGATGGGAGG - Intergenic
937062823 2:118992921-118992943 GCCTGCAGGCCCCAGGTGCATGG + Intronic
937284334 2:120740849-120740871 TCCTGCAGGCAGCTAGAGGGAGG + Intronic
937561040 2:123223993-123224015 GCCTCCAGGCCTGTGATGGGAGG + Intergenic
937761017 2:125603884-125603906 GCCTACAGGCCTGTGATGGGAGG - Intergenic
937906579 2:127055567-127055589 GCTGGCCGCCCGCTGGTGGGAGG - Intronic
938698118 2:133853053-133853075 GCCTCCAGGCCTGTGATGGGAGG - Intergenic
938868902 2:135453265-135453287 GCCTCCAGGCCTGTGATGGGAGG + Intronic
939137674 2:138315855-138315877 GCCTCCAGGCCTGTGATGGGAGG + Intergenic
939224969 2:139353633-139353655 GCCTCCAGGCCTGTGATGGGAGG - Intergenic
939578048 2:143919414-143919436 GCCTCCAGGCCTGTGATGGGAGG - Intergenic
939667069 2:144965336-144965358 GCCTCCAGGCCTGTGATGGGAGG - Intergenic
939852882 2:147321225-147321247 GCCTTCAGGCCTGTGATGGGAGG - Intergenic
940543029 2:155046068-155046090 GCCTCCAGGCCTGTGATGGGAGG + Intergenic
941161139 2:162035733-162035755 GCCCGCAGGGTACTGGTGGGTGG + Intronic
941227280 2:162865348-162865370 GCCTCCAGGCCTTTGATGGGAGG + Intergenic
941888346 2:170552788-170552810 GCCTGCAGGCCTTTGATGGGAGG - Intronic
942283340 2:174389696-174389718 GCCTCCAGGCCTATGATGGGAGG - Intronic
942387778 2:175460566-175460588 GCCTCCAGGCCTGTGATGGGAGG - Intergenic
942724800 2:178994520-178994542 GCCTCCAGGCCTGTGATGGGAGG + Intronic
943543325 2:189244082-189244104 GCCTCCAGGCCTGTGATGGGAGG + Intergenic
943620273 2:190140700-190140722 GCCTCCAGGCCTGTGATGGGAGG + Intronic
943725487 2:191247136-191247158 GCCTGTGGGACACTGGTGGGAGG + Intronic
943944678 2:194044415-194044437 GCCTCCAGGCCTGTGATGGGAGG - Intergenic
944920977 2:204412939-204412961 GCCTCCAGGCCTGTGATGGGAGG - Intergenic
945073592 2:206015321-206015343 GCCTCCAGGCCTATGATGGGAGG - Intronic
945166687 2:206954072-206954094 GCCTCCAGGCCTGTGATGGGAGG + Intronic
945534019 2:210989585-210989607 GCCTCCAGGCCTGTGATGGGAGG - Intergenic
945618645 2:212106684-212106706 GCCTCCAGGCCTGTGATGGGAGG - Intronic
946732293 2:222721040-222721062 GCCTCCAGGCCTGTGATGGGAGG + Intergenic
947328041 2:228999489-228999511 GCCTGCAGGCCTGTGATGGGAGG - Intronic
947488236 2:230571716-230571738 GCCTCCAGGCCTGTGATGGGAGG + Intergenic
947679385 2:232016360-232016382 GCTTGCAGCCCAGTGGTGGGAGG + Intronic
947893479 2:233646262-233646284 GCCTCCAGGCCTGTGATGGGAGG + Intronic
947903060 2:233738901-233738923 GCCTCCAGGCCTGTGATGGGAGG - Intronic
947904477 2:233750566-233750588 GCCTCCAGGCCTGTGATGGGAGG - Intronic
948652810 2:239459109-239459131 GTCTCCAGCCCTCTGGTGGGAGG - Intergenic
948793048 2:240388999-240389021 TCCTGGGAGCCGCTGGTGGGTGG + Intergenic
948837656 2:240633861-240633883 GCCTCCAGGCCTGTGATGGGTGG - Intergenic
1170280138 20:14637091-14637113 GACTGGAGGGAGCTGGTGGGAGG + Intronic
1170310027 20:14982454-14982476 GCCTCCAGGCCTGTGATGGGAGG - Intronic
1170714888 20:18823034-18823056 TCCTGCAGGCTCTTGGTGGGGGG + Intronic
1170741772 20:19064942-19064964 GCCTCCAGGCCTGTGATGGGAGG - Intergenic
1170875323 20:20244604-20244626 GCCTCCAGGCCTATGATGGGAGG + Intronic
1171044077 20:21794092-21794114 GCTCTCAGGCTGCTGGTGGGAGG + Intergenic
1171399633 20:24864594-24864616 GCCTCCAGGCCTGTGATGGGAGG - Intergenic
1172028083 20:31962962-31962984 GCCTGCAGGGCCCTGGGGGAGGG + Intergenic
1172115089 20:32568856-32568878 GACTGCAGGCTGCTTGTGTGGGG + Intronic
1172130284 20:32650621-32650643 GGCTGCGGGCCCCTGCTGGGCGG - Intergenic
1172613666 20:36269197-36269219 GCCTGCAGGGAGCTGGTGGGGGG + Intronic
1172812036 20:37654977-37654999 GCCTCCAGGCCTGTGATGGGAGG + Intergenic
1173116806 20:40251433-40251455 GGCTGGAGGCAGCTGGAGGGAGG - Intergenic
1173249786 20:41358383-41358405 GCCTGCAGGCAGCTGGGGAGAGG - Intronic
1175195424 20:57239938-57239960 GCCTCCAGGCCTGTGATGGGAGG + Intronic
1175268982 20:57720433-57720455 GCCAGCAGCCCGCGGGGGGGGGG + Intergenic
1175895673 20:62334620-62334642 GCCTGCAGGGAGAAGGTGGGAGG + Exonic
1175960912 20:62635982-62636004 GCCTGCAGGCAGCAGGGGGAAGG + Intergenic
1176274512 20:64256029-64256051 CCCTGGAGGCCGCTGGGGGGAGG - Intronic
1177067904 21:16463855-16463877 GCCTCCAGGCCTGTGATGGGAGG - Intergenic
1177198679 21:17930034-17930056 GACTGCAGGCCTCTGGGGGCTGG - Intronic
1177236172 21:18392081-18392103 GCCTCCAGGCCTGTGATGGGAGG + Intronic
1177238694 21:18428469-18428491 GCCTCCAGACCTATGGTGGGAGG - Intronic
1177285210 21:19040559-19040581 GCCTCCAGGCCTGTGATGGGGGG + Intergenic
1177525672 21:22287472-22287494 GCCTCCAGGCCTTTGGTGGGAGG - Intergenic
1177839236 21:26218053-26218075 GCCTGCAGGCCTGTGATGGGAGG - Intergenic
1178082804 21:29082442-29082464 ATCTGCAGTCAGCTGGTGGGTGG + Intronic
1178143920 21:29716898-29716920 GCCTCCAGGCCTATGATGGGAGG - Intronic
1178173942 21:30075682-30075704 GCCTCCAGGCCTGTGATGGGAGG - Intergenic
1178309089 21:31514839-31514861 TCCTGCAGCCCGCAGCTGGGTGG + Intronic
1178468233 21:32868834-32868856 GCCTGCAGGCAGCTGGTCAGTGG + Intergenic
1178642193 21:34353833-34353855 GCGTGCAGGCCACAGGTGTGTGG - Intergenic
1178832966 21:36071616-36071638 ACCTGCAGGATCCTGGTGGGTGG - Intronic
1179452994 21:41478246-41478268 TCCTGGAGGCCGCTGGTGGAGGG - Intronic
1179936639 21:44610284-44610306 GCCTCCAGGCCTCTGATGGGAGG - Intronic
1180063782 21:45402806-45402828 GCCTCCAGGACCCTGGTGGAGGG + Intergenic
1180153394 21:45964785-45964807 GCCTCCAGGCCTGTGATGGGAGG - Intergenic
1180929510 22:19579333-19579355 GCCTGAAGGCCCCAGTTGGGTGG + Intergenic
1181024092 22:20117752-20117774 GCCTGCAGGCCGGCGGAGGTTGG - Intronic
1182145247 22:27993361-27993383 GCTGGCAGGCCACTGGTTGGGGG + Exonic
1182766164 22:32759943-32759965 GGGTGCTGGCTGCTGGTGGGTGG - Intronic
1182766223 22:32760111-32760133 GGGTGCTGGCTGCTGGTGGGTGG - Intronic
1182799983 22:33024186-33024208 GTCTGGAGGGTGCTGGTGGGTGG - Intronic
1182945260 22:34316076-34316098 GCCTCCAGGCCTGTGATGGGAGG - Intergenic
1183647370 22:39134432-39134454 TCCTGCAGGCGGCTGGCGAGTGG - Exonic
1184348709 22:43928955-43928977 GCCTGCAGGGCACTGGTGTCGGG + Intronic
1184713304 22:46265797-46265819 GCCTCCAGGCCTGTGATGGGAGG + Intergenic
1184786420 22:46674110-46674132 GCCTGCAGGGCGCTGGCAGGGGG + Intronic
1184788063 22:46681289-46681311 GCCTGTGGGCCGAGGGTGGGTGG - Intergenic
1184831805 22:46993676-46993698 GCCTGCGGGCAGCTGCTGGGAGG + Intronic
1185331143 22:50252538-50252560 GCCAGCAGGTCCCTGGGGGGAGG - Intronic
950417726 3:12877887-12877909 GCCTGCAGGCCGCCTGTGACTGG + Intergenic
950503288 3:13377693-13377715 GCCTGCAGGTGGGTGGTGTGGGG - Intronic
950503333 3:13377825-13377847 GCCTGCAGGTGGGTGGTGTGGGG - Intronic
950503341 3:13377847-13377869 GCCTGCAGGTGGGTGGTGTGGGG - Intronic
950503356 3:13377891-13377913 GCCTGCAGGTGGGTGGTGTGGGG - Intronic
950503364 3:13377913-13377935 GCCTGCAGGTGGGTGGTGTGGGG - Intronic
950798050 3:15527142-15527164 GCCTCCCGCCTGCTGGTGGGAGG - Intergenic
951358995 3:21702442-21702464 GCCTCCAGGCCTGTGATGGGAGG + Intronic
951756495 3:26096666-26096688 GCCTCCAGGCCTGTGATGGGAGG + Intergenic
952715131 3:36472319-36472341 GCCTCCAGGCCTGTGATGGGAGG + Intronic
953095025 3:39766612-39766634 GCCTCCAGGCCAGTGATGGGAGG + Intergenic
953420469 3:42749910-42749932 GCCTGCAGGCCTCTGGAGTGTGG + Intronic
953898540 3:46823542-46823564 GCCTCCAGGCCTGTGATGGGAGG + Intergenic
954238318 3:49274139-49274161 TCCTGCAGCCCCCAGGTGGGGGG + Exonic
954379956 3:50214072-50214094 GGCTGCAGGCCTCAGGTAGGAGG + Intronic
956169584 3:66422118-66422140 GCCTCCAGGCCTGTGATGGGAGG + Intronic
956185727 3:66560122-66560144 GCCTCCAGGCCTGTGATGGGAGG + Intergenic
957495070 3:80982145-80982167 GCCTCCAGGCCTTTGATGGGAGG - Intergenic
957524088 3:81357956-81357978 GCCTCCAGGCCTGTGATGGGAGG - Intergenic
957787415 3:84900904-84900926 GCCTTCAGGCCTGTGATGGGAGG - Intergenic
957922614 3:86765315-86765337 CCTTTCAGGCCGCTGGTGGAAGG + Intergenic
958085033 3:88795729-88795751 GCCTCCAGGCCTGTGATGGGAGG + Intergenic
958893488 3:99805380-99805402 GCCTCCAGGCCTGTGATGGGAGG + Intergenic
959140991 3:102486758-102486780 GCCTCCAGGCCTGTGATGGGAGG - Intergenic
959562563 3:107799242-107799264 GCCTGCAGGCTGCATGTGGCTGG - Intronic
960060181 3:113312613-113312635 GCCTCCAGGCCTGTGATGGGAGG - Intronic
960563895 3:119114108-119114130 GCCTCCAGGCCTGTGATGGGAGG + Intronic
960564451 3:119118533-119118555 GCCTCCAGGCCTCTGATGGGAGG + Intronic
961362036 3:126374069-126374091 GCCTGCAGGCTGGTGAGGGGAGG - Intergenic
961366478 3:126402803-126402825 GCCTGGGGGTCGGTGGTGGGGGG + Intronic
961379164 3:126486192-126486214 GCCTCTAGGCAGCAGGTGGGTGG - Intronic
961781947 3:129325554-129325576 GCCTGCAGGTGGGTGGTGTGGGG - Intergenic
961961928 3:130864564-130864586 GCCTCCAGGCCTGTGATGGGAGG - Intronic
962057293 3:131886089-131886111 GCCTTCAGGCTGGTGATGGGAGG - Intronic
962162221 3:133011914-133011936 GCCTCCAGGCCTGTGATGGGAGG + Intergenic
962402941 3:135077235-135077257 GGCTGCAGGCCACTGGTGTGAGG + Intronic
962509434 3:136084141-136084163 GCCTCCAGGCCTGTGATGGGAGG - Intronic
962768895 3:138594214-138594236 CCCGGCTGGCTGCTGGTGGGAGG - Exonic
963297063 3:143557993-143558015 GCCTCCAGGCCTGTGATGGGAGG - Intronic
963391203 3:144665862-144665884 GCCTCCAGGCCTGTGATGGGAGG + Intergenic
963422134 3:145073579-145073601 GCCTTCAGGCCTGTGATGGGAGG + Intergenic
963593042 3:147286757-147286779 GCCTCCAGGCCTGTGATGGGAGG + Intergenic
964737856 3:159934473-159934495 GCCTCCAGGCCTGTGATGGGAGG + Intergenic
964792962 3:160470317-160470339 GCCTCCAGGCCTGTGATGGGAGG - Intronic
964795915 3:160496758-160496780 TACTGCAGTCCTCTGGTGGGAGG + Exonic
964836115 3:160940413-160940435 GCCTCCAGGCCTGTGATGGGAGG - Intronic
964989162 3:162785219-162785241 GCCTCCAGGCCTGTGATGGGAGG + Intergenic
965083377 3:164064478-164064500 GCCTCCAGGCCTATGATGGGAGG - Intergenic
965146618 3:164913151-164913173 GCCTCCAGGCCTGTGATGGGAGG + Intergenic
965397324 3:168174739-168174761 GGCTCCAGGCCTGTGGTGGGAGG + Intergenic
965455653 3:168896653-168896675 GCCTCCAGGCCTGTGATGGGAGG + Intergenic
965499967 3:169445233-169445255 GCCTCCAGGCCTGTGATGGGAGG - Intronic
965809713 3:172579152-172579174 GCCTCCAGGCCTGTGATGGGAGG - Intergenic
965990369 3:174810840-174810862 GCCTCCAGGCCTGTGATGGGGGG - Intronic
966074995 3:175924964-175924986 GCCTCCAGGCCTGTGATGGGAGG + Intergenic
967505291 3:190246352-190246374 GCCTACAGGCCTGTGATGGGTGG + Intergenic
967635056 3:191791157-191791179 GCCTCCAGGCCTGTGATGGGAGG + Intergenic
967987102 3:195103437-195103459 GGACGCAGGCCGCTGGTGTGGGG - Intronic
968381683 4:101778-101800 GCCTGGAAGCCTCTGCTGGGAGG + Intergenic
968882171 4:3306771-3306793 TCCTGGGGGACGCTGGTGGGTGG + Intronic
968884732 4:3321710-3321732 GCCTGCAGTCCACTGGGGGGAGG - Intronic
969177083 4:5406798-5406820 GCCTCCAGGCCTATGATGGGAGG + Intronic
969313549 4:6368253-6368275 GGCTGCAGGCCTCAGGTCGGTGG - Intronic
969403362 4:6971994-6972016 GCCTTCAGGCCTCTGGTTGCTGG + Intronic
969444090 4:7234288-7234310 GCCTGCTGGCAGCTGGAGGGTGG - Intronic
969651304 4:8469785-8469807 CCCTGAAGGCCGCCTGTGGGCGG - Intronic
969686909 4:8680717-8680739 GCCTGCAAGCCTCTGGAGGCAGG - Intergenic
970047871 4:11876308-11876330 GCCTCCAGGCCTGTGATGGGAGG + Intergenic
970217669 4:13776686-13776708 GCCTCCAGGCCTTTGATGGGAGG + Intergenic
970344073 4:15136189-15136211 GCCTCCAGGCCTGTGATGGGAGG + Intergenic
970382159 4:15518898-15518920 GCCTTCAGGCCTGTGATGGGAGG + Intronic
970554265 4:17215395-17215417 GCCTCCAGGCCTGTGATGGGAGG + Intergenic
970877349 4:20886429-20886451 TTCTGCAGGTAGCTGGTGGGTGG + Intronic
971948642 4:33315139-33315161 GCCTCCAGGCCTGTGTTGGGAGG - Intergenic
971962497 4:33507407-33507429 GCCTTTAGGCCTGTGGTGGGAGG - Intergenic
974012989 4:56624499-56624521 GCCTCCAGGCCTGTGATGGGAGG - Intergenic
974395059 4:61323250-61323272 GCCTTCAGGCCTGTGATGGGAGG + Intronic
974495009 4:62615123-62615145 GCCTCCAGGCCTGTGATGGGAGG + Intergenic
974843348 4:67323177-67323199 GCCTTCAGGCCTGTGATGGGAGG - Intergenic
975729276 4:77321498-77321520 GCCTCCAGGCCTGTGATGGGAGG + Intronic
976000824 4:80371284-80371306 GCCTCCAGGCCTGTGATGGGAGG + Intronic
976057048 4:81081222-81081244 GCCTCCAGGCCTGTGATGGGAGG - Intergenic
976273385 4:83252128-83252150 GGCTGCAGTCCACTGGAGGGTGG + Intergenic
976286476 4:83375730-83375752 GCCTCCAGGCCTGTGATGGGAGG + Intergenic
976405654 4:84658360-84658382 GCCTCCAGGCCTGTGATGGGAGG + Intergenic
976842322 4:89445796-89445818 GCCTCCAGGCCTCTGATGGGAGG + Intergenic
976988109 4:91327505-91327527 GCCTCCAGGCCTGTGATGGGAGG + Intronic
977063841 4:92288564-92288586 GCCTCCAGGCCTGTGATGGGAGG + Intergenic
977415940 4:96733276-96733298 GCCTCCAGGCCTGTGATGGGAGG - Intergenic
977512003 4:97973602-97973624 GCCTCCAGGCCTGTGATGGGAGG - Intronic
977545007 4:98367063-98367085 GCCTCCAGGCCTGTGATGGGAGG - Intronic
977592430 4:98841946-98841968 GCCTCCAGGCCTGTGATGGGAGG - Intergenic
978101124 4:104841626-104841648 GCCTCCAGGCCTATGATGGGAGG + Intergenic
978154428 4:105473561-105473583 GGCTGCAGGCCGCCGCGGGGTGG + Intronic
978234983 4:106447027-106447049 GCCTCCAGGCCTGTGGTGGGAGG + Intergenic
978330874 4:107611671-107611693 GCCTCCAGGCCTGTGATGGGAGG - Intronic
978915734 4:114124277-114124299 GCCTCCAGGCCTGTGATGGGAGG + Intergenic
978991201 4:115084504-115084526 GCCTCCAGGCCTGTGATGGGAGG - Intronic
979368053 4:119848514-119848536 GCCTCCAGGCCTGTGATGGGAGG + Intergenic
979391950 4:120138387-120138409 GCCTCCAGGCCTGTGATGGGAGG + Intergenic
979411428 4:120384416-120384438 GCCTCCAGGCCTGTGATGGGAGG - Intergenic
979895891 4:126156733-126156755 GCCTCCAGGCCTGTGATGGGAGG + Intergenic
979895911 4:126156827-126156849 GCCTCCAGGCCTGTGATGGGAGG + Intergenic
980266579 4:130524267-130524289 GCCTCCAGGCCTATGATGGGAGG + Intergenic
980346799 4:131633013-131633035 GCCTCCAGGCCTGTGATGGGAGG - Intergenic
980458248 4:133073039-133073061 GCCTCCAGGCCTGTGATGGGAGG - Intergenic
980596488 4:134962133-134962155 GCCTCCAGGCCTGTGATGGGAGG - Intergenic
980702767 4:136454619-136454641 GCCTCCAGGCCTGTGATGGGAGG - Intergenic
981356915 4:143799414-143799436 GCCTCCAGGCCTGTGATGGGAGG + Intergenic
981611491 4:146597886-146597908 GCCTGCAGGCTTGTGATGGGAGG + Intergenic
981861448 4:149361434-149361456 GCCTCCAGGCCTGTGATGGGAGG - Intergenic
982121299 4:152145843-152145865 GCCTCCAGGCCTGTGATGGGAGG + Intergenic
982301162 4:153880876-153880898 GCCTCCAGGCCTTTGATGGGAGG - Intergenic
982829603 4:160043461-160043483 GCCTCCAGGCCTGTGATGGGAGG + Intergenic
982917259 4:161227698-161227720 GCCTCCAGGCCTGTGATGGGAGG + Intergenic
983657552 4:170098430-170098452 GCCTCCAGGCCTGTGATGGGAGG + Intergenic
983968483 4:173843484-173843506 GCCTCCAGTCCTGTGGTGGGAGG - Intergenic
984556973 4:181226022-181226044 GCCTAGAGGCGGCTGGGGGGAGG - Intergenic
984944336 4:184959522-184959544 GCCACCAGGCTGCAGGTGGGAGG - Intergenic
985220268 4:187696784-187696806 GCCTCCAGGCCTGTGATGGGAGG - Intergenic
985371700 4:189292150-189292172 GCCTCCAGGCCTGTGATGGGAGG - Intergenic
985573224 5:661893-661915 GCCTGAGGGCCGCTGGGGGAGGG + Exonic
985666269 5:1182998-1183020 TCCTGCAGACAGCTGCTGGGGGG + Intergenic
985809138 5:2070427-2070449 GCCTCCAGGCCTGTGATGGGAGG - Intergenic
986105556 5:4656152-4656174 GCCTCCAGGCCTATGATGGGAGG + Intergenic
986504102 5:8430654-8430676 TCATGCAGGCCACTGCTGGGAGG - Intergenic
986706431 5:10457960-10457982 CCCTGCAGGCTGCTGGGGTGGGG - Intronic
986780179 5:11058246-11058268 GCCTCCAGGCCTGTGGTGGGAGG - Intronic
987000024 5:13651221-13651243 GCCTCCAGGCCTGTGATGGGTGG - Intergenic
987542761 5:19276630-19276652 GCCTCCAGGCCTGTGATGGGAGG - Intergenic
987545951 5:19310137-19310159 GCCTCCAGGCCTGTGATGGGAGG + Intergenic
987597477 5:20020429-20020451 GCCTCCAGGCCTTTGATGGGAGG - Intronic
987792082 5:22581188-22581210 GCCTTCAGGCCTGTGATGGGAGG - Intronic
987802880 5:22721100-22721122 GCCTTCAGGCCTGTGATGGGAGG - Intronic
987862004 5:23500688-23500710 GCCTCCAGGCCTCTAATGGGAGG + Intergenic
987881483 5:23750943-23750965 GCCTGCAGGCCTGTGATAGGAGG + Intergenic
988061413 5:26175417-26175439 GCCTCCAGGCCTGTGATGGGAGG - Intergenic
988074822 5:26338932-26338954 GCCTCCAGGCCTGTGATGGGAGG + Intergenic
988730573 5:33968768-33968790 GCCTGCAGGCATCAGGTGTGTGG + Intronic
988928522 5:36013359-36013381 GCCTCCAGGCCTGTGATGGGAGG - Intergenic
989067843 5:37481622-37481644 GCCTCCAGGCCTGTGATGGGAGG + Intronic
990291210 5:54354066-54354088 GCCTCCAGGCCTGTGATGGGAGG - Intergenic
990526031 5:56628799-56628821 GCCTCCAGGCCTGTGATGGGAGG - Intergenic
990545162 5:56815352-56815374 GCCCGGCGGCCGCAGGTGGGAGG - Intergenic
990701110 5:58475635-58475657 GCCTCCGGGCCTCTGATGGGAGG + Intergenic
991116894 5:62964641-62964663 GCCTCCAGGCCTGTGATGGGAGG + Intergenic
991122501 5:63032467-63032489 GCCTCCAGGCCTGTGATGGGAGG - Intergenic
991184903 5:63795186-63795208 GCCTCCAGGCCTGTGATGGGAGG + Intergenic
991293745 5:65059731-65059753 GCCTCCGGGCCGGTGATGGGAGG - Intergenic
991355797 5:65767508-65767530 GCCTCCAGGCCTGTGATGGGAGG + Intronic
991484468 5:67120146-67120168 GCCTGGAGGCCAGTGTTGGGTGG + Intronic
993146094 5:84095862-84095884 GCCTTCAGGCCTATGATGGGAGG - Intronic
993285471 5:85990939-85990961 GCCTCCAGGCCTGTGATGGGAGG - Intergenic
994425159 5:99576340-99576362 GCCTCCAGGCCTGTGATGGGAGG - Intergenic
994436179 5:99735893-99735915 GCCTCCAGGCCTGTGATGGGAGG + Intergenic
994580314 5:101632963-101632985 GCCTCCAGGCCTGTGATGGGAGG + Intergenic
994849525 5:105036225-105036247 GCCTTCAGGCCTGTGATGGGAGG + Intergenic
995055364 5:107753579-107753601 GCCTCCAGGCCTGTGATGGGAGG - Intergenic
995370179 5:111409483-111409505 GCCTCCAGGCCTGTGATGGGAGG + Intronic
996030973 5:118703452-118703474 GCCTCCAGGCCTGTGATGGGAGG + Intergenic
996036342 5:118762796-118762818 GCCTGGAGACCTCTGTTGGGAGG - Intergenic
996248172 5:121291931-121291953 CCTTGCAGGCAGCTGGTGGGAGG + Intergenic
996670558 5:126112999-126113021 GCCTCCAGGCCTGTGATGGGAGG - Intergenic
996829216 5:127720971-127720993 GCCTCCAGGCCTATGATGGGAGG + Intergenic
997016262 5:129938276-129938298 GCCTCCAGGCCTGTGATGGGAGG + Intronic
997081665 5:130746802-130746824 GCCTCCAGGCCTGTGATGGGAGG - Intergenic
997181459 5:131832919-131832941 GCCTCCAGGCCTGTGATGGGAGG + Intronic
997182348 5:131843206-131843228 GCCTCCAGGCCTGTGATGGGAGG + Intronic
997362659 5:133305191-133305213 GCCTGCAAGCCGCTGGAGAGGGG - Intronic
997789291 5:136742928-136742950 GCCTGCAGGCCTGTGATGGGAGG - Intergenic
998139807 5:139693358-139693380 GGCTCCAGGCTGCTGGTGGGAGG + Intergenic
998167658 5:139853501-139853523 GCCTGCAGGCTTCAGGAGGGTGG - Intronic
998402409 5:141854600-141854622 GCCAGTAGGTCGATGGTGGGAGG - Intronic
998813979 5:145993751-145993773 GCCTCCAGGCCTGTGATGGGAGG + Intronic
998873520 5:146576008-146576030 GTCTCCAGGCCTGTGGTGGGAGG + Intergenic
999541038 5:152572941-152572963 GCCTACAGGCCTGTGATGGGTGG - Intergenic
1000777921 5:165442408-165442430 GCCTCCAGGCCTGTGATGGGAGG + Intergenic
1001269869 5:170302996-170303018 TCCTGCCGGCCGTGGGTGGGAGG + Intergenic
1002044845 5:176536190-176536212 GCCTGGAGGCCGCTGAGGGCCGG + Intronic
1002206781 5:177568480-177568502 GCAGTCAGGCTGCTGGTGGGAGG + Intergenic
1002270464 5:178068469-178068491 GCTTGCAGACAGCTGGTGGGTGG + Intergenic
1002817168 6:692368-692390 GCTTCCAGGCTGCTGGTGTGCGG + Intronic
1003484468 6:6563570-6563592 GCCTCCAGGCCTGTGATGGGGGG + Intergenic
1003872616 6:10414189-10414211 GCCTGCTGGCCGCTGGGTGCGGG - Intronic
1005982944 6:30851523-30851545 GCCTCCAGGCCTGTGATGGGAGG - Intergenic
1006163423 6:32050728-32050750 GGCTGCTGGCAGCTGGTGAGGGG - Intronic
1006164042 6:32054118-32054140 GGCTGCTGGCAGCTGGTGAGGGG - Intronic
1006423551 6:33950064-33950086 GCCTGCTGGGTGCTGGTAGGAGG - Intergenic
1006451844 6:34109932-34109954 GGCAGCAGGCTGCTGGGGGGTGG - Intronic
1006478394 6:34272738-34272760 GCCTGCAGGGGGCTGGAGGACGG - Intergenic
1007636004 6:43300072-43300094 GACTGCAGGCAGCTGGGGAGCGG + Intronic
1007902197 6:45422619-45422641 GGCTGCAGGCTGCTGGAGGGGGG - Exonic
1008220912 6:48852462-48852484 GCCTCCAGGCCTGTGATGGGAGG + Intergenic
1008261042 6:49366769-49366791 GCCTCCAGGCCTGTGATGGGAGG + Intergenic
1008595791 6:53040428-53040450 CCCTGCCGGCTGTTGGTGGGAGG - Intronic
1008650051 6:53552692-53552714 GCCTCCAGGCCTATGGTGGAAGG - Intronic
1008756087 6:54797078-54797100 GCCTCCAGGCCTGTGATGGGAGG - Intergenic
1008859620 6:56133637-56133659 GCCTCCAGGCCTGTGATGGGAGG - Intronic
1009346060 6:62614112-62614134 GCCTCCAGGCCTGTGATGGGAGG - Intergenic
1009527432 6:64764520-64764542 GCCTCCAGGCCTGTGATGGGAGG + Intronic
1009637074 6:66280363-66280385 GCCTCCAGGCCTCTGATGGGAGG - Intergenic
1009792340 6:68419862-68419884 GCCTCCAGGCCTGTGATGGGAGG - Intergenic
1009804985 6:68590943-68590965 GCCTTCAGGCCTGTGATGGGAGG + Intergenic
1010263703 6:73844845-73844867 GCCTCCAGGCCTGTGATGGGAGG - Intergenic
1010610983 6:77953688-77953710 ACCTGCAGGCCTGTGATGGGTGG - Intergenic
1010611825 6:77962862-77962884 GCCTCCAGGCCTGTGATGGGAGG - Intergenic
1010978373 6:82341567-82341589 GCCTCCAGGCCTGTGATGGGAGG + Intergenic
1011041114 6:83031727-83031749 GCCTCCAGGCCTGTGATGGGAGG - Intronic
1011110583 6:83833451-83833473 GCCTCCAGGCCTGTGATGGGAGG - Intergenic
1011129717 6:84041004-84041026 GCCTCCAGGCCATGGGTGGGAGG - Intronic
1011353835 6:86453419-86453441 GCCTCCAGGCCTGTTGTGGGAGG - Intergenic
1011412729 6:87082846-87082868 GACTGCAGGAAGCTGGTTGGAGG - Intergenic
1011867912 6:91854283-91854305 GCCTCCAGGCCTATGATGGGAGG - Intergenic
1012070263 6:94604936-94604958 GCCTCCAGGCCTGTGATGGGAGG + Intergenic
1012125320 6:95420986-95421008 GCCTGCAGGCCTGTGAAGGGAGG + Intergenic
1012141455 6:95631435-95631457 GCCTCCAGGCCTGTGTTGGGAGG - Intergenic
1012254392 6:97015787-97015809 GCCTCCATGCCTCTGATGGGAGG - Intronic
1012762244 6:103317291-103317313 GCCTCCAGGCCTGTGGTGGGAGG - Intergenic
1012830762 6:104201366-104201388 GCCTCCAGGCCTATGATGGGAGG - Intergenic
1013048899 6:106512699-106512721 GCCCGGGGGCCGCTGGCGGGCGG - Exonic
1013086599 6:106863007-106863029 GCCTCCAGGCCTGTGATGGGAGG - Intergenic
1013338626 6:109191522-109191544 GCCTCCAGGCCTGTGATGGGAGG - Intergenic
1013688046 6:112609078-112609100 GCCTCCAGGCCTGTGGTAGGAGG - Intergenic
1013829579 6:114255849-114255871 GCCTCCAGGCCTGTGCTGGGAGG + Intronic
1013935329 6:115587207-115587229 GCCTCCAGGCCTGTGATGGGAGG - Intergenic
1014407422 6:121068903-121068925 GCCTCCAGGCCTGTGATGGGAGG - Intergenic
1014469948 6:121801625-121801647 GCCTTCAGGCTTCTGATGGGAGG - Intergenic
1014562979 6:122913700-122913722 GCCTCCAGGCCTGTGATGGGAGG - Intergenic
1014714514 6:124848912-124848934 GCCTCCAGGCCTGTGATGGGAGG - Intergenic
1014771119 6:125458706-125458728 GCCTCCAGGCCTGTGATGGGAGG + Intergenic
1014861189 6:126470149-126470171 GCCTCCAGGCCTGTGATGGGAGG - Intergenic
1015004413 6:128261636-128261658 GCCTGCAGGTGGCTGGTTAGTGG - Intronic
1015372001 6:132464868-132464890 ACCTCCAGGCCCCTGGAGGGTGG - Intronic
1016122716 6:140363954-140363976 GCCTCCAGGCCTATGATGGGAGG - Intergenic
1016291671 6:142534668-142534690 GCCTCCAGGCCTATGATGGGAGG - Intergenic
1016411224 6:143785921-143785943 GCCTTCAGGCCTGTGATGGGAGG + Intronic
1017547592 6:155468518-155468540 GCCTCCAGGCATGTGGTGGGAGG + Intergenic
1017590634 6:155974930-155974952 ACCTGCAGGCCCCTGATGTGGGG - Intergenic
1017654485 6:156614222-156614244 GCCTCCAGGCCTATGATGGGAGG + Intergenic
1017690708 6:156961456-156961478 GCCAGCAAGCCGCTGCTGGCGGG - Intronic
1017789095 6:157780078-157780100 GCCTGCAGACCTCTGGTGACAGG + Intronic
1018376674 6:163219589-163219611 GACTGCAGGCCGCAGTGGGGAGG - Intronic
1018480980 6:164190075-164190097 GCCTGCAGGGAGCAGGTGCGAGG - Intergenic
1018502083 6:164422307-164422329 GCCTCCAGGCCTGTGATGGGAGG - Intergenic
1018930870 6:168239533-168239555 GCCTGCAGGCCGCTGAGGCCTGG - Intergenic
1019150466 6:170002020-170002042 GCCTCCAGGCCTGTGATGGGAGG + Intergenic
1019174429 6:170153012-170153034 GCCTCCAGCCAGCCGGTGGGGGG - Intergenic
1019174677 6:170154073-170154095 GCCTGCAGGCCTGGGCTGGGAGG - Intergenic
1019735668 7:2648740-2648762 GCCTGCAGTAGGGTGGTGGGGGG + Intronic
1020001541 7:4759091-4759113 GTCTGCAGGCCGCCGGAGCGAGG - Exonic
1020407734 7:7855625-7855647 GCCTCCAGGCCTGTGGTGGGAGG + Intronic
1020513578 7:9089802-9089824 GTCTGCAGGCCTCTGTTGTGAGG - Intergenic
1020611345 7:10401517-10401539 GCCTCCAGGCCCGTGATGGGAGG + Intergenic
1021275665 7:18647917-18647939 GCCTGGTGGCTGCTGTTGGGTGG - Exonic
1021646792 7:22796642-22796664 GCCTCCAGGCCTGTGATGGGAGG + Intergenic
1021882783 7:25110656-25110678 GCCTGCAGGCCTGTAATGGGAGG - Intergenic
1023015762 7:35967910-35967932 GCATGCAGGCAGGTGGTGTGTGG - Intergenic
1023188592 7:37555706-37555728 GCCTCCAGGCCTGTGATGGGTGG + Intergenic
1023873420 7:44274702-44274724 GCCTACAGTCTGCTGGCGGGTGG + Intronic
1023887925 7:44374308-44374330 GTCTGCAGGCCCCAGGTGGCAGG + Intergenic
1023930495 7:44702455-44702477 GCCTGGTGACCCCTGGTGGGTGG - Intronic
1024415948 7:49107582-49107604 GCCTCCAGGCCTGTGATGGGAGG - Intergenic
1024487122 7:49931785-49931807 GCCTCCAGGCCTGTGATGGGAGG - Intronic
1025038518 7:55619060-55619082 GCCTCCAGGCCTGTGATGGGAGG - Intergenic
1026033559 7:66815659-66815681 GCCTACAGGTGGATGGTGGGGGG - Intergenic
1026522172 7:71127076-71127098 GACTGAAGGCCGCTGGTCTGGGG - Intergenic
1026941305 7:74289490-74289512 GCGCGCAGGCGGCTGCTGGGCGG + Exonic
1026979440 7:74517959-74517981 GCCTGCAGGCTGGGGGTGGGTGG - Intronic
1027395290 7:77747370-77747392 GCCTCCAGGCCTGTGATGGGAGG - Intronic
1027586729 7:80066854-80066876 GCCTCCAGGCCTGTGATGGGAGG + Intergenic
1027831522 7:83183128-83183150 GCCTCCAGGCCTGTGATGGGAGG + Intergenic
1028207187 7:88031726-88031748 GCCTCCAGGCCTGTGATGGGAGG - Intronic
1028516320 7:91681249-91681271 GCCTCCAGGCCTGTGATGGGAGG + Intergenic
1029047428 7:97645152-97645174 GCCTGCAGGCCTGTGATGGGAGG - Intergenic
1029519609 7:101051792-101051814 TCCGGCAGTCCTCTGGTGGGGGG - Exonic
1030357363 7:108557153-108557175 GCCTCCAGGCCTGTGATGGGAGG + Intronic
1030415436 7:109238000-109238022 GCCTCCAGGCCTATGATGGGAGG - Intergenic
1030527694 7:110673365-110673387 GCCTCCAGGCCTGTGATGGGAGG + Intronic
1030986249 7:116245053-116245075 GCCTCCAGGCCTGTGATGGGAGG + Intronic
1031573072 7:123383265-123383287 GCCTCCAGGCCTGTGATGGGAGG - Intergenic
1031608196 7:123794431-123794453 GCCTCCAGGCCTGTGATGGGAGG - Intergenic
1031818732 7:126472731-126472753 GCCTCCAGGCCTGTGATGGGAGG - Intronic
1032318226 7:130860987-130861009 GCCTCCAGGCCTGTGATGGGAGG - Intergenic
1032454002 7:132058187-132058209 GCCTCCAGGCCTATGATGGGAGG - Intergenic
1033129675 7:138735140-138735162 TCGTGCAGGGGGCTGGTGGGTGG + Intronic
1033342366 7:140502096-140502118 GCTTGCAGCCAGCTGGTGGCTGG + Intergenic
1033419769 7:141195068-141195090 GCCTCCAGGCCTGTGATGGGAGG + Intronic
1033760034 7:144427762-144427784 GCCTCCAGGCCTGTGATGGGAGG + Intergenic
1034011278 7:147531648-147531670 GCCTCCAGGCCTGTGATGGGAGG + Intronic
1034751838 7:153576260-153576282 GCCTCCAGGCCTGTGGTGGGAGG - Intergenic
1034876195 7:154726589-154726611 GCCTCCAGGCCTGTGATGGGAGG + Intronic
1034967450 7:155400098-155400120 GACTCTAGGCTGCTGGTGGGAGG - Intergenic
1035181130 7:157090467-157090489 GCCTGCAGGGCCCTGGCTGGAGG + Intergenic
1035425928 7:158773149-158773171 GCCTGCCGGGAGCTGCTGGGAGG - Intronic
1035459319 7:159029581-159029603 GCCTGCGGGCCCCTGGTGATGGG - Exonic
1035549518 8:509637-509659 GCCTCCAGGCCTGTGATGGGAGG + Intronic
1035754668 8:2022512-2022534 GCCTGCAGGTCCCAGGAGGGTGG + Intergenic
1036202141 8:6778735-6778757 ACCTGCAGGATGCTGGTGGCTGG - Intergenic
1036917833 8:12821642-12821664 GCCCGCAGGCCACTGGCTGGTGG - Intergenic
1037205965 8:16320633-16320655 GCCTCCAGGCCTGTGATGGGAGG - Intronic
1038309351 8:26434119-26434141 GGATGCAGGCGGCTGGTGGCGGG + Intronic
1038446865 8:27610653-27610675 TGCTGCAGGCAGCAGGTGGGCGG - Intronic
1038880502 8:31605666-31605688 GCCTTCAGGCCTGTGATGGGAGG + Intergenic
1039071337 8:33651901-33651923 GCCTCCAAGCCTGTGGTGGGAGG - Intergenic
1039107455 8:34004504-34004526 GCCTCCAGGCCTGTGATGGGAGG + Intergenic
1039121901 8:34157271-34157293 GCCTCCAGGCCTGTGATGGGAGG - Intergenic
1039918616 8:41877326-41877348 GCCAGCAGGCTGCTGATGGTGGG + Intronic
1040401163 8:47051335-47051357 GCCTTCAGGCCTTTGATGGGAGG - Intergenic
1040813367 8:51481583-51481605 GCCTCCAGGCCAGTGATGGGAGG - Intronic
1041013797 8:53571010-53571032 GCCTCCAGGCCTGTGATGGGAGG - Intergenic
1041059518 8:54022368-54022390 GACTGCAGATCGCTGGTGAGGGG + Exonic
1042028842 8:64452072-64452094 GGCTGCCTGCAGCTGGTGGGTGG - Intergenic
1042602487 8:70512389-70512411 GCCTCCAGGCCTGTGATGGGAGG - Intergenic
1042646125 8:70988102-70988124 GCCTCCAGGCCTGTGATGGGAGG + Intergenic
1043426059 8:80150023-80150045 GCCTCCAGGCCTGTGATGGGAGG - Intronic
1043518511 8:81019383-81019405 GCCTCCAGGCCTGTGATGGGAGG - Intronic
1043776685 8:84278381-84278403 GCCTCCAGGCCTGTGATGGGAGG + Intronic
1044066610 8:87706500-87706522 GCCTCCAGGCCTGTGATGGGAGG + Intergenic
1044303890 8:90616376-90616398 GCCTCCAGGCCTGTGATGGGAGG - Intergenic
1044324880 8:90847886-90847908 GCCTCCAGGCCTGTGATGGGAGG + Intronic
1044326870 8:90868912-90868934 GCCTCCAGGCCTATGATGGGAGG - Intronic
1044945447 8:97384783-97384805 GCCTCCAGGCCTATGATGGGAGG + Intergenic
1045050539 8:98320229-98320251 GCCTCCAGGCCTGTGATGGGAGG + Intergenic
1045053650 8:98349888-98349910 GCCTCCAGGCCTGTGATGGGAGG + Intergenic
1045207365 8:100056466-100056488 GCCTCCAGGCCTATGATGGGAGG - Intronic
1045617933 8:103939493-103939515 GCCTCCAGGCCTGTGATGGGAGG + Intronic
1046226383 8:111285763-111285785 GCCTCCAGGCCTGTGATGGGAGG + Intergenic
1046433171 8:114154074-114154096 GCCTTCAGGCCTGTGATGGGAGG + Intergenic
1046735117 8:117768557-117768579 GCCTCCAGGCCTGTGATGGGAGG - Intergenic
1047219865 8:122910719-122910741 GTGTGCAGGCCCCTGCTGGGGGG + Intronic
1048295473 8:133210596-133210618 GCCTGCAGCCCCCTGCAGGGAGG - Intronic
1048478966 8:134770038-134770060 GCCTTCAGGCCTGTGATGGGAGG + Intergenic
1048668382 8:136689758-136689780 GCCTCCAGGCCTGTGATGGGAGG + Intergenic
1049076258 8:140398878-140398900 GCCTCCAGGCCTGTGATGGGAGG - Intronic
1049100821 8:140577871-140577893 TCCTGCAGGCCCCTGGAGGCGGG + Intronic
1049230275 8:141478228-141478250 GGCTGGAGGCCACTGGTGTGAGG + Intergenic
1049578360 8:143399947-143399969 GCCTGCAGTCTGCTGGGGGCTGG + Intergenic
1049594582 8:143477519-143477541 GCCTGCAGGCACCTGGAGGCCGG - Intronic
1049689608 8:143952880-143952902 GCCTGCAGGCCCCTGGCTGGTGG - Intronic
1050121523 9:2313673-2313695 GCCTCCAGGCCTGTGATGGGAGG - Intergenic
1050674573 9:8037123-8037145 GCCTCCAGGCCTGTGATGGGAGG + Intergenic
1050952748 9:11618373-11618395 GCGTGCGGGCCTCAGGTGGGAGG - Intergenic
1051604463 9:18906671-18906693 GCCTGCAGGAGGATGGTGGCAGG - Exonic
1051619467 9:19036426-19036448 GCCTGCGGGCCTGTGATGGGAGG - Intronic
1051767506 9:20540681-20540703 GCCTCCAGGCCAGTGATGGGAGG + Intronic
1051914992 9:22198008-22198030 GCCTCCAGGCCTGTGATGGGAGG - Intergenic
1051946181 9:22572764-22572786 GCCTGCAGGCCTGTGATGGGAGG - Intergenic
1052079117 9:24180793-24180815 GCCTCCAGGCCTGTGATGGGAGG + Intergenic
1052294521 9:26882287-26882309 GCCTCCAGGCCTGTGATGGGAGG - Intronic
1052625039 9:30963254-30963276 GCCTCCAGGCCTGTGATGGGAGG + Intergenic
1052969468 9:34368224-34368246 GCCTCCAGGCCTGTGATGGGAGG + Exonic
1053270985 9:36749407-36749429 GCCTCTGGGCCGCTGCTGGGAGG - Intergenic
1053616431 9:39770801-39770823 GCCTCCAGGCCTGTGATGGGAGG + Intergenic
1053625578 9:39867600-39867622 GCCTCCTGGCCTCTGATGGGAGG - Intergenic
1054218310 9:62383101-62383123 GCCTCCTGGCCTCTGATGGGAGG + Intergenic
1054237086 9:62571588-62571610 GCCTCCAGGCCTGTGATGGGAGG - Intergenic
1054551225 9:66606099-66606121 GCCTCCAGGCCTGTGATGGGAGG - Intergenic
1054811828 9:69441239-69441261 GCCTGCAGGCCTCTGGTGCCTGG + Intronic
1055141943 9:72886533-72886555 GCCTCCAGGCCTGTGATGGGAGG - Intergenic
1055858849 9:80724404-80724426 GCCTGCAGGCCTGTGATAGGAGG + Intergenic
1056012417 9:82346187-82346209 GCCTCCAGGCCTGTGATGGGAGG - Intergenic
1056527360 9:87455637-87455659 GCCTCCAGGCCTGTGATGGGAGG + Intergenic
1057061024 9:92003946-92003968 GGCTGCGGGCCCCTGGCGGGGGG + Intergenic
1057908347 9:98999370-98999392 ACCTGCAGGAAGGTGGTGGGAGG + Intronic
1058181676 9:101807557-101807579 GCCTGCAGGCCTGTGATGGGAGG - Intergenic
1058385310 9:104429201-104429223 GCCTGCAGGCCTGTGATGGGAGG - Intergenic
1058868623 9:109183717-109183739 GCCTGCAGCCCTCTGCTGGCGGG - Intronic
1058956248 9:109951515-109951537 GCCTGAAGTCCGCTAGTGGCAGG - Intronic
1059587300 9:115619913-115619935 GCCTCCAGGCCTGTGATGGGAGG + Intergenic
1060234625 9:121853613-121853635 GACTGCAGGCAGCTGGGGGCCGG + Intronic
1060531861 9:124352225-124352247 GCCTGCAGGCAGCAGGTGTCAGG - Exonic
1061116322 9:128615046-128615068 GCCTTCAGGCTCCTGGTGGTGGG + Intronic
1061405320 9:130390548-130390570 GCCTGAAGGCCGGGAGTGGGAGG + Intronic
1061453483 9:130681538-130681560 GCCTGCAGCGCGGTGCTGGGCGG - Exonic
1062194625 9:135266044-135266066 GCCAGGAGGCTGCTGGTGAGGGG + Intergenic
1062346282 9:136116833-136116855 GCATGCAGGCAGGTGGTGTGCGG + Exonic
1062384989 9:136305663-136305685 GCCTCCAGGCAGCTGCTGAGTGG - Intronic
1062438731 9:136559461-136559483 GCCTCCAGGCCTGTGATGGGAGG - Intergenic
1062452329 9:136620909-136620931 GCCCGCAGGCCTCTGCCGGGAGG + Intergenic
1062562327 9:137147015-137147037 GCCTGTCGGGCGCTGGGGGGAGG - Intronic
1062564862 9:137159801-137159823 GCCTGGAGGCTGAGGGTGGGCGG + Intronic
1062616992 9:137401796-137401818 GCCTCCAGGCCTATGATGGGAGG + Intronic
1062670056 9:137703204-137703226 GCCTCCAGGCCTGTGATGGGAGG + Intronic
1185476235 X:417214-417236 GCATGTAGGGAGCTGGTGGGCGG + Intergenic
1185781141 X:2847914-2847936 TCCTGCCGGCATCTGGTGGGCGG - Intronic
1185871671 X:3669981-3670003 TGCTCCTGGCCGCTGGTGGGTGG + Intronic
1186700250 X:12083135-12083157 GCCTCCAGGCCTGTGATGGGAGG - Intergenic
1186742566 X:12534001-12534023 GCCTCCAGGCCTGTGATGGGAGG - Intronic
1187072403 X:15901258-15901280 GCCTCCAGGCCTGTGATGGGAGG + Intergenic
1187818220 X:23256292-23256314 GCCTGGAGACCCCTGTTGGGAGG - Intergenic
1188056086 X:25542313-25542335 GCCTTCAGGCCTGTGATGGGAGG + Intergenic
1188308032 X:28582715-28582737 GCCGGCTGGCTGCTGGTGGGAGG - Intergenic
1188449529 X:30294808-30294830 GCCTCCAGGCCTGTGATGGGAGG - Intergenic
1188753873 X:33936338-33936360 GCCTTCAGGCCTGTGATGGGAGG + Intergenic
1189071348 X:37866880-37866902 GCCTCCAGGCCTGTGATGGGAGG + Intronic
1190950567 X:55139474-55139496 GCCTTCAGGCCTGTGATGGGAGG - Intronic
1191052338 X:56207156-56207178 GCCTCCAGGCCTGTGATGGGAGG + Intergenic
1191116466 X:56857988-56858010 GCCTCCAGGCCTGTGATGGGAGG + Intergenic
1192269512 X:69565512-69565534 GCCTGCAGGAAGCTGGAGAGTGG - Intergenic
1192309383 X:69997656-69997678 GCCTCCAGGCCTGTGATGGGAGG - Intronic
1192335579 X:70216762-70216784 GCCTCCAGGCCTATGATGGGAGG - Intergenic
1192841887 X:74865620-74865642 GCCTCCAGGCCTTTGATGGGAGG - Intronic
1192887100 X:75347436-75347458 ACCTGCAGGCCTGTGATGGGAGG - Intergenic
1193188337 X:78539341-78539363 GCCTCCAGGCCTGTGATGGGAGG + Intergenic
1193221270 X:78929303-78929325 GCCTCCAGGCCTGTGATGGGAGG + Intergenic
1193406394 X:81107193-81107215 GCCTCCAGGCCTGTGATGGGAGG - Intergenic
1193478473 X:81996566-81996588 GTCTGCTGGCCCCTGTTGGGCGG - Intergenic
1193529896 X:82643421-82643443 GCCTCCAGGCCTGTGATGGGAGG + Intergenic
1193759228 X:85443472-85443494 GCCTCCAGGCCTGTGATGGGAGG + Intergenic
1193807958 X:86016375-86016397 GCCTGCAGGCCTGTGATGGGTGG - Intronic
1193938537 X:87652213-87652235 GCCTCCAGGCCTGTGATGGGAGG + Intronic
1194043376 X:88970825-88970847 GCCTTCAGGCCTGTGATGGGAGG + Intergenic
1194082952 X:89490411-89490433 GCCTCCAGGCCTGTGATGGGAGG + Intergenic
1194578519 X:95642180-95642202 GCCTCCAGGCCTGTGATGGGAGG + Intergenic
1194947945 X:100091318-100091340 GGCTGGAGGCCCCTGTTGGGAGG - Intergenic
1195210131 X:102646372-102646394 GCCTCCAGGCCTGTGATGGGAGG + Intergenic
1195228090 X:102818491-102818513 GCCTCCAGGCCTGTGATGGGAGG + Intergenic
1195863665 X:109407584-109407606 GCCTCCAGGCCTGTGATGGGAGG - Intronic
1195989194 X:110665873-110665895 GCATGCAGGGTGGTGGTGGGGGG + Intergenic
1196173602 X:112616740-112616762 GCCTCCAGGCCTGTGATGGGAGG - Intergenic
1196973915 X:121138171-121138193 GCCTCCAGGCCTGTGATGGGAGG + Intergenic
1197004498 X:121480357-121480379 GCCTCCAGGGCTTTGGTGGGAGG - Intergenic
1197016607 X:121632834-121632856 GCCTTCAGGCCTGTGATGGGTGG + Intergenic
1197092519 X:122556030-122556052 GCCTCCAGGCCTATGATGGGAGG - Intergenic
1197223089 X:123932202-123932224 GCCTCCAGGCCTGTGATGGGAGG - Intergenic
1197639793 X:128954903-128954925 GCCTCCAGGCCTGTGATGGGAGG + Intergenic
1197642845 X:128985949-128985971 GCCTCCAGGCCTGTGATGGGAGG - Intergenic
1198266539 X:135014355-135014377 GCCTGTAGGCCCCTGGTGAAGGG + Intergenic
1198274624 X:135089272-135089294 GCCTCCAGGCCTATGATGGGAGG - Intergenic
1198750308 X:139932208-139932230 GGCTGCGGGCGGCTGGGGGGCGG - Intronic
1198966837 X:142236766-142236788 GCCTCCAGGCCTCTGATGGGAGG - Intergenic
1199070445 X:143469347-143469369 GCCTCCAGGCCTGTGATGGGAGG + Intergenic
1199077921 X:143545302-143545324 GCCTCCAGGCCTGTGATGGGAGG + Intergenic
1199106538 X:143875582-143875604 GCCTCCAGGCCTGTGATGGGAGG - Intergenic
1199220582 X:145311399-145311421 GCCTCCAGGCCCGTGATGGGAGG + Intergenic
1199346540 X:146747156-146747178 GCCTCCAGGCCTGTGATGGGAGG + Intergenic
1199389365 X:147261987-147262009 GCCTCCAGGCCTGTGATGGGAGG - Intergenic
1199462607 X:148101027-148101049 GCCTCCAGGCCTGTGATGGGAGG - Intergenic
1199760177 X:150898870-150898892 GCCTGCGGGCACCCGGTGGGTGG + Intergenic
1200154724 X:153969421-153969443 CCCTGCAGGCGGCTGGGGGAGGG - Intronic
1200295416 X:154914269-154914291 GCCTCCAGGCCTGTGATGGGAGG + Intronic
1200435603 Y:3146284-3146306 GCCTCCAGGCCTGTGATGGGAGG + Intergenic
1201193981 Y:11473810-11473832 GGCTGCAGGCTGCTGATGGTGGG + Intergenic