ID: 1156378720

View in Genome Browser
Species Human (GRCh38)
Location 18:36537514-36537536
Sequence TCTCTGACACCCACCCAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 344
Summary {0: 1, 1: 0, 2: 1, 3: 34, 4: 308}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156378720_1156378726 26 Left 1156378720 18:36537514-36537536 CCTTGCTGGGTGGGTGTCAGAGA 0: 1
1: 0
2: 1
3: 34
4: 308
Right 1156378726 18:36537563-36537585 ACATCTGCTTGTTTGAAATAAGG 0: 1
1: 0
2: 0
3: 15
4: 373
1156378720_1156378723 -2 Left 1156378720 18:36537514-36537536 CCTTGCTGGGTGGGTGTCAGAGA 0: 1
1: 0
2: 1
3: 34
4: 308
Right 1156378723 18:36537535-36537557 GAAAGCCAAGTAGGCACTGAGGG 0: 1
1: 0
2: 1
3: 28
4: 225
1156378720_1156378722 -3 Left 1156378720 18:36537514-36537536 CCTTGCTGGGTGGGTGTCAGAGA 0: 1
1: 0
2: 1
3: 34
4: 308
Right 1156378722 18:36537534-36537556 AGAAAGCCAAGTAGGCACTGAGG 0: 1
1: 0
2: 2
3: 28
4: 316

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156378720 Original CRISPR TCTCTGACACCCACCCAGCA AGG (reversed) Intronic
900137158 1:1122455-1122477 CTTCTGCCACCCACCCAGCCCGG - Intergenic
900358817 1:2278195-2278217 TCTCTGTGCCCCACCCATCATGG + Intronic
901435505 1:9245130-9245152 GCTCTGACAGCCCCCAAGCAGGG + Exonic
902312902 1:15595231-15595253 TCTCAGAGACCCACCCAGTGAGG + Intergenic
903380569 1:22894131-22894153 TCAATGACACTCACCCAACATGG - Intronic
903552094 1:24164790-24164812 GCTCTGTCACCCACCCAGGCTGG + Intronic
903552196 1:24165657-24165679 TCCCTGATTCCCAGCCAGCAGGG + Intronic
904047533 1:27617429-27617451 TCTCTGTAACCCTCCCAGCCAGG - Intronic
904102763 1:28046875-28046897 GCTCTGCCACCAACCCAGGATGG + Intronic
904334107 1:29785829-29785851 TCCCTGACTCCTCCCCAGCAGGG - Intergenic
905346271 1:37313134-37313156 CCTCAGACCCCCACCCAGGAGGG + Intergenic
905880149 1:41457853-41457875 TCTCTGACACTCCCCCAGGCTGG - Intergenic
906013628 1:42552970-42552992 TCTCTGACACCACCCCAGTCAGG + Intronic
907009454 1:50949889-50949911 TCTCTGTCACCCACCCAGGCTGG + Intronic
907134186 1:52123749-52123771 GTTCTGTCACCCACCCAGGATGG - Intergenic
907400979 1:54224640-54224662 TGTCTCCCACCCACCCACCACGG + Intronic
907435064 1:54440350-54440372 TTCCTCACACCCACCCAGGAGGG + Intergenic
909666182 1:78135413-78135435 TCTCTCACACACACACATCAAGG - Intronic
910421058 1:87064014-87064036 TCTCTGACATCACCCCATCAGGG + Intronic
911007044 1:93237174-93237196 TGTCTGTCACCCTCTCAGCAGGG + Intronic
911018150 1:93357348-93357370 TCTGTGTTACCCACCAAGCAAGG + Intronic
911854987 1:102865311-102865333 TCTGTGACACTCACCCAGAAGGG - Intergenic
912680803 1:111727611-111727633 CCTCTGCCACCCTCCCAACAAGG + Exonic
912916824 1:113823857-113823879 TCTCTGACACCAACTCATGATGG - Intronic
914349373 1:146826992-146827014 CCTCTGACACCATTCCAGCAGGG - Intergenic
915230182 1:154439930-154439952 ACTCTGTCACCCACCCAGGCTGG + Intronic
915271935 1:154759582-154759604 TCTCTCCTACACACCCAGCATGG + Intronic
915862683 1:159463104-159463126 CCTCTGACACCACCCCAGCAGGG + Intergenic
915978538 1:160406376-160406398 TCTCTGACTCCCACCCTCAAGGG - Intronic
916885607 1:169064619-169064641 CCTCTGACACCATTCCAGCAGGG - Intergenic
917561469 1:176161566-176161588 CCTCTGTCACCCACCCAGTCTGG - Intronic
918149542 1:181786200-181786222 CCTCTTACACTCAGCCAGCATGG - Intronic
918652834 1:186987103-186987125 TCCCAGACACCCAACAAGCAAGG - Intronic
919990477 1:202705623-202705645 TCCCTGGCACTCAGCCAGCAGGG + Intronic
920319313 1:205105989-205106011 TCTCTGACACCACCCCAGTGAGG - Intronic
921172974 1:212565588-212565610 TGGGTGGCACCCACCCAGCAGGG - Intronic
922218892 1:223542962-223542984 TCTGTGGCAGGCACCCAGCAGGG - Intronic
922865666 1:228859565-228859587 TCTCTGACTCCAACACAGCCTGG - Intergenic
922892368 1:229071929-229071951 TCTCAGCCTCCCACCCAGCCTGG - Intergenic
923268576 1:232334985-232335007 TCTCTGAAATCCACCCACCTTGG + Intergenic
924799521 1:247317500-247317522 TCTCTGAGACCACCCCAGCAGGG - Intronic
924910090 1:248500643-248500665 TCACTGCCACCCACCCAGAGTGG - Intergenic
924914014 1:248547412-248547434 TCACTGCCACCCACCCAGAGTGG + Intergenic
1065663609 10:28034442-28034464 TCTCTGACATCACTCCAGCAGGG + Intergenic
1065663644 10:28034657-28034679 TCTTTGATACCTCCCCAGCATGG + Intergenic
1066562890 10:36689691-36689713 CCTCTGTCACCAACCCACCAGGG - Intergenic
1067209921 10:44251512-44251534 TCTCTGAAAACCACCTAGCCAGG + Intergenic
1069515048 10:69070648-69070670 GCTCTCACACCCACCCTGCCTGG + Intergenic
1070328821 10:75404016-75404038 TCTCTGTCTCCCACTCCGCACGG + Intergenic
1071312310 10:84354167-84354189 CCTCTGTCACCCACCCAGGCAGG - Intronic
1073575820 10:104622354-104622376 TCTCTGACACCATTCCTGCAGGG - Intergenic
1073575843 10:104622497-104622519 CCTCTGACACCACCCCAGCAGGG - Intergenic
1073865297 10:107796503-107796525 TGCCTTCCACCCACCCAGCATGG + Intergenic
1074113452 10:110438437-110438459 TCCATGCCACCCACCCAGCTGGG + Intergenic
1075397070 10:122134999-122135021 TCGATGAAACACACCCAGCATGG - Intronic
1075529632 10:123218511-123218533 TCTTTGACACCTCCCTAGCAAGG + Intergenic
1076444861 10:130507462-130507484 CCTCTGACACCACCCTAGCAAGG + Intergenic
1076547089 10:131252684-131252706 CTTCTGACAGCCACCCACCATGG + Intronic
1076872676 10:133201373-133201395 TCTCTTGCACCCGCCCACCACGG - Intronic
1077437233 11:2548835-2548857 CCTCAGACACCCACCCACCTGGG - Intronic
1077868732 11:6243768-6243790 TCACTGATACCTACCCAGCATGG + Intronic
1081528187 11:43941481-43941503 GCACTGACAGGCACCCAGCAGGG - Intronic
1082224200 11:49682967-49682989 TCTCTTACAACCATCCTGCAAGG + Intergenic
1082740883 11:56909629-56909651 TCTCTACCCCCCACCCAGAATGG - Intergenic
1083340629 11:61956314-61956336 TCTCTGACACCCCCTCAGCCTGG + Intronic
1084530130 11:69722308-69722330 GCTCTGTCACCCACCCAGGCTGG + Intergenic
1084559555 11:69895251-69895273 ACCCAGACACCCACCCAGCCGGG + Intergenic
1084651368 11:70491337-70491359 TCTCAGACACCCCCCCAACTTGG + Intronic
1085106358 11:73846694-73846716 TCTCTCTCTCCCACCCAGCCTGG + Intronic
1086543275 11:87938422-87938444 TCTCTGGCACTACCCCAGCAGGG + Intergenic
1086624848 11:88936227-88936249 TCTCTTACAACCATCCTGCAAGG - Intronic
1087626461 11:100602575-100602597 CCTCTGACACCACCCCAGCAAGG - Intergenic
1088470570 11:110184493-110184515 GCTCTACCACCCACCCTGCAAGG - Intronic
1088742368 11:112777512-112777534 CCTCTGTCTCACACCCAGCAGGG + Intergenic
1090410956 11:126509344-126509366 TCTCTGCCACCCTCCAAGCTTGG + Intronic
1091534286 12:1391208-1391230 TCTTTGACACCACTCCAGCAGGG + Intronic
1092109558 12:5949286-5949308 TCCCTGACCCCCTCCAAGCAAGG + Intronic
1092625215 12:10319638-10319660 ACTCTTACACACAGCCAGCAAGG + Intergenic
1094726168 12:33118809-33118831 TCTCAGCCACCCACAGAGCAGGG + Intergenic
1096694167 12:53338281-53338303 TCTCAGACTCCCCCCCAACAAGG - Intronic
1098146075 12:67499068-67499090 TCTCACCCACCCATCCAGCATGG - Intergenic
1098739780 12:74157870-74157892 TCTCTGACACCAGCCCTGTAGGG + Intergenic
1099557241 12:84124921-84124943 GCTCTGTCACCCACCCAGGCTGG - Intergenic
1100572574 12:95857284-95857306 CCTCTGATACCCAGTCAGCATGG - Intergenic
1101756573 12:107625677-107625699 CCTCTAACACCACCCCAGCAGGG + Intronic
1104105682 12:125656912-125656934 TCTCTTACACACATACAGCAGGG + Exonic
1104451921 12:128876336-128876358 TCTCTGACTCTCACCCAGGCTGG + Intronic
1104734539 12:131128874-131128896 TCACTCACACCCAGACAGCAGGG - Intronic
1104734546 12:131128905-131128927 TCACTCACACCCAGACAGCAGGG - Intronic
1104734553 12:131128936-131128958 TCACTCACACCCAGACAGCAGGG - Intronic
1104734581 12:131129058-131129080 TCACTCACACCCAGACAGCAGGG - Intronic
1104734588 12:131129089-131129111 TCACTCACACCCAGACAGCAGGG - Intronic
1104734595 12:131129120-131129142 TCACTCACACCCAGACAGCAGGG - Intronic
1104734613 12:131129212-131129234 TCACTCACACCCAGACAGCAGGG - Intronic
1104734620 12:131129243-131129265 TCACTCACACCCAGACAGCAGGG - Intronic
1104734636 12:131129305-131129327 TCACTCACACCCAGACAGCAGGG - Intronic
1104734657 12:131129398-131129420 TCACTCACACCCAGACAGCAGGG - Intronic
1104734671 12:131129456-131129478 TCACTCACACCCAGACAGCAGGG - Intronic
1104734678 12:131129487-131129509 TCACTCACACCCAGACAGCAGGG - Intronic
1105416005 13:20211688-20211710 TCTCTGTCACCCCTCCAGAAGGG - Intergenic
1105533948 13:21246481-21246503 TCTCAGGTACCCACCCAGCCCGG - Intergenic
1108080101 13:46726600-46726622 TCTCTGACACCACCCCAGCAAGG - Intronic
1108178341 13:47817358-47817380 TCCCTCACACCAACCCAGTAAGG - Intergenic
1110093179 13:71480602-71480624 TCTCTGACACTCACAGACCAAGG - Intronic
1111626689 13:90796846-90796868 GCTCTGTCACCCACACTGCAGGG - Intergenic
1112500418 13:99938888-99938910 TCGCTGTCACCCACAGAGCACGG - Intergenic
1112577930 13:100653504-100653526 TCTCTGACCCCTCCCCAACAAGG - Intronic
1117246383 14:53890593-53890615 TGTCTGACCCCCACCCAGGAGGG - Intergenic
1118987754 14:70771395-70771417 TCTATTACACCCTCCCAGGATGG - Intronic
1119813847 14:77547470-77547492 TTTATGACCCCCTCCCAGCAAGG + Intronic
1121271627 14:92641632-92641654 TCTCTGGCTCCCACTCAGAAGGG - Intronic
1121498121 14:94411698-94411720 CCTCTGGCACCCACCTTGCATGG - Intergenic
1122153622 14:99737752-99737774 CGGCTGTCACCCACCCAGCAGGG - Intronic
1122685528 14:103503487-103503509 ACTCTCACACCCACCCAGACGGG - Exonic
1122863418 14:104592939-104592961 CCTATGGCACCCACCCAGGAGGG + Intronic
1122956185 14:105072634-105072656 CCCCTGACACACACACAGCAGGG - Intergenic
1123069391 14:105634825-105634847 TCTCTGACACTCTCTCACCATGG - Intergenic
1123088490 14:105730614-105730636 TCTCTGACACTCTCTCACCATGG - Intergenic
1123094437 14:105759986-105760008 TCTCTGACACTCTCTCACCATGG - Intergenic
1123754156 15:23383674-23383696 ACTCTGTCACCCACCCAGGCTGG + Intergenic
1124247910 15:28086202-28086224 CCTCTGACACCCTGTCAGCAAGG - Intronic
1125303326 15:38281420-38281442 TCTCTGTCTGTCACCCAGCATGG + Intronic
1125651874 15:41324019-41324041 GCTCTGTCACCCACCCAGGCTGG + Intronic
1125801921 15:42456620-42456642 ACTCTGTCACCCACCCAGACTGG - Intronic
1132554332 16:566018-566040 TCACTGCCTCCCTCCCAGCAGGG + Intergenic
1132676946 16:1124854-1124876 ACCCTGCCCCCCACCCAGCAGGG + Intergenic
1133737774 16:8628988-8629010 CCTCTGATTCCAACCCAGCAGGG + Exonic
1134462227 16:14439340-14439362 ACTCTGTCACCCACCCAGGCTGG - Intronic
1136083360 16:27867570-27867592 TCTCTGACACACAGTGAGCAAGG - Intronic
1136227232 16:28867042-28867064 TCTCAGTCACCCACCCTCCAAGG - Intronic
1139984663 16:70888562-70888584 CCTCTGACACCATTCCAGCAGGG + Intronic
1140264318 16:73407433-73407455 GCTCTGAGACCCACACAGCTTGG + Intergenic
1140765213 16:78150905-78150927 GCTCTGTCACCCACCCAGGCTGG + Intronic
1140900682 16:79364433-79364455 ACACTGCCACCCACCCAGCCTGG - Intergenic
1142239451 16:88938535-88938557 GCTCTAAGACCCACCCAGGAAGG + Intronic
1142601187 17:1053731-1053753 GCTCTGACACCCGCCCAGGCTGG + Intronic
1143028426 17:3954139-3954161 TCTCTGCCACCCCCACAGCAAGG + Intronic
1143533562 17:7521534-7521556 CCTCTGTCACCCACCCAGGCTGG - Intergenic
1143780332 17:9225769-9225791 TCTCTGACTGACACCCGGCAGGG + Intronic
1144164515 17:12596504-12596526 TCTCTGACACTATCCCAGCAAGG + Intergenic
1144243139 17:13334183-13334205 TCTCTGAGTCCCACCCACCCTGG - Intergenic
1145268091 17:21390087-21390109 TCCCTGACTCCCCACCAGCAGGG + Intronic
1146285640 17:31572572-31572594 TCACTGTCACATACCCAGCACGG + Intronic
1146414580 17:32620236-32620258 TCCTTGACACCAGCCCAGCAGGG + Intronic
1146634578 17:34494585-34494607 TCTCTGACTCAGAGCCAGCAGGG - Intergenic
1146916085 17:36679367-36679389 TCAGTGACACCCTCCCACCATGG + Intergenic
1146989903 17:37260331-37260353 GCTTTGTCACCCACCCAGGATGG + Intronic
1147340567 17:39751177-39751199 TCTCAGACACTCACCAAGAATGG - Intergenic
1148244951 17:46024572-46024594 TCTGTGACACCCCCACAACAGGG - Exonic
1148889168 17:50795338-50795360 GCTCTGTCACCCACCCAGACTGG - Intergenic
1150061957 17:62076122-62076144 ACTCTGTCACCCACCCAGACTGG - Intergenic
1150299883 17:64038955-64038977 TTTCTGACACACAGCCACCATGG + Intergenic
1151338121 17:73452314-73452336 TCTCTGACACACAGACACCAGGG + Intronic
1151345018 17:73496122-73496144 ACGCTGACTCCCACCCAGCAGGG - Intronic
1151671339 17:75573288-75573310 GCCCCGACACCCACCCAGCCCGG - Intronic
1152779662 17:82220851-82220873 ACTCTGTCACCCACCCAGGCTGG + Intergenic
1152789406 17:82270800-82270822 TCCCAGACAGCCACCCATCAGGG - Intronic
1152803045 17:82340445-82340467 TCACTGACAGCCTCTCAGCATGG - Intergenic
1153338791 18:3952856-3952878 TCTCTTTCACCCACCCAGGACGG + Intronic
1155096303 18:22559543-22559565 TCGCTGACACCCACCCGGGATGG - Intergenic
1156138467 18:34075344-34075366 TCTCTCACACACACCCACAAAGG - Intronic
1156275026 18:35576115-35576137 TCTCTGACTCCTTCTCAGCAGGG - Intergenic
1156378720 18:36537514-36537536 TCTCTGACACCCACCCAGCAAGG - Intronic
1156410009 18:36818702-36818724 TCTATGCCACTTACCCAGCATGG - Intronic
1157501481 18:48193888-48193910 TCCCTGCCACCTAGCCAGCAGGG + Intronic
1157524280 18:48367730-48367752 CCTCTGACACCATCCCAGCAGGG - Intronic
1157678102 18:49582499-49582521 TCTCTGTCCCGAACCCAGCAAGG - Intronic
1157740616 18:50089772-50089794 CCTTTGATACCCACCCAACAAGG + Intronic
1159420195 18:68208537-68208559 TCACTCACCCCCACCCAGGAGGG + Intergenic
1161104246 19:2435378-2435400 GCTCTGACACCGCCACAGCATGG + Intronic
1162462626 19:10822217-10822239 CCTCTGTCACCCACCCAGGCTGG + Intronic
925107667 2:1306859-1306881 TCTCTGACACACACAGTGCATGG - Intronic
925361261 2:3282179-3282201 TTGCCGACACCAACCCAGCAGGG - Intronic
926131562 2:10305988-10306010 GCTCTGACGCACACTCAGCAGGG - Intronic
926680808 2:15662747-15662769 TCACAGACACACACGCAGCATGG + Intergenic
926699544 2:15794342-15794364 TCTCCTACCCCCACCCAGCTGGG - Intergenic
927613625 2:24566769-24566791 TCGTTGGCACCCACCCAGCTGGG + Intronic
928587327 2:32773651-32773673 TTCCTCACACCCACCCTGCAAGG - Intronic
929053394 2:37856470-37856492 TCTCTGACCCCCTCCAAGCCTGG - Intergenic
930986406 2:57593702-57593724 TCTCTGACACCACCACGGCAAGG + Intergenic
934300970 2:91775868-91775890 TCCCTGGCACCTCCCCAGCAGGG - Intergenic
936057628 2:109272729-109272751 TCTCACATACCCACCCAGCTGGG - Intronic
936527038 2:113248441-113248463 TCCCTGACTCCCACACTGCAGGG - Intronic
938085925 2:128402082-128402104 CCTCTGACACCACTCCAGCATGG + Intergenic
938711087 2:133976887-133976909 TCCCAGACACTCACCCAGCCTGG - Intergenic
942113700 2:172707098-172707120 CCTCTGATACCCCACCAGCAGGG + Intergenic
942824644 2:180160499-180160521 TCACTGATACTCACCCAGGACGG - Intergenic
944427178 2:199595344-199595366 GCTGGGACTCCCACCCAGCAAGG + Intergenic
944966235 2:204937314-204937336 CCTCTGACACCCATTCAGCTTGG + Intronic
945234435 2:207621792-207621814 TGCATGACACTCACCCAGCAGGG + Exonic
946027824 2:216682661-216682683 AGACTGACACCCACACAGCATGG + Intronic
946272297 2:218604585-218604607 GCTCTGTCACCCACCCAGGCTGG + Intergenic
948659798 2:239499884-239499906 TCTCTGCCACCCACCCAAGCTGG - Intergenic
948924727 2:241088120-241088142 TCTCTGACTCACAGCCAGCCAGG + Exonic
948994417 2:241571235-241571257 GCTCTGACACCCACCCCTCGGGG - Intronic
1171946013 20:31378174-31378196 TCTCTGTCACCACCCCATCAGGG - Intronic
1172597657 20:36161177-36161199 TTTCTTTCACCCACCCAGTATGG + Intronic
1172767599 20:37359028-37359050 GCCCTGATCCCCACCCAGCATGG - Intronic
1173183362 20:40820986-40821008 TCTCCCACACCCACCCAGCTGGG + Intergenic
1173260701 20:41432387-41432409 TTTCTGATACCAGCCCAGCAAGG - Intronic
1173301853 20:41810456-41810478 TCTCTGACACCACTCCAGCAGGG - Intergenic
1174073368 20:47914387-47914409 GCTCTGTCACCCACCCAGGCTGG - Intergenic
1175215659 20:57390675-57390697 TCCCTGACACCAGCCCAGAACGG + Intergenic
1175252371 20:57617170-57617192 GCTCTGCCAACCACCCAGCTTGG + Intronic
1175844355 20:62050870-62050892 CCTCCTGCACCCACCCAGCAAGG + Intronic
1179516494 21:41911950-41911972 TCTCTGCCACCCAAACAGCTGGG + Intronic
1179610825 21:42548780-42548802 TCTCTGTCACCCTCACAGAAGGG + Intronic
1179664245 21:42899148-42899170 AGTCTCACAACCACCCAGCAAGG - Intronic
1179710888 21:43212377-43212399 TCTCTGCCAGCCACCCTGCTGGG - Intergenic
1179794149 21:43772884-43772906 ACTCTGTCACCCACCCAGGCTGG + Exonic
1179948886 21:44698514-44698536 CCTCTGACACTCGCCCATCAGGG - Intronic
1180050357 21:45328288-45328310 TCTCGGACGCCGCCCCAGCACGG + Intergenic
1180721189 22:17909922-17909944 TCTTTGACAAGCACACAGCATGG + Intronic
1181040861 22:20192030-20192052 TCCCTGACTCCCACCCAGGATGG - Intergenic
1181962269 22:26630861-26630883 TCTCTTTCCCCCACCCAGTACGG + Intergenic
1182238705 22:28897348-28897370 ACTCTGTCACCCACCCAGGCTGG + Intronic
1182316002 22:29447801-29447823 ACTCTGTCACCCACCCAGGCTGG + Intergenic
1182512852 22:30831496-30831518 TCTCTGAACCCCAACCACCAAGG - Intronic
1183031347 22:35108669-35108691 TCTGAGACACCACCCCAGCAAGG + Intergenic
1184459343 22:44628285-44628307 TCCCTGTCACCCACCCATCAAGG + Intergenic
1184650170 22:45916056-45916078 CCTCTGGCTCCCACCAAGCACGG - Intergenic
1185251519 22:49804147-49804169 TCTCTCACCCCCACCCTCCAGGG - Intronic
949638091 3:6006268-6006290 TCTCTGCCAGGGACCCAGCACGG + Intergenic
949644249 3:6075157-6075179 TCTCTGACTCATCCCCAGCAAGG + Intergenic
950077640 3:10198468-10198490 TCACTGTCTCCCACCCAGCTAGG - Intronic
950627872 3:14261404-14261426 ACTCCGACCTCCACCCAGCAGGG + Intergenic
950642484 3:14357492-14357514 TCTCTGACTCCTACCCCTCAAGG + Intergenic
953059341 3:39414323-39414345 TCTCTCAGACCCACTCAGCTGGG + Intergenic
953512286 3:43554580-43554602 TCTCTGACACCATTCCAGCAAGG + Intronic
954117080 3:48472974-48472996 TCTCAAACACACACGCAGCATGG + Intronic
954140721 3:48603793-48603815 TCTCTGCCACCCACCCCTCCAGG + Intronic
954584234 3:51720147-51720169 TCCCTGCCACCCATCTAGCAGGG + Intergenic
954758102 3:52853495-52853517 TCTCTCACAGCCGCCCAGCTGGG + Intronic
955495668 3:59529609-59529631 TCTCTCACCATCACCCAGCAAGG + Intergenic
955846127 3:63164669-63164691 GCTCTGACACCTTCCCAGGAAGG - Intergenic
955852552 3:63236413-63236435 TCTCTGTCACAATCCCAGCAAGG - Intronic
959241462 3:103801162-103801184 TCTCTGACACCACTCCATCATGG + Intergenic
960388132 3:117045577-117045599 ACTATGACACCCATCCTGCATGG - Intronic
960678458 3:120221691-120221713 CCTCTGTCACCCACCCAGGCTGG + Intronic
962193462 3:133335980-133336002 TAGCCGACACCCACCCATCAAGG + Intronic
962863168 3:139423424-139423446 TCTCTGGCACCACCCCAGTAGGG - Intergenic
962957678 3:140281114-140281136 TGTGTGACAGCCTCCCAGCAGGG + Intronic
963141067 3:141946493-141946515 TCTCTGACACCCATTCACCAGGG - Intergenic
963467779 3:145704221-145704243 TCCCTGGCACACAGCCAGCAAGG + Intergenic
965464238 3:169006946-169006968 TCTCTGACACCCTTCCATCCAGG - Intergenic
966607291 3:181834195-181834217 TCTCTGACACCATCCCAGTGTGG + Intergenic
968764367 4:2460309-2460331 TCTAGGAGACCCACCCAGGAGGG - Intronic
968900155 4:3427149-3427171 GCCCTGACACCCACCCAGGCAGG + Intronic
968964966 4:3765202-3765224 CCTCTGACAAACACCCAGAACGG - Intergenic
968981271 4:3850967-3850989 TCTGGGTCACCCACCCATCATGG + Intergenic
969220728 4:5756819-5756841 TCTCTGAAAGTCACCCTGCAGGG - Intronic
971058147 4:22936782-22936804 ACTCTGACACCCAGGCAGGAGGG + Intergenic
971319206 4:25591778-25591800 ACTCTGTCACCCACCCAGCCTGG + Intergenic
971758576 4:30734889-30734911 TTGGAGACACCCACCCAGCAGGG - Intronic
973028284 4:45302385-45302407 TCTCTGACCCCATCCCAGGAAGG + Intergenic
974667292 4:64980517-64980539 TCTCTGTCACCCAGGCAGCTGGG + Intergenic
975491086 4:74989509-74989531 TCTCTGGCAGCCACCCTCCAGGG + Intronic
975491343 4:74992119-74992141 TCTCTGGCAGCCACCCTCCAGGG + Intronic
977691702 4:99918971-99918993 TCTCTGTTACCATCCCAGCAGGG + Intronic
983197320 4:164821864-164821886 TCTCTCACCCCCATCCAGGAAGG - Intergenic
985573201 5:661785-661807 TCTCTGTCACCTAGCCAGGAGGG - Exonic
988712129 5:33789177-33789199 TCTCTCACACACACTCAGCAAGG + Intronic
989731878 5:44658720-44658742 GCACTGAAACCAACCCAGCAGGG - Intergenic
991394690 5:66191860-66191882 TCTCTGTCACCCAGGCAGAAGGG + Intergenic
992841138 5:80696123-80696145 TCTCTGACACCATCCCCGTAAGG + Intronic
997235345 5:132269253-132269275 TCACTCACCCCTACCCAGCAGGG - Intronic
997281069 5:132646050-132646072 ACTCTGCCACCCACCCAGGCTGG - Exonic
999892415 5:155993372-155993394 GCTCTGACACCCACCCAGGCTGG + Intronic
1000240266 5:159402536-159402558 GCTCTGGCACTCAGCCAGCATGG + Intergenic
1000919601 5:167122440-167122462 TCTCTGACCCCCACCCTCCCCGG + Intergenic
1002789684 6:427954-427976 GCTCGGACACCCTCACAGCAAGG - Intergenic
1003028096 6:2576595-2576617 TCTCTGACACCACCCCAGTCGGG + Intergenic
1003377172 6:5590372-5590394 TCTCAGGCACCCAGCCAGCCCGG + Intronic
1003907059 6:10711536-10711558 ACTCTGTCACCCACCCAGGCTGG + Intergenic
1004890610 6:20097097-20097119 TCTCTAAAAAACACCCAGCACGG - Intergenic
1006442823 6:34062743-34062765 TCTCTGATGGCCACCCAGCCTGG - Intronic
1006934854 6:37710210-37710232 TTAATGACACCCACCCAGCCAGG + Intergenic
1012058471 6:94446322-94446344 TCTGTGACACCACCTCAGCAGGG - Intergenic
1016107791 6:140184705-140184727 TTTCTGACAGCCTCCCACCAGGG + Intergenic
1017071571 6:150579706-150579728 TCTCTGCCTGCCACCAAGCATGG + Intergenic
1018917924 6:168148942-168148964 ACTCTGTCACCCACCCAGGATGG - Intergenic
1019120118 6:169795408-169795430 TCTCTGAAACCCACCCCCCTGGG + Intergenic
1021222126 7:17986357-17986379 TCTCTGTCACCCACCCAGGTTGG + Intergenic
1021525025 7:21577367-21577389 TCTCTGACATCACCCCAGCAAGG - Intronic
1022507601 7:30916361-30916383 TCTAGGGCCCCCACCCAGCAGGG + Intronic
1022528900 7:31054784-31054806 TGCCTGAGACCCACCCACCATGG + Intronic
1023363708 7:39442072-39442094 TCTCTGAGAGCCACCAAGAATGG - Intronic
1023737823 7:43250298-43250320 TCTGTGACACCAACTCAGCCTGG + Intronic
1023850489 7:44147370-44147392 GCTCTGAGACGCCCCCAGCAAGG - Intronic
1024173940 7:46819127-46819149 TCTCTGACACCATCCTAGCAGGG - Intergenic
1024279859 7:47710071-47710093 GCACTGAAACCCACCCAGCCTGG - Intronic
1026036620 7:66834324-66834346 GCTCTGTCACCCACCCAGGCTGG + Intergenic
1026301101 7:69098718-69098740 TCTCTGTCACCCAGGCTGCAGGG - Intergenic
1027477115 7:78646987-78647009 TTACTGTCACCCACCCACCAAGG - Intronic
1028994022 7:97079582-97079604 CCTCTGTCATCCACCCAGCAAGG + Intergenic
1029428319 7:100511839-100511861 ACTCTGTCACCCACCCAGGCTGG + Intergenic
1030196543 7:106858814-106858836 TCACTGAGACACACCCTGCAAGG + Intergenic
1030668474 7:112308155-112308177 TTTCTGATACCCACCCAATAAGG + Intronic
1031750422 7:125564299-125564321 CCGCTGTCACACACCCAGCAAGG + Intergenic
1034292673 7:149945312-149945334 TCAGTGACAACCTCCCAGCAAGG + Intergenic
1035162691 7:156962612-156962634 TCTCTGACATGCAGCCAGGATGG + Intronic
1035174558 7:157040833-157040855 GCTCTGTCACCCACCCAGGCTGG - Intergenic
1036741982 8:11371573-11371595 CCTCTGACACCCACTGCGCAGGG + Intergenic
1036753218 8:11456204-11456226 TCACTCACACTCACACAGCAAGG - Intronic
1037618461 8:20542687-20542709 TATCTGACACGCCCCCAGCCTGG + Intergenic
1038549302 8:28451952-28451974 GCTCTGACACTCACCCAGGCTGG - Intronic
1039006637 8:33045534-33045556 TCTGTGACACTATCCCAGCAGGG - Intergenic
1039951569 8:42177007-42177029 ACTCTGTCACCCACCCAGGCTGG + Intronic
1041308259 8:56485912-56485934 TCTCTGACACCACTCCAACAGGG - Intergenic
1041973297 8:63768065-63768087 TCTCTGACACCAACGCAGTGGGG + Intergenic
1044712055 8:95067744-95067766 CCTCTGACACCACCCCAGCAGGG + Intronic
1046722349 8:117634788-117634810 TCTCTCACACCCACCCTGATTGG - Intergenic
1048466136 8:134666001-134666023 TCTCTGACACTAGCCCAGCTGGG - Intronic
1048571344 8:135659609-135659631 TCTCTGACACCACCCCAGCTGGG + Intergenic
1048955605 8:139533667-139533689 TCTCTGACAGTGAGCCAGCAGGG - Intergenic
1049383326 8:142328632-142328654 TTTCTGACAGCCACACACCAGGG + Intronic
1051768433 9:20549354-20549376 TCTCTGTTACCAACCCAGCATGG + Intronic
1053440876 9:38115415-38115437 GCTCTGCCACCCACCTAGCTGGG + Intergenic
1056249477 9:84733178-84733200 GCTCTGACACCACCCCACCAAGG - Intronic
1057021813 9:91705037-91705059 ACTCTGTCACCCACCCTGGAGGG + Intronic
1057426220 9:94951905-94951927 TCCCAGAACCCCACCCAGCATGG + Intronic
1058734752 9:107883954-107883976 CCTCTGACTCACACACAGCACGG + Intergenic
1059495714 9:114707532-114707554 TCTCTGTCCCCCACCAAGCCTGG + Intergenic
1061475870 9:130865829-130865851 TCTCTGCCAGGCACACAGCAAGG - Intronic
1185455983 X:311180-311202 CCTCAGACACCCACCCAACTCGG - Intronic
1187728237 X:22225867-22225889 TGTATGACAACCAGCCAGCATGG - Intronic
1188203423 X:27321530-27321552 TCTCTGACAGCACTCCAGCAGGG - Intergenic
1190705020 X:53020407-53020429 TTCCTGAGAGCCACCCAGCATGG + Intergenic
1190984076 X:55484921-55484943 TCTCTGAGCCCCAGCCTGCAGGG - Exonic
1192806507 X:74514476-74514498 TCTCTGACACCACCTCAGCATGG - Intronic
1193080103 X:77398226-77398248 ACTCTGTCACCCACCCAGGCTGG - Intergenic
1193205899 X:78747122-78747144 GCTCTGACACCCACCTTCCAAGG - Intergenic
1193771353 X:85591771-85591793 TGTCTGACACCCACTCAGCCAGG + Intergenic
1194121476 X:89968739-89968761 TCTCTGAAAACCACACAACATGG - Intergenic
1194317384 X:92396811-92396833 CCTCTGTCACCCACCCAGGCTGG - Intronic
1194884136 X:99292045-99292067 TTGCTAACACCCACACAGCAGGG - Intergenic
1195694539 X:107657129-107657151 CTTCTGACACCACCCCAGCAAGG + Intergenic
1195821512 X:108950117-108950139 TCTCTGATAGCACCCCAGCAGGG + Intergenic
1195858433 X:109355670-109355692 ACTCTGCCACCAATCCAGCAGGG + Intergenic
1195919945 X:109973912-109973934 ACTCTGACACCTCTCCAGCAGGG + Intergenic
1198097775 X:133397521-133397543 ACTCTGTCACCCACCCTGGAGGG - Intronic
1200114603 X:153764662-153764684 TCTCTGCCTCCCCCACAGCACGG - Intronic
1200474333 Y:3626191-3626213 TCTCTGAAAACCACACAACATGG - Intergenic
1200625560 Y:5510118-5510140 CCTCTGTCACCCACCCAGGCTGG - Intronic