ID: 1156376208

View in Genome Browser
Species Human (GRCh38)
Location 18:36517403-36517425
Sequence TCCCTGTGGGGTCCCCTGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 260
Summary {0: 1, 1: 0, 2: 6, 3: 38, 4: 215}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156376203_1156376208 4 Left 1156376203 18:36517376-36517398 CCAAGATTCACACTGTCTTGAAG 0: 1
1: 0
2: 1
3: 21
4: 138
Right 1156376208 18:36517403-36517425 TCCCTGTGGGGTCCCCTGCATGG 0: 1
1: 0
2: 6
3: 38
4: 215
1156376201_1156376208 26 Left 1156376201 18:36517354-36517376 CCCTGGGGTTGTGACGATGGAAC 0: 1
1: 0
2: 1
3: 8
4: 62
Right 1156376208 18:36517403-36517425 TCCCTGTGGGGTCCCCTGCATGG 0: 1
1: 0
2: 6
3: 38
4: 215
1156376202_1156376208 25 Left 1156376202 18:36517355-36517377 CCTGGGGTTGTGACGATGGAACC 0: 1
1: 0
2: 0
3: 5
4: 62
Right 1156376208 18:36517403-36517425 TCCCTGTGGGGTCCCCTGCATGG 0: 1
1: 0
2: 6
3: 38
4: 215

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156376208 Original CRISPR TCCCTGTGGGGTCCCCTGCA TGG Intronic
901156474 1:7143032-7143054 TCCCTCTGGGGTCACCTGGAGGG - Intronic
901737193 1:11320046-11320068 TCCCTGTGAGGCCCCTTGCTGGG - Intergenic
902082866 1:13833228-13833250 TCCCTGTGAAGGCACCTGCAGGG + Intergenic
902835621 1:19045000-19045022 GGCCCTTGGGGTCCCCTGCAGGG - Intergenic
903430075 1:23290130-23290152 TCCCTGAGGGGCTCCCTGAATGG + Intergenic
903778423 1:25807585-25807607 TCGCTGGCAGGTCCCCTGCAGGG + Intronic
904008217 1:27374772-27374794 TCCCTGTGGCTTCTCCTGCTTGG - Exonic
905240312 1:36576828-36576850 TCCCTGTGGAATCCCAGGCAGGG + Intergenic
907250983 1:53139351-53139373 TCTGAGTGGGGTCCCCAGCACGG - Intronic
908472052 1:64453735-64453757 TCCCAGTGGGTTCCCCTCCTTGG - Intergenic
911165892 1:94724014-94724036 ACACTGTGGGGCCCCCTGTAAGG - Intergenic
912487968 1:110043937-110043959 ACCATGTGTGGTCCTCTGCAGGG + Intronic
918134868 1:181662805-181662827 TCCCTGTAGGGTGCCATGGATGG - Intronic
922560909 1:226568939-226568961 TCCTTGTAGGGTCCCTAGCAAGG + Intronic
922726117 1:227923830-227923852 TCCCTGTGGGGCCACCAGGAGGG - Intronic
924739108 1:246784580-246784602 ACACTGAGGGGTCCCCTCCAAGG + Intergenic
1063978851 10:11437805-11437827 GCCAGGTGGGGTCCCTTGCAGGG + Intergenic
1064207510 10:13336416-13336438 TCTCTGTGGAGTCCACTCCATGG - Intronic
1066449226 10:35512777-35512799 TCCCTGTGGGGAGCTCAGCATGG + Intronic
1067095647 10:43297777-43297799 TCCATGTGGCCTCCCCAGCATGG - Intergenic
1067279438 10:44860125-44860147 GCCCAGCGGGGTCCCCTGGATGG - Intergenic
1067655925 10:48191174-48191196 TTCATGTGGGGTCTCCAGCAAGG - Intronic
1067764174 10:49072704-49072726 TCCCTGTGGTGTCACCAGCAAGG - Intronic
1069917527 10:71796509-71796531 GCCCTGAGGGGTTCCCTGGAGGG - Intronic
1069951908 10:72024874-72024896 ACCCTGTGGGGTTGCCAGCAAGG + Intergenic
1070633700 10:78106886-78106908 TGCCTGTGGGGTCTCCTGAAGGG + Intergenic
1071565718 10:86670417-86670439 GCCCTGTGGCCTCCCCTGCCTGG + Intronic
1073183612 10:101601918-101601940 TCCCTTTGTGGTCCCCTAGAGGG + Intronic
1076214767 10:128684601-128684623 TCACTGTGCAGTCTCCTGCAAGG - Intergenic
1076340384 10:129741431-129741453 TCCCTGAGGGCTCCCCTGCATGG + Intronic
1077145502 11:1042538-1042560 TCCCTTTGGGGAGCCCGGCAGGG + Intergenic
1077194886 11:1274536-1274558 TCCCTGGGCGCTACCCTGCAGGG - Exonic
1077378368 11:2216049-2216071 GCCCTGTGGGGGTCCCTGCCCGG + Intergenic
1082003540 11:47407957-47407979 ACCCTTTGGGGTCCAATGCATGG - Intronic
1083326152 11:61873967-61873989 TCCCTGTGGGTTCCCTTCCCTGG + Intronic
1084268082 11:68015128-68015150 TCCCTGTGGGGTCATCTGAGTGG + Intronic
1084380880 11:68812003-68812025 CTGCTGTGGGGTCCTCTGCAGGG - Intronic
1084542879 11:69798289-69798311 TCCCTGTGGGGTCTCCAGGTGGG + Intergenic
1087704855 11:101478680-101478702 TCCCTGTGAAGTCTCCTGCCTGG - Intronic
1091218465 11:133917673-133917695 TGACAGTGGGGTCCTCTGCAGGG - Intronic
1091648306 12:2290386-2290408 TCCCTCTGGGCAGCCCTGCAGGG + Intronic
1091800768 12:3323261-3323283 TCCCAGTGAGGTCCCCAGCAAGG - Intergenic
1092524646 12:9302307-9302329 TCCCTTGGTGGCCCCCTGCATGG + Intergenic
1092542619 12:9429505-9429527 TCCCTTGGTGGCCCCCTGCATGG - Intergenic
1095088736 12:38085300-38085322 GCTGTCTGGGGTCCCCTGCAAGG + Intergenic
1096322520 12:50627787-50627809 CCCCTGTGAGGTCACCTGCAAGG - Intronic
1099103918 12:78477665-78477687 TCCCTGAGGGGACCCCCGAAGGG - Intergenic
1101836912 12:108302347-108302369 TCCCTGTGTGTTTCCTTGCAGGG - Intronic
1102558170 12:113742543-113742565 GCTCTGTGGGGGCACCTGCAAGG + Intergenic
1103271503 12:119677446-119677468 GCCCTGTTGGGTACCCTGTAGGG - Intronic
1105214397 13:18275901-18275923 TCCTTTTGGGGTCAGCTGCAGGG - Intergenic
1106253510 13:28001808-28001830 TCCGGGTGGGGTCCCCAGCAGGG - Intergenic
1106302205 13:28478450-28478472 TCCCTGTGGGTTCCCTTAGAAGG + Intronic
1108734114 13:53264532-53264554 TCCCTGTAGGGTCCTCCTCATGG - Intergenic
1110244815 13:73310882-73310904 TCCCTGAGAGGTACCCTGCATGG + Intergenic
1112496562 13:99910361-99910383 TCCCTGTGGGGATTGCTGCAAGG + Intergenic
1112586715 13:100724945-100724967 TTGCTGTGGGGTCCCCAACAGGG + Intergenic
1112632817 13:101180689-101180711 CCCATGTGGGGCCCCCAGCAAGG + Intronic
1113108584 13:106797961-106797983 ACCTTGTGGAGTCCCCTGCCTGG - Intergenic
1113291999 13:108917384-108917406 GCCCTGTGCTTTCCCCTGCATGG + Intronic
1113723840 13:112582526-112582548 TCCCTGTGGGTTCCCCTCTCTGG - Intronic
1117192594 14:53307428-53307450 TCTCTGTGGGGTCCCTTCCTTGG + Intergenic
1121644538 14:95508812-95508834 TCCCTCTGCGGCCCCCTTCAGGG - Intergenic
1122400581 14:101465072-101465094 TCCCTCTGGGGCCCCTTGCATGG + Intergenic
1122499580 14:102187806-102187828 GCTCTGTTGGGTCCCCTGCCTGG - Intronic
1122848365 14:104513197-104513219 TCCCTGTGAGCTGCCCTGCAGGG - Intronic
1122858274 14:104570483-104570505 TCCCTGTGTGGTGCCAGGCAAGG + Intronic
1123038261 14:105480050-105480072 TCCCTCCGGGATCCCCTGCCTGG + Intronic
1202895139 14_GL000194v1_random:2410-2432 TCCCTGTGGGACCCTCAGCAGGG + Intergenic
1125283527 15:38069065-38069087 GCTCTGTGGTGTGCCCTGCAGGG - Intergenic
1127793985 15:62422974-62422996 TTCCTTTGGAGGCCCCTGCATGG + Intronic
1129059786 15:72851757-72851779 TGCTTGTGGGGTCATCTGCACGG - Intergenic
1130559271 15:84945608-84945630 TCTCTGTGGCTTCCCCTGCTGGG + Exonic
1131806373 15:96126671-96126693 TCTCTGGGGGTTCCCCTCCAGGG + Intergenic
1132689276 16:1175286-1175308 TGCATGTGGGGTCCCCTGCTGGG + Intronic
1132852500 16:2031169-2031191 TCCCTGTGGGGAGCCCAGCCTGG + Intronic
1132993824 16:2812344-2812366 TCACTGTGGGCTCCTCTGCAGGG + Intergenic
1133229631 16:4360429-4360451 CCCCTGTGTGCTCACCTGCAGGG + Exonic
1135125639 16:19807134-19807156 TCCCTATGGGGGCACCTACATGG + Intronic
1135622688 16:23969204-23969226 TCCCAGTGGGCCCCACTGCAGGG - Intronic
1136309869 16:29400337-29400359 TCCATGAGGGACCCCCTGCAAGG - Intronic
1137070602 16:35901365-35901387 TCACTCTGGGCTCCCCTGGAAGG - Intergenic
1137070687 16:35901946-35901968 TCACTCTGGGCTCCCCTGGATGG - Intergenic
1137484763 16:48881947-48881969 TCCCTGGGGTCTCCCCTGCTAGG - Intergenic
1138080940 16:54090930-54090952 TCCATGTGGGCTCTCCAGCAGGG + Intronic
1139360691 16:66397974-66397996 TTCCTGTGGGGGTTCCTGCAGGG - Exonic
1139552281 16:67680983-67681005 TCCCTGCCGGGCCCCGTGCAAGG - Intronic
1139834702 16:69828934-69828956 TCCCTGTGGTGTTCCCTGACAGG + Intronic
1140719556 16:77758969-77758991 ACCCTGTGGGGTCTCTTACAGGG + Intergenic
1143667481 17:8372721-8372743 TTCCTTTGCGGTCCCCTGAAGGG - Intronic
1144863269 17:18319007-18319029 ACCCTGGAGGGTCCCCTGCGGGG + Intronic
1145279543 17:21457713-21457735 TCCCTGTGGTGTCGCCCCCAGGG + Intergenic
1146257550 17:31400407-31400429 TTCCTGTGGCCTTCCCTGCAGGG + Intronic
1146472717 17:33137532-33137554 TCTCTCAGAGGTCCCCTGCAGGG - Intronic
1146828110 17:36041571-36041593 TCCCTGTGGTGTTTTCTGCATGG - Intergenic
1147196466 17:38770035-38770057 TCTCTGTGGGGGCCACTACATGG + Intronic
1147625755 17:41898771-41898793 TCCCAGTGGTCTTCCCTGCAAGG + Exonic
1147758786 17:42784402-42784424 TCCCTGTAGGGTCCACAGCAGGG - Exonic
1149186823 17:54008018-54008040 GCCCTCTGGAGTGCCCTGCATGG + Intergenic
1149387587 17:56157164-56157186 TCCCTTTGCTGTCCCCTGCCAGG - Intronic
1151834259 17:76572992-76573014 TTCCTCCTGGGTCCCCTGCATGG + Intronic
1153698206 18:7665101-7665123 TCCCTGAGGGGTCCCCTACCAGG - Intronic
1153752355 18:8245682-8245704 TATCTGTGTGGTCCCCTTCAAGG - Intronic
1156228166 18:35129301-35129323 TGCCTGTGGGGCCCCCTACCAGG - Intronic
1156376208 18:36517403-36517425 TCCCTGTGGGGTCCCCTGCATGG + Intronic
1156453841 18:37281792-37281814 ACCCTGGGGGGGCCACTGCATGG - Intronic
1160497589 18:79384245-79384267 CCCCAGCGGGGTCACCTGCAGGG + Intergenic
1160592312 18:79951456-79951478 GTCCTGTGGGGTCCCCGGCCCGG - Intronic
1161104532 19:2436845-2436867 TCCCTGTGAGGGCCCCTCCAGGG + Intronic
1161323491 19:3652097-3652119 ACCCTATGGGGTTCCCAGCACGG + Intronic
1161564986 19:4996990-4997012 TCCCTGTGGGCACAGCTGCATGG + Intronic
1161981912 19:7634262-7634284 TCCCAGTGGTATCCCCTGCTTGG - Intronic
1162494131 19:11013761-11013783 TCACTGTGCAGTGCCCTGCAAGG + Intronic
1163316158 19:16542126-16542148 CCCCCTTGGGGTCCCCGGCAAGG - Intronic
1163513300 19:17748439-17748461 TCACTGTGGGGTCCCCTGCCTGG + Intronic
1163745387 19:19043593-19043615 TCCCTGTGGGGGTGCCAGCAGGG + Intronic
1165707852 19:37989059-37989081 TTCCTGTGGTTTCCCCAGCACGG + Intronic
1166034171 19:40155341-40155363 TCACTGTGGTCTCCACTGCATGG - Intergenic
1166364565 19:42272047-42272069 CCCCTTTGGGGTCCTCTGCTGGG - Intronic
1167274401 19:48527838-48527860 ACCCTGTGGAGTCCCCTCCATGG - Intergenic
1168132372 19:54329767-54329789 CCCCTGTTTGGTCCCGTGCAGGG + Intergenic
1168687506 19:58357591-58357613 TTCCTCTGGGGCCACCTGCAGGG + Exonic
925088949 2:1137614-1137636 TCCCTGTCTGGTCAGCTGCAGGG - Exonic
927552104 2:24009957-24009979 TCCCTTTGGGGTGCCCTTCGCGG + Intergenic
927726063 2:25424265-25424287 CCCCTGTAGGATCCCCTGCCAGG - Intronic
928300751 2:30121869-30121891 TCCCTGCTGTGTGCCCTGCAGGG + Intergenic
929313952 2:40455075-40455097 TCCCTGTGGAGTCCCCTGAATGG - Intronic
930722954 2:54655573-54655595 TGCGTGTGTGGCCCCCTGCATGG + Intronic
932623118 2:73278112-73278134 TCCCTCTGGGATCCCATGCTAGG + Intronic
932721036 2:74139153-74139175 TCCCTGCGGGATTCCCTGGAGGG - Intronic
932819525 2:74887636-74887658 TCCCTGTGGGTTCCTTTCCAAGG + Intronic
934299926 2:91770838-91770860 TCCTTTTGGGGTCAGCTGCAGGG + Intergenic
936090833 2:109500427-109500449 TCCCTGGGGTCTTCCCTGCATGG - Intronic
936641818 2:114321350-114321372 TCCCTGTTGGTTCCCATTCAGGG + Intergenic
937064340 2:119005935-119005957 GCCCTGCGGGGTGCCCTGCTAGG - Intergenic
937912084 2:127080740-127080762 GCCCTGGGGTGTCCCCTCCAAGG - Intronic
937958747 2:127438583-127438605 GCCCTGTGGAGCCCCCAGCAGGG - Intronic
942692493 2:178601028-178601050 TCCCAGTAGGGTCCCATGCAAGG + Exonic
945067209 2:205957308-205957330 TCCCAGTGGGGTCCCCTGAAGGG + Intergenic
945972229 2:216242153-216242175 TCCTTGTTGGGTCACCAGCAAGG - Intergenic
946321306 2:218955993-218956015 TCCTTGTAGGGGCCCCTACAGGG + Intergenic
946321307 2:218955994-218956016 TCCCTGTAGGGGCCCCTACAAGG - Intergenic
946399645 2:219461634-219461656 TCCCTATGGTGTCCCCTCCTGGG + Intronic
947084294 2:226433733-226433755 TTCCTGTTGGGTCCTCAGCAGGG + Intergenic
947118432 2:226795544-226795566 TCCTTGTGGGCCCCCCAGCAGGG + Exonic
948061338 2:235045005-235045027 CCCATGTGGGGTCACCTGCAGGG + Intronic
1169082563 20:2806082-2806104 CCCCAGTGGGTTCACCTGCAAGG + Intergenic
1171367637 20:24637037-24637059 TCCCTGTGGGGGATCCTGCAAGG + Intronic
1172169047 20:32917847-32917869 CCACTGTGGGCTCCCCAGCAGGG + Intronic
1172583444 20:36065758-36065780 TCCCTGTGGGTGCCCTTGCTTGG - Intergenic
1172762837 20:37334040-37334062 TCCCTCTGGGGGCACCTGCTGGG - Intergenic
1174370710 20:50085514-50085536 TCTCTGTGGGTTCCCCTGTCAGG + Intronic
1175500206 20:59444693-59444715 TCCCTGTGTGGTGCTCAGCACGG - Intergenic
1175553347 20:59831139-59831161 TGCCTGTGGGGTCACCTGTTTGG + Intronic
1179034700 21:37749417-37749439 TCCCTATGGGGCTCCCTGCATGG - Intronic
1179245035 21:39625698-39625720 TCCCTGTGTGCGCCCCTGCGGGG - Intronic
1180002162 21:45000113-45000135 TCCCTGTGGGGCAGCCTGCGTGG - Intergenic
1180259659 21:46660540-46660562 TCCCTGTGAGGTCTCATTCATGG - Intronic
1180593693 22:16960573-16960595 TCCCTGTAAGGTCCTCTACAAGG - Intergenic
1180675210 22:17581782-17581804 TCCCTGCGGGGTCCCCAGCCAGG + Intronic
1180840124 22:18955238-18955260 TCCCTGTGGGGTCCCCACAAAGG + Intergenic
1181035673 22:20168748-20168770 TCCCCGTGGGGCCCCCTGCGTGG + Intergenic
1181061783 22:20285251-20285273 TCCTTGTGGGGTCCCCACAAAGG - Intergenic
1181698276 22:24604934-24604956 TCCTTTTGGGGTCAGCTGCAGGG + Intronic
1182094174 22:27614944-27614966 TCCCTGTGGTGTCCCAACCAGGG - Intergenic
1185044752 22:48523319-48523341 ACCCCGTAGGGTCCCCTGGATGG - Intronic
1185128844 22:49026030-49026052 TCCCTGGGGGGTCACCTGGGCGG + Intergenic
1185316985 22:50183562-50183584 TCCGGCTGGGGTCCCCTGCAGGG - Intergenic
1185318043 22:50187174-50187196 AGCCTGTGGGGCCCCCTGCATGG + Intronic
949386284 3:3505961-3505983 TCCCTGTGGGCTCAGGTGCATGG + Intergenic
949969861 3:9396204-9396226 TCCCTGGGCGTTGCCCTGCAGGG - Intergenic
950686362 3:14621392-14621414 TCCCTGTGGGGTCCAGGGCAAGG - Intergenic
954193928 3:48984914-48984936 TTCCTGTGTTGTCCCCAGCAAGG + Exonic
954927052 3:54245373-54245395 TCCCTGGGGGACCCCCTGCCTGG + Intronic
958169236 3:89917610-89917632 TCTCTCTGGGGTTCCCTCCAGGG - Intergenic
961126590 3:124424151-124424173 TCCCGGGGGGGTTCCCAGCAGGG + Intronic
968549184 4:1213685-1213707 CCCCTGTGGGGGGCCCTGCCTGG + Intronic
968622536 4:1610355-1610377 GCCCCTTGGGCTCCCCTGCACGG - Intergenic
968705150 4:2074211-2074233 TCCCTGTGGGGCCCTCGGGAGGG + Intronic
973696650 4:53496993-53497015 TCTCAGGGTGGTCCCCTGCAAGG + Intronic
973774561 4:54232045-54232067 TCCCTGTGGGGTCTGCAGGAAGG - Intronic
976151558 4:82097647-82097669 TCCCTGTGGGGTTTTCTTCAAGG + Intergenic
979597216 4:122547371-122547393 CCACTGTGGGGTCCCCTCCCTGG + Intergenic
980101321 4:128544044-128544066 TCTCTGTGGCATCCCCTGTAAGG + Intergenic
981582205 4:146261186-146261208 TTCCTCTGGGGCCCCTTGCAAGG - Intronic
985527986 5:416743-416765 TCACTGTGGGGTGCCGTGAACGG + Intronic
985763317 5:1763043-1763065 TCCCTGTGGGGTCCTCAGTGTGG - Intergenic
985766783 5:1784316-1784338 ACCCTGTGGAGGCCCCTCCATGG + Intergenic
985848613 5:2372212-2372234 TCCCTCTGGGGTTTCCTCCATGG + Intergenic
985895681 5:2749050-2749072 TCCCTGTGGGGGCGCGGGCACGG + Exonic
986279912 5:6314449-6314471 TCTCTCAGGGGTCCCCTTCAGGG + Intergenic
986706418 5:10457884-10457906 TCCCTGGGGAATCGCCTGCAGGG - Intronic
987084670 5:14457509-14457531 TCTCTGTGGGCTCAGCTGCAAGG - Intronic
987477000 5:18402612-18402634 TCACTGCGGGGTCCCCTGAAGGG + Intergenic
993766514 5:91865234-91865256 TCCCTGTTAGGTCCCCTGCAGGG + Intergenic
997395632 5:133557684-133557706 TCTCTGGGGGTTCCCCTTCATGG - Intronic
997673687 5:135696655-135696677 TCCCAGTTGGGTCTCCTCCAAGG - Intergenic
1001425390 5:171619073-171619095 TCCATGTGGGCTCCCCTTAATGG + Intergenic
1001956526 5:175851558-175851580 CCACTGTGGGGTCCTCTGCAAGG + Intronic
1002771085 6:291809-291831 TCTCTGGGGGCTCCCCTGCCTGG - Intronic
1006130789 6:31868274-31868296 TCTCTCTCGGGTCCCCCGCAGGG + Intronic
1006818568 6:36871721-36871743 TCCCTGTTGGGTCACCTCCTTGG + Exonic
1007244792 6:40453161-40453183 TTCCTGTTGTGTACCCTGCAGGG + Intronic
1007309088 6:40930910-40930932 GACCTGTGGGGTCCCCTGTGGGG + Intergenic
1019126823 6:169846230-169846252 TCCCTGGGGCGACCTCTGCAGGG - Intergenic
1019134065 6:169897276-169897298 TCCCTGTGGGTTTCCCTCCAGGG + Intergenic
1019276273 7:177630-177652 TCCCTGTGTGCTCCTGTGCATGG + Intergenic
1019276291 7:177707-177729 TCCCTGTGTGCTCCTGTGCATGG + Intergenic
1019276309 7:177784-177806 TCCCTGTGTGCTCCTGTGCATGG + Intergenic
1019276343 7:177938-177960 TCCCTGTGTGCTCCTGTGCATGG + Intergenic
1019276361 7:178015-178037 TCCCTGTGTGCTCCTGTGCATGG + Intergenic
1019276378 7:178092-178114 TCCCTGTGTGCTCCTGTGCATGG + Intergenic
1019329515 7:455680-455702 TCCCCGTGGGCTCCCCCGGAAGG + Intergenic
1019727536 7:2611354-2611376 CCCCTGTGGGGACTCCTGCCGGG + Exonic
1019770994 7:2883510-2883532 TCACTGTGGTGGCCCCAGCAGGG + Intergenic
1020089032 7:5327569-5327591 TCCCTGTGGGTACAGCTGCAGGG - Intronic
1026285950 7:68962892-68962914 TCCCTGTTGGGACCACTGCTTGG - Intergenic
1029125733 7:98294006-98294028 TCCCTGTAGTGTCCCCCGGAAGG - Intronic
1030113995 7:106049521-106049543 TCCCTTTGGGTTCCCCTGGGTGG + Intergenic
1034344612 7:150378908-150378930 GCCCTGATGGGTCCCCAGCAGGG + Intronic
1036749423 8:11434552-11434574 TTCCTGTGGAGTCCTCGGCAGGG - Intronic
1037116661 8:15236772-15236794 TCCCTCTGGGGTCCCCTGCTTGG - Intronic
1039479456 8:37861491-37861513 TCCCTTTGGGGTCCAATCCATGG + Exonic
1040642031 8:49346202-49346224 TCCCTCTGGGTCCACCTGCATGG + Intergenic
1047430813 8:124789905-124789927 TCCCTGGGGGCTCATCTGCAGGG - Intergenic
1048616343 8:136079652-136079674 TCTCTGTGGAGTCTCCTGCATGG + Intergenic
1049502338 8:142974177-142974199 TGCCTGTGGGCTGCCCTGCCTGG - Intergenic
1049605275 8:143526421-143526443 TCCCTGAGGGGTCTCCTGCTCGG - Intronic
1050615236 9:7395070-7395092 TCTCTGTGGGCTCCCCAGCGTGG - Intergenic
1051359059 9:16265758-16265780 TCCCTGTGGGCTCCACTCCATGG + Intronic
1051478826 9:17537932-17537954 TACCTGGGAGGTCTCCTGCAGGG + Intergenic
1053493177 9:38526887-38526909 CCCCCGTGGGGTCTTCTGCAAGG + Intergenic
1057179036 9:93019966-93019988 GCCCTGTGCTGTACCCTGCAGGG + Intronic
1057512677 9:95693731-95693753 TTCCTGTGGCCTCCCCAGCATGG + Intergenic
1058602447 9:106684669-106684691 TCCCTGTGGGGTCAGCTTCATGG - Intergenic
1058754011 9:108067423-108067445 AGCCAGTGGGATCCCCTGCAAGG - Intergenic
1058820360 9:108723816-108723838 GCCCTGTGCTGTCCCCTGCCAGG + Intergenic
1060227511 9:121802995-121803017 TTCCTGTAGGGTGCCCTGCTCGG - Intergenic
1060232771 9:121837978-121838000 GCCCTGTGGGGCCCACAGCAAGG - Intronic
1060846186 9:126839426-126839448 CCTCGGTGGGGTCCTCTGCAGGG - Intergenic
1061709890 9:132480287-132480309 ACCCTGTGGGGTCAACAGCAGGG + Intronic
1061820666 9:133225757-133225779 TTCCTGTGGGGTGTCCAGCAGGG - Intergenic
1061902521 9:133680362-133680384 TGCCTGTGAGGCCCCCTACAGGG + Intronic
1062227750 9:135463101-135463123 TCCCTCTGGGGTCTCCTGGGTGG + Intergenic
1062341922 9:136097539-136097561 TCACTCAGGGGTCCCCAGCAGGG + Intergenic
1185467113 X:361729-361751 TACGTGTGTGGTCCCCCGCAGGG - Intronic
1186290834 X:8096821-8096843 TTCCTGTGGGCTTCCCTGGATGG - Intergenic
1186792916 X:13016322-13016344 TCCCTGCAGTGTCCCCTGCCTGG - Intergenic
1194901667 X:99519876-99519898 TCTCTGTGAGGTCCCCTGTGAGG - Intergenic
1195196369 X:102501233-102501255 TCTCTATGGGGAACCCTGCAAGG + Intergenic
1199991431 X:152989737-152989759 ACCCTGTGGCCTCCCCTGCGGGG + Exonic
1200000828 X:153058952-153058974 ACCCTGTGGCCTCCCCTGCAGGG - Intronic
1202160346 Y:21927817-21927839 TCCCTGCAGGGGACCCTGCAGGG + Intergenic
1202160347 Y:21927818-21927840 ACCCTGCAGGGTCCCCTGCAGGG - Intergenic
1202231009 Y:22658560-22658582 ACCCTGCAGGGTCCCCTGCAGGG + Intergenic
1202231010 Y:22658561-22658583 TCCCTGCAGGGGACCCTGCAGGG - Intergenic
1202312148 Y:23537604-23537626 TCCCTGCAGGGGACCCTGCAGGG + Intergenic
1202312149 Y:23537605-23537627 ACCCTGCAGGGTCCCCTGCAGGG - Intergenic
1202558654 Y:26132989-26133011 ACCCTGCAGGGTCCCCTGCAGGG + Intergenic
1202558655 Y:26132990-26133012 TCCCTGCAGGGGACCCTGCAGGG - Intergenic