ID: 1156377987

View in Genome Browser
Species Human (GRCh38)
Location 18:36531832-36531854
Sequence CAGTTTGCCCACAGGCAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 245
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 222}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156377981_1156377987 16 Left 1156377981 18:36531793-36531815 CCTGCGGTCCTCTCGGAGGCAGG 0: 1
1: 0
2: 0
3: 12
4: 132
Right 1156377987 18:36531832-36531854 CAGTTTGCCCACAGGCAGGCTGG 0: 1
1: 0
2: 0
3: 22
4: 222
1156377983_1156377987 8 Left 1156377983 18:36531801-36531823 CCTCTCGGAGGCAGGATGCTTGA 0: 1
1: 0
2: 1
3: 10
4: 83
Right 1156377987 18:36531832-36531854 CAGTTTGCCCACAGGCAGGCTGG 0: 1
1: 0
2: 0
3: 22
4: 222
1156377978_1156377987 29 Left 1156377978 18:36531780-36531802 CCGCTGTCTACAGCCTGCGGTCC 0: 1
1: 0
2: 0
3: 9
4: 144
Right 1156377987 18:36531832-36531854 CAGTTTGCCCACAGGCAGGCTGG 0: 1
1: 0
2: 0
3: 22
4: 222

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156377987 Original CRISPR CAGTTTGCCCACAGGCAGGC TGG Intronic
900379019 1:2374429-2374451 CACAGTGCCCACAGGAAGGCAGG + Intronic
900491298 1:2950430-2950452 CAGTTTCCCCAAATGCAGGTGGG + Intergenic
900574531 1:3376526-3376548 CAGTGAGACCACAGTCAGGCGGG + Intronic
900960317 1:5914969-5914991 CTGTTTGCTCAGTGGCAGGCTGG - Intronic
901799689 1:11700915-11700937 CAGTTGTCCCTCAGGCAGGCGGG + Intronic
902236831 1:15063085-15063107 TAGTTTGCGCAGGGGCAGGCAGG - Intronic
902681619 1:18047762-18047784 CAGGGTGCCCACATGGAGGCAGG - Intergenic
902816866 1:18921403-18921425 CAGTTTGCATGCAGGCAGGGTGG - Intronic
903329319 1:22589075-22589097 CAGGTTGGCCACCAGCAGGCTGG - Exonic
903450614 1:23451547-23451569 CAATTTGCCCAGAGGGAAGCTGG + Intronic
903653236 1:24933558-24933580 CAATTCGCCCACAGGCTGCCTGG + Intronic
903711424 1:25327771-25327793 TAGTTCACCCACTGGCAGGCTGG + Intronic
903715524 1:25363658-25363680 TAGTTCACCCACTGGCAGGCTGG - Intronic
905365642 1:37449807-37449829 CAGTTTGTCCCCAGGGAGGAAGG - Intergenic
912687323 1:111777776-111777798 CAGTTTGCCCACTGGCCTTCAGG - Intronic
912744948 1:112238392-112238414 TAGTTTGCATACTGGCAGGCTGG - Intergenic
914830207 1:151165588-151165610 CAGTTTGCCCCCAAGTAGCCTGG + Exonic
914882352 1:151557053-151557075 CAGTTAATCCACAGGAAGGCAGG - Intronic
915937269 1:160096882-160096904 CAGTCTGCCCTGAGGCAGTCAGG - Intronic
916146316 1:161743361-161743383 CAGTTTGACCTCCGGGAGGCTGG - Intergenic
917920877 1:179748551-179748573 CAGGTTGCCCACGGGCAGTGCGG + Intronic
918740836 1:188128575-188128597 CAGTTTCCTCACAGGAAGGGTGG - Intergenic
919568411 1:199218232-199218254 GTGATTGCCCACAGGGAGGCAGG - Intergenic
920288403 1:204898644-204898666 CAGTGGGCCAAAAGGCAGGCGGG + Intronic
920319571 1:205108570-205108592 CAAGTAGCCCACAGGAAGGCAGG + Intronic
920338908 1:205263119-205263141 AGGTTTGCCCACATGCATGCAGG + Intronic
923413286 1:233730984-233731006 AAGGGTGCCCAAAGGCAGGCTGG - Intergenic
924940750 1:248811352-248811374 CAGGTTACACACGGGCAGGCTGG + Exonic
1063151992 10:3345519-3345541 CACCCTCCCCACAGGCAGGCTGG - Intergenic
1065089617 10:22218877-22218899 CAGATCACCCACTGGCAGGCAGG + Intergenic
1065969603 10:30795968-30795990 CAGTGAGGCCAGAGGCAGGCAGG + Intergenic
1066388831 10:34962704-34962726 CAAAATGCCCACAGGCAGGCTGG - Intergenic
1066696229 10:38080326-38080348 CAGCTTGGCCACAGGCATGGTGG + Intergenic
1066996299 10:42567191-42567213 CAGCTTGGCCACAGGCATGGTGG - Intergenic
1068973726 10:62985988-62986010 TAGATTGCACACAGGCAGCCTGG - Intergenic
1069751377 10:70747440-70747462 CACATTCCCCACAGCCAGGCAGG - Intronic
1072382521 10:94890061-94890083 CAGTTTGCTCACAGTTATGCAGG - Intergenic
1073045999 10:100638644-100638666 CAGTTGGGTCACAGGCAGGGAGG - Intergenic
1075221406 10:120588100-120588122 CAGACTTCCCATAGGCAGGCAGG - Intronic
1075263468 10:120981792-120981814 GAATTTTCCCACAGGGAGGCAGG - Intergenic
1075680691 10:124329074-124329096 CACTTTGGTCACAGGAAGGCAGG + Intergenic
1076263298 10:129089428-129089450 CAGATTGCCCCCAGACAGGCAGG - Intergenic
1076266007 10:129110447-129110469 CAGCTTGCACAGAGGCAGGGAGG - Intergenic
1076351338 10:129816780-129816802 CATTTTGTCCACAGGCACTCAGG + Intergenic
1076650274 10:131982355-131982377 CAGTTTCCCCACTAGCAGGATGG - Intergenic
1076660904 10:132055588-132055610 CAGTTTGCCCGCCGGCAAGCAGG + Intergenic
1077506847 11:2933557-2933579 CAGCTTCCTCACAGGCTGGCAGG - Intergenic
1078175213 11:8964762-8964784 CCGTTCGCGCACAGGCAGGGCGG + Exonic
1083721932 11:64607640-64607662 CATTTTGCCCGCCGGCAGGTTGG + Exonic
1083776062 11:64894827-64894849 CAGATTGGCAACGGGCAGGCTGG + Exonic
1083904356 11:65660413-65660435 CAGGGAGCCCACAGGGAGGCTGG - Intronic
1084661581 11:70549550-70549572 CAGTGTGGCCAGGGGCAGGCGGG + Intronic
1085387734 11:76166702-76166724 CAGTTCCCCAACAGGCAGGGAGG + Intergenic
1086359672 11:86044900-86044922 CAGTTTTTCCACAGACTGGCAGG - Intronic
1101566051 12:105906568-105906590 CAGTTGGCCTACAGGCACACAGG - Intergenic
1101779058 12:107819108-107819130 CATCTTGGCCACTGGCAGGCTGG + Intergenic
1102054966 12:109889694-109889716 CAGTTTGCATGCTGGCAGGCAGG + Intergenic
1102220995 12:111194359-111194381 GAGTTTGCAAACTGGCAGGCCGG + Intronic
1103448591 12:121011766-121011788 CACTTAGCACACAGCCAGGCAGG - Intronic
1104711418 12:130989566-130989588 CAGTCTGCTCCCAGCCAGGCCGG + Intronic
1105854399 13:24361766-24361788 CAGGGTGCCCAGAGGAAGGCGGG + Intergenic
1106297373 13:28428168-28428190 TAGTGTGCCCACAGGCATACTGG + Intronic
1106397487 13:29394926-29394948 CAATTTTTCCACAGACAGGCGGG - Intronic
1108077773 13:46699491-46699513 CAGCTTGCCCACAGAAAAGCAGG - Intronic
1108470983 13:50766708-50766730 CAGTTTAAACTCAGGCAGGCAGG + Intronic
1111873099 13:93859116-93859138 CAGATTGCCCACATGCTAGCTGG - Intronic
1112256880 13:97842183-97842205 GAGCTTGCCCACAGGAAGGTGGG - Intergenic
1113736264 13:112680692-112680714 CAGTTTACAGACAGGCAAGCAGG + Intronic
1113868885 13:113546184-113546206 CAGTGTGGCCAAAGGCAGCCTGG + Intronic
1114115182 14:19614313-19614335 CAGGTTGTCCATTGGCAGGCAGG + Intergenic
1114416452 14:22548043-22548065 CAGTCTGAGCAAAGGCAGGCAGG - Intergenic
1116041613 14:39692846-39692868 CAGTTTGAAGGCAGGCAGGCAGG + Intergenic
1118709221 14:68506101-68506123 CAGTGTGCCCCCAGGCAGCCTGG + Intronic
1119980363 14:79073833-79073855 CAATTTGAGCACAGGCAGTCTGG - Intronic
1121247404 14:92472000-92472022 CAGTTTCTCCCCAGGCAGGGAGG - Intronic
1121817960 14:96942987-96943009 CAGTTTGAACCCAGGCAGCCTGG + Intergenic
1123112424 14:105879634-105879656 CAGGGTGCCCAGGGGCAGGCAGG - Intergenic
1124231698 15:27951683-27951705 GACTTTGCCCACAGGCAGCCGGG - Intronic
1126099969 15:45113068-45113090 CTCTGTGCCCACAGGCAGTCAGG - Exonic
1126343206 15:47666386-47666408 AATTTTGCCCTCAGCCAGGCTGG - Intronic
1128549311 15:68587815-68587837 CAGTGTTCCCACAGCCAGTCAGG + Intronic
1130183340 15:81652717-81652739 CATTTTGCCCACAGCCTCGCAGG - Intergenic
1132599077 16:765926-765948 CAGTTTACCCACTGGCAAACAGG - Intronic
1133046303 16:3090124-3090146 CACTCTGCGCACAGGAAGGCGGG + Exonic
1134660013 16:15976977-15976999 CAGATGGCCCAGGGGCAGGCAGG - Intronic
1134686675 16:16163727-16163749 CAGCTGGCAGACAGGCAGGCAGG + Intronic
1135638874 16:24102596-24102618 CAGTTGGCCAAGAGGCAGACAGG - Intronic
1136005562 16:27326725-27326747 CAGCAGGCCCACAGGGAGGCTGG + Intronic
1137558462 16:49488319-49488341 CAGAGTGCCCAGAAGCAGGCAGG - Exonic
1137598005 16:49737683-49737705 CAGACTGCCCACAGGCTGCCAGG + Intronic
1138423219 16:56913264-56913286 CACTTTGCCCATAGGGAGGAAGG + Exonic
1139938250 16:70586816-70586838 CAGCTTGCCCACGGTCACGCAGG + Intronic
1140349308 16:74246785-74246807 CAGTTTGAAGACAGTCAGGCAGG - Intergenic
1141560908 16:84867263-84867285 CATTTTCCCCACACCCAGGCAGG + Intronic
1142601433 17:1054785-1054807 CAGTTTGCCCCCAGGAACTCAGG + Intronic
1144950376 17:18990601-18990623 CACATTGCCCTCAGCCAGGCAGG + Intronic
1145035886 17:19540287-19540309 CAGGTGGCCCACAGGGAGGCAGG + Intronic
1148328073 17:46795435-46795457 CCCTTTGCCCACGGGCCGGCTGG - Intronic
1148465885 17:47865087-47865109 TAGTTTGCCCTGCGGCAGGCAGG - Intergenic
1148574278 17:48698259-48698281 CAAGTAGCCCACAGGAAGGCAGG - Intergenic
1149592244 17:57839003-57839025 CACTTTGGCCCCAGGGAGGCAGG + Exonic
1150474354 17:65463381-65463403 CAGTGTGCTCAGAGGCTGGCTGG - Intergenic
1151273523 17:73015266-73015288 CAGTATTCCCAAAGGCAGGGAGG - Intronic
1151356055 17:73559242-73559264 TAGTTTTCCCAGAGGCAGGCAGG - Intronic
1151928830 17:77217892-77217914 CAGTGTGTCCACAGGCAGTCAGG + Intergenic
1152233275 17:79125518-79125540 CCGTTGTCCCACACGCAGGCTGG - Intronic
1152741938 17:82022276-82022298 CAGTTTCTCCACTGGCAGGTGGG + Intronic
1154073606 18:11178008-11178030 CAGGCTGCCCTCAGGAAGGCCGG + Intergenic
1156377987 18:36531832-36531854 CAGTTTGCCCACAGGCAGGCTGG + Intronic
1157295713 18:46441278-46441300 CACTGTGCCCAGACGCAGGCTGG + Intronic
1157605348 18:48922868-48922890 CAGTCTTCCCACAGGCAGCCTGG + Intronic
1157681124 18:49607902-49607924 CAGTTTTTACACAGACAGGCAGG + Intergenic
1159667264 18:71176977-71176999 GAGTTTGCCAACAGGAAAGCAGG - Intergenic
1160156595 18:76438854-76438876 CTGTGCTCCCACAGGCAGGCTGG + Intronic
1160418759 18:78729821-78729843 CAGTTTGCTCATAGACAGTCTGG + Intergenic
1160763201 19:796074-796096 CAGTTTCCCCACCTGTAGGCGGG + Intergenic
1160763300 19:796488-796510 CAGTTTCCCCACCTGTAGGCGGG + Intergenic
1163335826 19:16671026-16671048 CAGTTTGCCCATATGTAGGAGGG - Intronic
1163724680 19:18915840-18915862 CAGTTTGCCCACAAGATGGCAGG - Intronic
1164888009 19:31799745-31799767 CAGGTCACCCCCAGGCAGGCAGG + Intergenic
1165101896 19:33443803-33443825 CAGTGTGTCCTCAGGCAGGGAGG + Intronic
1165101911 19:33443993-33444015 CAGTGTGTCCTCAGGCAGGGAGG + Intronic
1165279313 19:34783052-34783074 CACATTGACAACAGGCAGGCAGG + Intergenic
1166264503 19:41670475-41670497 GAGTTTGCTCTCAGTCAGGCAGG + Intronic
1168073024 19:53963123-53963145 CAGTTTGACCACGGGCAGCCGGG - Exonic
925451115 2:3969781-3969803 CAGCTTGGCCACAGACAGGAAGG - Intergenic
925464794 2:4097440-4097462 CTGTTTGACCTCAGGCAAGCTGG + Intergenic
926321791 2:11753486-11753508 CAGTTTAACCACAGGGACGCTGG + Intronic
927875165 2:26650398-26650420 CATTCTGCCCACAGGGTGGCTGG + Intergenic
927911151 2:26900874-26900896 CAGTCTGCCCACCGCGAGGCTGG - Intronic
928775696 2:34760355-34760377 CAGGCTGCCTCCAGGCAGGCTGG - Intergenic
929865635 2:45715071-45715093 AAGCTTTTCCACAGGCAGGCAGG + Intronic
931417724 2:62097415-62097437 GAGTTTGCCCATAGGGAGTCTGG + Intronic
936048615 2:109205722-109205744 CACTTTGCTCACTGGCAGGAAGG + Intronic
936308204 2:111360744-111360766 CAGTTGGTCCAGAGGTAGGCAGG - Intergenic
937496746 2:122428615-122428637 CAGTGAGACTACAGGCAGGCGGG - Intergenic
941019340 2:160391229-160391251 AAGTTTGGACACAGACAGGCAGG + Intronic
944443837 2:199769626-199769648 CAGATTGCACACTGGCAAGCAGG - Intronic
944474797 2:200092623-200092645 CAGTATCCCCACAGGAAGCCAGG + Intergenic
947179004 2:227395578-227395600 CTGTGTGCCCAGAGGGAGGCTGG - Intergenic
947638699 2:231693954-231693976 CAGAGACCCCACAGGCAGGCTGG - Intergenic
947984401 2:234436608-234436630 CAGGTTCCTCCCAGGCAGGCGGG + Intergenic
948051513 2:234982648-234982670 CAGTTTTTGCACAGGCAGGGAGG + Intronic
948403341 2:237700329-237700351 CAGTTTGTTCACAGACAAGCAGG - Intronic
948942238 2:241202362-241202384 CTGTTGGCCCCCAGGGAGGCGGG + Intronic
1170975508 20:21160362-21160384 CAGGTTTCCCACAGGCAGCCTGG - Intronic
1172132051 20:32662240-32662262 CAGTGTGCCCAGAGTCAGCCAGG - Intergenic
1173151213 20:40567976-40567998 CAGTTGGCCCCCTGGCAGGTGGG + Intergenic
1173530582 20:43766528-43766550 CAGTCTTCCCACTGGCAGTCCGG + Intergenic
1174850060 20:53985299-53985321 CAGTTTGCCCAGAGGCAGAGAGG + Exonic
1177816423 21:25982258-25982280 CAGTCTCCCCACAGGCCTGCTGG - Intronic
1178671638 21:34596138-34596160 CAGTTTGCCCACTTGTAGGATGG - Intronic
1178935723 21:36859923-36859945 CAGTGTGCCCTTAGGCAGCCAGG - Intronic
1179926523 21:44538098-44538120 CAGTCACCCCACAGCCAGGCCGG - Intronic
1180467564 22:15627762-15627784 CAGGTTGTCCATTGGCAGGCAGG - Intergenic
1180710543 22:17836543-17836565 CAGGTTGCATCCAGGCAGGCAGG - Intronic
1180881601 22:19208018-19208040 CAGTTTTTCCACAGACAGGTCGG - Intronic
1180947232 22:19702970-19702992 CAGATTGCAGACAGGGAGGCAGG + Intergenic
1181555661 22:23670434-23670456 CAGTTTCCCCACATGTAAGCAGG - Intergenic
1183393861 22:37560723-37560745 CCGGGTGCCCACAGGAAGGCCGG + Intronic
1183448675 22:37877999-37878021 CAGCTTGGCCACAGGCATGGTGG - Exonic
1183484662 22:38082527-38082549 CAGGGTTCCCACAGGCAGGAAGG + Intronic
1184091052 22:42293207-42293229 CAGTTTGCTCAGAGTCAGCCAGG - Intronic
1185295618 22:50052294-50052316 CAGTTTGACCACAGCTAAGCAGG - Intronic
1185324395 22:50218642-50218664 CAGGCATCCCACAGGCAGGCAGG + Intronic
1185363095 22:50420836-50420858 CAGGTTCCCCACATGCCGGCAGG + Intronic
949566601 3:5251115-5251137 CTGCTTGTCCCCAGGCAGGCAGG - Intergenic
949899799 3:8801976-8801998 CAATTTGCCCAAAGGAAGGAAGG + Intronic
950234231 3:11304600-11304622 CACTTGGCCAACAGGCAGGCAGG - Intronic
950264183 3:11562443-11562465 CTCTGTGTCCACAGGCAGGCAGG - Intronic
951580413 3:24157253-24157275 CACTTTGCCCTCTGGCTGGCTGG + Intronic
952901844 3:38116130-38116152 CAGCCTGCCCACAAACAGGCCGG + Intronic
954410223 3:50367358-50367380 CAGTGTGCCCAGCAGCAGGCAGG - Intronic
956176966 3:66482090-66482112 CAGCCTGGGCACAGGCAGGCTGG + Intronic
960823769 3:121761144-121761166 TAGTTTGCCCAAAGGTAGGGAGG + Intergenic
961476688 3:127151118-127151140 CCCATTGCCCACAGGGAGGCTGG + Intergenic
964611300 3:158618888-158618910 CAGTCTGGCCACAGGCAGTAAGG - Intergenic
967984211 3:195083276-195083298 CAGTTTACACACAGGTAGACAGG - Intronic
968084200 3:195867330-195867352 CGCTTCGCCCACAGCCAGGCTGG + Intronic
968535859 4:1128643-1128665 CAAATAGCCCACAGGAAGGCAGG + Intergenic
968782313 4:2592529-2592551 ACATTGGCCCACAGGCAGGCAGG + Intronic
969058026 4:4414132-4414154 CAGGTTCCCCACAGGGAGGAGGG + Intronic
969301642 4:6300560-6300582 CCTTTTGCCCAGAGGCAGGGTGG + Intronic
969712083 4:8850263-8850285 GAGGCTCCCCACAGGCAGGCGGG - Intronic
970024142 4:11603937-11603959 CAGTTTGCCCACACCCCTGCAGG + Intergenic
971311063 4:25526073-25526095 CAGGCTGCCCGCAGGCAGGAAGG - Intergenic
975719560 4:77236597-77236619 CTGGATGCCCACAGGCAGGCAGG - Intronic
976002071 4:80386105-80386127 CAGTCTGCCCCCAGGGAGCCTGG + Intronic
976427045 4:84916530-84916552 CAGTTTGTACTCAGGCAGGAGGG + Intronic
976702022 4:87980206-87980228 ATGTTTGCCAGCAGGCAGGCAGG - Intronic
978370637 4:108026647-108026669 CAGTTTCCCCGCATGCAGTCAGG + Intronic
979583077 4:122382863-122382885 CAGTTTACCCAGAAGCAGTCAGG + Intronic
984137129 4:175954820-175954842 CTGTTTGCCATCAGGCAGCCAGG - Intronic
984742048 4:183174251-183174273 CAGGTTGGGCAAAGGCAGGCAGG + Intronic
984922687 4:184779531-184779553 CAGACTGCCCAAAGGAAGGCTGG + Intronic
987937284 5:24482363-24482385 CAGTGTGAACACAGGAAGGCAGG + Intergenic
988673410 5:33406528-33406550 CAGTGTGCTCAGAGGCAGTCAGG + Intergenic
990444236 5:55879155-55879177 TAGTCTGCCCTCAGACAGGCTGG + Intronic
995581581 5:113607951-113607973 CAGTTTGCCCAGAGACAGAGAGG - Intergenic
996794433 5:127329720-127329742 TAGTTTACCAACAGGCAGGTTGG + Intronic
998093574 5:139384458-139384480 CAGTGTGGACACCGGCAGGCGGG - Intronic
1000190809 5:158908892-158908914 CAGCTTGACCACAGCCCGGCTGG - Intronic
1000796795 5:165674090-165674112 CAGTATGCCCATTGGCAGACTGG + Intergenic
1001309623 5:170601729-170601751 CAGGAAGCCCACAGGCCGGCAGG + Intronic
1002299631 5:178249894-178249916 GGGTTTGCACACAGGCAGCCTGG + Intronic
1003436548 6:6094132-6094154 TAGTTTACTCACAGGCAAGCAGG - Intergenic
1006886102 6:37383521-37383543 CCCTGTGGCCACAGGCAGGCAGG - Intronic
1012620613 6:101339698-101339720 CAGCATGGCCACAGGGAGGCAGG - Intergenic
1015830720 6:137365969-137365991 CAACTTTCACACAGGCAGGCAGG + Intergenic
1018701999 6:166434551-166434573 CGGGATGCCCACAGGCAGACAGG - Intronic
1018745440 6:166758065-166758087 CCACTTGCCCACAGCCAGGCTGG + Intronic
1019420343 7:947904-947926 CAGTGTGCCCAGAGCCAGGGCGG - Intronic
1020891242 7:13880440-13880462 CAGTGTCAACACAGGCAGGCAGG - Intergenic
1021848010 7:24781172-24781194 CAGTGTGACCACAGACAGGCAGG + Intergenic
1022881880 7:34596143-34596165 CAGTTTTTCCACGGACAGGCAGG - Intergenic
1023017382 7:35981715-35981737 CCTTTTCCCCACATGCAGGCAGG + Intergenic
1026034792 7:66823231-66823253 CAGTTTGCCCAGATGCAGAATGG - Intergenic
1029434349 7:100554002-100554024 CAGGTTGCCCTCAGATAGGCAGG - Intronic
1031512252 7:122665181-122665203 CTGCTTGCCCACATGCAGACAGG - Intronic
1032776599 7:135120511-135120533 CACATTACCCACAGGAAGGCAGG + Intronic
1033545883 7:142399876-142399898 CAGTCTGCCCACAGCAGGGCTGG + Intergenic
1033548575 7:142424964-142424986 CAATTTGCCCACAGCAGGGCTGG + Intergenic
1033753692 7:144379885-144379907 CCCTGTGCCCACAGGCTGGCTGG + Exonic
1048021432 8:130542843-130542865 CAGTTTGCACACAGCCAGAAAGG - Intergenic
1048393853 8:133994222-133994244 CAGTCTGCCTCCAGGTAGGCTGG - Intergenic
1049079129 8:140427965-140427987 CAGTCTCCCCATAGGCAGGGAGG - Intronic
1049147636 8:141013294-141013316 CAGGTTGCTCACAGGCTGGTGGG + Intergenic
1049336366 8:142088835-142088857 CAGTCTGCACACAGGCAGCCCGG + Intergenic
1049386713 8:142346626-142346648 CAGGTTGCAGACAGGCACGCGGG - Intronic
1052037314 9:23697017-23697039 CAGTCTTCCCCCAGGGAGGCAGG - Intronic
1053444715 9:38143130-38143152 CAGTTTCCCTACAGGAAGGCAGG - Intergenic
1055627441 9:78188721-78188743 CAGTTTGACAAAAGGCAGCCAGG + Intergenic
1056993198 9:91429881-91429903 CAGCTTGCCCACAGCCACTCAGG + Intergenic
1060143667 9:121232756-121232778 CAGTTAGGTCTCAGGCAGGCCGG + Intronic
1060283717 9:122230262-122230284 CAGTTTGCACACACACAGGCAGG + Intergenic
1060475094 9:123980885-123980907 CAGTCTGCACCCAGGCAGGTTGG - Intergenic
1060791154 9:126486603-126486625 CATTAGGCCCACAGGCAGGCCGG - Intronic
1061561933 9:131410226-131410248 CATCTAGCTCACAGGCAGGCAGG - Intronic
1061620743 9:131809855-131809877 CTGTGTGCCCACCAGCAGGCTGG - Intergenic
1062199960 9:135297326-135297348 CAGGATGCTGACAGGCAGGCAGG + Intergenic
1188263896 X:28046640-28046662 AACTGTGCCCACAGGCAGTCAGG - Intergenic
1189285951 X:39852602-39852624 AAAATTGCCCACAGGCAGGGAGG + Intergenic
1193794017 X:85851369-85851391 CAGTGTGTCCACAGGCAGACAGG + Intergenic
1193934615 X:87601363-87601385 CAGGTTGCCCACATGCATGGTGG + Intronic
1198672135 X:139092311-139092333 GAGTTTGACCAAATGCAGGCTGG - Intronic