ID: 1156376640

View in Genome Browser
Species Human (GRCh38)
Location 18:36520789-36520811
Sequence CCATTCCTACACAGAGAGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 158}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156376635_1156376640 24 Left 1156376635 18:36520742-36520764 CCTTCCTTTTATCTGAGATGAGA 0: 1
1: 0
2: 0
3: 23
4: 272
Right 1156376640 18:36520789-36520811 CCATTCCTACACAGAGAGTGTGG 0: 1
1: 0
2: 0
3: 17
4: 158
1156376637_1156376640 20 Left 1156376637 18:36520746-36520768 CCTTTTATCTGAGATGAGAAGGA 0: 1
1: 1
2: 0
3: 16
4: 300
Right 1156376640 18:36520789-36520811 CCATTCCTACACAGAGAGTGTGG 0: 1
1: 0
2: 0
3: 17
4: 158

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156376640 Original CRISPR CCATTCCTACACAGAGAGTG TGG Intronic
904929868 1:34078222-34078244 CCCTTCCCACACAGACAGTGGGG - Intronic
905416136 1:37805741-37805763 CCATTCCCAGACCTAGAGTGGGG - Intronic
905480110 1:38256026-38256048 CTACTCCTACCAAGAGAGTGAGG - Intergenic
906426294 1:45716033-45716055 CCAATCCTACACAGAGAATTAGG + Intronic
906638309 1:47425210-47425232 CCATCCCTACCCAGACAGAGAGG - Intergenic
912499756 1:110114094-110114116 CCACTCACACACAGAGTGTGGGG - Intergenic
912596144 1:110878350-110878372 CCCTTCCTACACAGAGCCTGTGG - Intronic
912642847 1:111363627-111363649 CATTTCCTACAGAGAGAGTGAGG + Intergenic
913200204 1:116489845-116489867 CCATTTATACATTGAGAGTGGGG - Intergenic
917384725 1:174459417-174459439 CCAATCCCACACAGATAATGAGG - Intronic
918115127 1:181489611-181489633 CCTTTTCTACTCAGAGACTGTGG + Intronic
920732086 1:208496912-208496934 CCGTTCCTACACAGAGATCCTGG - Intergenic
922620497 1:226985385-226985407 CCATTCTTACACAGGGAGCCGGG - Intronic
1068718096 10:60210702-60210724 CCATTCCCACACACACAATGGGG + Intronic
1072797488 10:98367068-98367090 TCTCTCCTGCACAGAGAGTGGGG - Intergenic
1073276419 10:102315495-102315517 CCATTTTTCCACAGACAGTGGGG + Intronic
1075578287 10:123596863-123596885 CCATTCTTAGGCACAGAGTGAGG - Intergenic
1076148235 10:128142054-128142076 ACAATCATACACAGAGGGTGGGG + Intergenic
1076367126 10:129928608-129928630 ATATTCCTAGACAGAGAATGTGG + Intronic
1076722977 10:132400832-132400854 CCTTTCCTGATCAGAGAGTGAGG + Intronic
1078533144 11:12152453-12152475 CAATTCCTATACAGAGTGGGTGG - Intronic
1081529536 11:43948426-43948448 CCAATGCTACACAGATAGTCAGG + Intergenic
1082070496 11:47935815-47935837 CCAATCCCTCACAGATAGTGAGG + Intergenic
1091807926 12:3369167-3369189 CCATTCCTTCACAGAAAATCAGG - Intergenic
1093754769 12:22840253-22840275 CCAATCCTCCACAGATACTGAGG + Intergenic
1094563878 12:31581816-31581838 CCAATCCCACACAGATACTGAGG - Intronic
1095807194 12:46332834-46332856 CACTTCCTACACAGAAAGTTGGG - Intergenic
1097053424 12:56236999-56237021 CCATTCCTACCCAGTTCGTGGGG - Exonic
1097611018 12:61820455-61820477 GAATTCCTAAAAAGAGAGTGAGG - Intronic
1099282861 12:80674981-80675003 AGATTCCTACAAAGAGACTGTGG - Intronic
1103920149 12:124395122-124395144 CCCCTGCCACACAGAGAGTGAGG + Intronic
1107297101 13:38921298-38921320 CCTTTCCTGTACAGAGATTGTGG - Intergenic
1108504034 13:51093852-51093874 CCATTCCTAAACAGACTATGTGG - Intergenic
1111624072 13:90761164-90761186 CTATTCCTCCAAAGAGAGTGTGG - Intergenic
1111992610 13:95132104-95132126 CCAATCCCACACAGATAGAGAGG - Intronic
1114488355 14:23078782-23078804 CCCTCCCTACACAGAGATGGAGG - Intronic
1116493820 14:45536867-45536889 CCATTCCTTCTCACTGAGTGGGG - Intergenic
1117824505 14:59687741-59687763 CCATTCCTATACAGAGATCCTGG + Intronic
1119174704 14:72560489-72560511 CCTTTCTTACATAGAGTGTGAGG - Intronic
1119290127 14:73488980-73489002 CCATTGCAACACAGAGGTTGGGG + Intronic
1119975977 14:79024176-79024198 CCATTCTTACATACAGAGGGTGG + Intronic
1120499809 14:85281741-85281763 ACATCCCTAAACAGAGAATGTGG + Intergenic
1123439709 15:20281592-20281614 CCATTACTGCACAGAGAATCTGG - Intergenic
1123946191 15:25240065-25240087 CCAAGCCCACACAGGGAGTGTGG - Intergenic
1126131084 15:45342222-45342244 CCATTCCTTCCCAGAGAATTGGG + Intergenic
1126204114 15:46023229-46023251 CTGTTCCTACAAAGAGTGTGTGG - Intergenic
1126606796 15:50486175-50486197 CCATTTCTCCACAGAAAGAGGGG + Intronic
1127379300 15:58416376-58416398 CCAATCCCACACAGATACTGAGG + Intronic
1129575486 15:76739208-76739230 CCAATCCTCCACAGATACTGAGG + Intronic
1132291631 15:100707662-100707684 GCATTCCTACCCAGTGTGTGAGG - Intergenic
1133764622 16:8829225-8829247 CCATTCATACACGGCGAGAGGGG + Intronic
1136845460 16:33572806-33572828 CCATTACTGCACAGAGAATCTGG + Intergenic
1139342597 16:66278217-66278239 CCCTTCCTATGCAGAGATTGTGG + Intergenic
1139701926 16:68713087-68713109 CCATAGAGACACAGAGAGTGGGG - Intronic
1141669240 16:85483000-85483022 GCACTGCTACACAGAGAGTTTGG - Intergenic
1203107168 16_KI270728v1_random:1421459-1421481 CCATTACTGCACAGAGAATCTGG + Intergenic
1146282640 17:31554961-31554983 CAATTCAGTCACAGAGAGTGAGG + Intergenic
1146522232 17:33534813-33534835 GCATTCATACACAGAGAATGAGG - Intronic
1152412268 17:80133441-80133463 CCTTTCCTAGACAGTGTGTGGGG + Intergenic
1152848027 17:82614309-82614331 CCGTCCCGACACAGGGAGTGAGG + Intronic
1153772537 18:8427095-8427117 GCGTTCCTCCTCAGAGAGTGAGG - Intergenic
1156376640 18:36520789-36520811 CCATTCCTACACAGAGAGTGTGG + Intronic
1156504281 18:37579307-37579329 CCATTACCAGACAGTGAGTGTGG - Intergenic
1157378873 18:47192749-47192771 TCATTCCTACCCAGGGGGTGGGG - Intergenic
1158879044 18:61758852-61758874 CCATTCCTACCCAGAGGCTGGGG + Intergenic
1162879436 19:13647282-13647304 CCTTGCCTGCACAGAGACTGGGG - Intergenic
1163078497 19:14918248-14918270 CTATTCCTGCCCAGGGAGTGTGG - Intergenic
1163397326 19:17071362-17071384 CCATGCCTGCAGAGCGAGTGTGG + Intronic
925434653 2:3826658-3826680 CCATTCCTACCCACAGAGAGGGG - Intronic
925768337 2:7259194-7259216 CCACTCCTGGACAGAGTGTGGGG + Intergenic
925768345 2:7259236-7259258 TCATTCCTGGACACAGAGTGTGG + Intergenic
925768356 2:7259280-7259302 TCATTCCTGGACACAGAGTGTGG + Intergenic
925768368 2:7259324-7259346 CCATTCCTGGACACAGAGTGTGG + Intergenic
925768379 2:7259368-7259390 CCATTCCTGGACACAGAGTGTGG + Intergenic
925768392 2:7259412-7259434 CCATTCCTGGACACAGAGTGTGG + Intergenic
925768404 2:7259456-7259478 CCATTCCTGGACACAGAGTGTGG + Intergenic
925825183 2:7841323-7841345 CAATCCATACACAGAGATTGAGG + Intergenic
926360079 2:12078629-12078651 CCATTCCCACACAGGGACTTGGG + Intergenic
926730870 2:16034466-16034488 CCATCCCAACACAGACAGGGAGG + Intergenic
928374372 2:30763090-30763112 CCATGCCTACACTGTGACTGGGG - Exonic
930468449 2:51782907-51782929 TCAATCCTCCACGGAGAGTGTGG + Intergenic
932276192 2:70453962-70453984 CCATTCCTGCCCACAGAGGGAGG - Intronic
933838378 2:86264404-86264426 CCATGCCATCCCAGAGAGTGTGG - Intronic
935184764 2:100722101-100722123 CCATGCCTACGTACAGAGTGTGG + Intergenic
936771565 2:115920097-115920119 TCTTTCCTACAGAGAGAGAGGGG + Intergenic
937746966 2:125425925-125425947 CCATGCCTATAAGGAGAGTGGGG + Intergenic
938186958 2:129240344-129240366 TCCTTCCCTCACAGAGAGTGTGG - Intergenic
939503426 2:143014108-143014130 ACATTCCTACACAAAGATTATGG + Intronic
940090878 2:149915493-149915515 CCATTCAAACCCAGAGAGTGAGG + Intergenic
940404337 2:153283724-153283746 CCCTTCCTATGCAGAGACTGTGG - Intergenic
942559438 2:177204820-177204842 CCATTCCTACACAGATAAGCAGG + Intergenic
942613460 2:177765353-177765375 CCATTTGTACTCAGAGATTGTGG - Intronic
942666753 2:178327841-178327863 CCATTTCTACACAGAAAGCCAGG + Intronic
943242530 2:185403816-185403838 CCAATCCTACACAGAGTGATAGG - Intergenic
944288763 2:197980092-197980114 GCATTCCCACACACAGAGTCAGG - Intronic
948271149 2:236674193-236674215 CCATTTTTCCACAGAGGGTGTGG + Intergenic
1170562532 20:17569746-17569768 CCATGCCTGCACAGTGGGTGGGG + Intergenic
1170684456 20:18556377-18556399 CCATTCCCCCACAGATACTGAGG + Intronic
1171118087 20:22544261-22544283 GCATTCAGAGACAGAGAGTGAGG - Intergenic
1171359904 20:24579970-24579992 CCTTACCTCCACAGAGAGAGAGG - Intronic
1174261222 20:49296775-49296797 CCCTTCCTACCCACACAGTGGGG - Intergenic
1177294825 21:19160695-19160717 CCATTCCTGCACATAGATGGGGG - Intergenic
1178165290 21:29967742-29967764 CCATGCCTACACACACAGAGAGG - Intergenic
1178497463 21:33099385-33099407 CCATTCGTGCCCCGAGAGTGTGG - Intergenic
1181638822 22:24186463-24186485 CCATTCCTGCAGGGAGACTGAGG + Intronic
1182862956 22:33576665-33576687 CCAATCCTCCACAGATAGAGAGG - Intronic
1183509067 22:38224648-38224670 CCATTCCTGCATATAGAGTGGGG + Intronic
1184696213 22:46140507-46140529 CCATTACTGCACAGAGAATCTGG - Intergenic
951159987 3:19407620-19407642 CCATTCCTAGACATAGATAGTGG + Intronic
951236371 3:20240849-20240871 ACCTTCCTGCACAGAGATTGTGG + Intergenic
960781007 3:121316677-121316699 CTATTACTACAAAGAGCGTGTGG + Intronic
960854162 3:122085956-122085978 TCCTTCCTCCACAGAGACTGTGG + Intronic
961499457 3:127321535-127321557 CCATTTCAACAGAAAGAGTGAGG + Intergenic
965532228 3:169783022-169783044 CCTTTCCTACACAGATATTCTGG + Intronic
966357404 3:179095609-179095631 CCTCTCCTAGACAGGGAGTGAGG + Intergenic
966756538 3:183376580-183376602 CCATTCCTACAGTGAGAAGGGGG - Intronic
967577911 3:191118671-191118693 CCATATATACATAGAGAGTGAGG - Intergenic
970009937 4:11447824-11447846 ACATTCCTATACAGAGGGTCAGG - Intergenic
970078322 4:12250702-12250724 CCATTTCTATACAGAGGATGAGG + Intergenic
971614041 4:28764491-28764513 CCTTTCCTATACAGAGATTTTGG + Intergenic
974089109 4:57292051-57292073 ATATTCCAACATAGAGAGTGAGG - Intergenic
975091317 4:70407600-70407622 CCATTCCTAGCCAGATAGTAAGG - Intronic
975489854 4:74976372-74976394 CCATTCCTCCTCACAGGGTGGGG + Intronic
977761751 4:100746190-100746212 TACTTCCTACACAGAGATTGTGG + Intronic
977764217 4:100777848-100777870 CCCTTCCAATACAGAGATTGTGG - Intronic
979139399 4:117153088-117153110 CCATTCCCATACAGAGAATTTGG - Intergenic
979420053 4:120493181-120493203 CCAGTCCTTCACAGATACTGAGG - Intergenic
985629274 5:1006320-1006342 CCATTCCTTCCCAGAGGGTCCGG - Intergenic
988504272 5:31808183-31808205 CCAGTCCTGCACAGAGCGTCAGG - Intronic
989162707 5:38406973-38406995 CCATTCCCATACAGAGAAAGGGG + Exonic
989395247 5:40948621-40948643 CCATATCTAGACAGATAGTGAGG - Intronic
989452364 5:41601773-41601795 CCAATCCTCCACAGATGGTGAGG - Intergenic
992373039 5:76164775-76164797 CCAATCCCACACAGATACTGAGG - Intronic
992413051 5:76526234-76526256 TCATTTGTACACAAAGAGTGAGG - Intronic
993443237 5:87980794-87980816 CTCTTCCTGCACAGAGATTGTGG - Intergenic
995148208 5:108810637-108810659 CCATTCCTGTGCAGAGACTGTGG - Intronic
995318529 5:110804020-110804042 CCATTCCTGTACAGAGATTGTGG - Intergenic
1001106505 5:168858949-168858971 CCTTCTCTAAACAGAGAGTGAGG + Intronic
1001363258 5:171109486-171109508 CCAATCCTACACAGATACTGAGG - Intronic
1001774275 5:174316884-174316906 CCAAGGCTACACAGTGAGTGGGG - Intergenic
1002598766 5:180341442-180341464 ATATTCCTAAACAGTGAGTGGGG + Intronic
1004983955 6:21059135-21059157 CCATTCCTCCTCACTGAGTGGGG - Intronic
1006720119 6:36144746-36144768 CCATTTCTACCCAGATGGTGAGG - Intergenic
1007744561 6:44035388-44035410 CCATTCCTTTAGAGAGAATGAGG - Intergenic
1008632269 6:53373788-53373810 TCATACCTACTCACAGAGTGGGG - Intergenic
1012728581 6:102849533-102849555 ACATTCCTAGGCAGTGAGTGAGG + Intergenic
1013857224 6:114588336-114588358 CCATTTTTACACAGGGAGTAAGG - Intergenic
1015424265 6:133047484-133047506 CCAATCTTACACAGACACTGTGG - Intergenic
1016668903 6:146677705-146677727 TCATTCCAACACATAGAATGTGG + Intronic
1018660741 6:166084911-166084933 CCCTTTCAATACAGAGAGTGTGG - Intergenic
1022495361 7:30849937-30849959 ACATTTAGACACAGAGAGTGGGG - Intronic
1025255497 7:57381720-57381742 CCATTCCTGGCCAGAGTGTGGGG + Intergenic
1031237679 7:119197382-119197404 CCCTTCCTGCACAGTGATTGTGG + Intergenic
1033129441 7:138733360-138733382 TCATGCCCACACAGAGAGGGTGG + Intronic
1034311506 7:150092868-150092890 CCAATTCTCCACAGATAGTGAGG - Intergenic
1034630136 7:152524303-152524325 ACATTCCTACACACAGAGCCTGG + Intergenic
1034708443 7:153169695-153169717 TCATTGCTACAGAGACAGTGTGG + Intergenic
1034795349 7:154007786-154007808 CCAATTCTCCACAGATAGTGAGG + Intronic
1035740985 8:1928618-1928640 CCGTCCCTACACAGATCGTGGGG - Exonic
1037910212 8:22739735-22739757 CCATTCTTACCCAGACAGAGGGG - Intronic
1041137964 8:54780806-54780828 CCAATCCTCCACAGATACTGAGG + Intergenic
1042109694 8:65367563-65367585 CCATTCCTGTGCAGAGATTGTGG + Intergenic
1047566286 8:126047364-126047386 CCCTTCCTAGACATAGATTGTGG - Intergenic
1049136510 8:140906254-140906276 ACATTCCTACCAACAGAGTGTGG - Intronic
1053391833 9:37741393-37741415 ACATTCCTCCACCGAGAGTGTGG + Intronic
1056376484 9:86018583-86018605 CCACTCATACACAGACACTGGGG - Intronic
1058454438 9:105126196-105126218 CCATGCCCACAGAGAGAGTAGGG + Intergenic
1062068756 9:134543885-134543907 CCTGTCCTGCACAGAGAGGGTGG - Intergenic
1190221150 X:48512959-48512981 CCATGACTAGACAGAGACTGTGG + Intronic
1191736075 X:64389303-64389325 CCAATACTAGACAGAGAGTTAGG - Intronic
1191774094 X:64793542-64793564 CCCTTCCTAAACAGAGATTCTGG + Intergenic
1192493643 X:71598385-71598407 TCATTCCCACACATAGAGCGGGG - Intronic
1195292967 X:103446881-103446903 CCATCACTACACAGAGACCGAGG - Intergenic
1195753109 X:108176750-108176772 CCATTCCTAGGCAGAGAGGAAGG + Intronic
1197231743 X:124012312-124012334 ACATTCCTAGACAAAGAGTAAGG - Intronic
1197390835 X:125861602-125861624 CTATTCCTGTACAGAGAATGTGG + Intergenic