ID: 1156381346

View in Genome Browser
Species Human (GRCh38)
Location 18:36564195-36564217
Sequence GCACACAGCCTCTCCAAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 160}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156381346_1156381348 -3 Left 1156381346 18:36564195-36564217 CCTGTTTTGGAGAGGCTGTGTGC 0: 1
1: 0
2: 0
3: 14
4: 160
Right 1156381348 18:36564215-36564237 TGCTTCCACTGGTATTTCATTGG 0: 1
1: 0
2: 3
3: 13
4: 202

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156381346 Original CRISPR GCACACAGCCTCTCCAAAAC AGG (reversed) Intronic
901891361 1:12268723-12268745 TCATACAGCATCTCAAAAACGGG - Exonic
903471775 1:23592254-23592276 GCACCCAGCCTCCCCAAGCCTGG - Intronic
904439769 1:30522649-30522671 GCACACGGCATTTCCCAAACTGG + Intergenic
905145373 1:35883572-35883594 GCACACAGCCTCCTTCAAACTGG - Intronic
909704835 1:78569041-78569063 ACACACAGACACTCCCAAACTGG + Intergenic
920405727 1:205708437-205708459 CCACATAGCTTCTCCAAAGCAGG + Intergenic
920532617 1:206714931-206714953 GCACACATTCTCTCGAAACCTGG - Intronic
922151886 1:223013440-223013462 GCCCACATCCTTTCCAACACTGG - Intergenic
923135288 1:231111743-231111765 TCACACAGCATATCCAAAATAGG + Intergenic
924899764 1:248384843-248384865 CCACTCAGCCTCTTCTAAACCGG + Intergenic
1063552390 10:7045324-7045346 GCACACAACCTGTCCAGCACAGG + Intergenic
1064387470 10:14909717-14909739 GCACACAGGCTTTGCAAACCTGG - Intronic
1065540618 10:26762947-26762969 ACACACATCCTCACCAACACTGG + Intronic
1067961184 10:50852346-50852368 GCACACACCCCCTCCACAAAGGG + Intronic
1068197588 10:53737840-53737862 GGATACAGCCTCTCCAAGGCTGG - Intergenic
1070051914 10:72897741-72897763 TGACACAGCCTCTCCATGACTGG + Intronic
1070456951 10:76626821-76626843 GCACACAGCCTGGCCCAAAATGG - Intergenic
1071404687 10:85318599-85318621 GAACTGAGCCTCTCCAAGACAGG - Intergenic
1072035373 10:91558346-91558368 ACACACAGCATTTCCTAAACAGG - Intergenic
1072323494 10:94273739-94273761 GCACACTGCCTTTTCATAACTGG - Intronic
1072532629 10:96333624-96333646 TGACACAGCCTTTCGAAAACAGG + Intronic
1075033124 10:119040475-119040497 TAACACAGCCTATCCAAAACTGG - Intronic
1075562778 10:123480540-123480562 GCAAACACCCTCTCCAAACATGG + Intergenic
1076225801 10:128774219-128774241 GCAAACAGCATCTATAAAACAGG - Intergenic
1077523528 11:3050366-3050388 GCACACTCCCTAGCCAAAACTGG + Intronic
1083181471 11:60988621-60988643 AAACACAGCCTCTCCAGAGCAGG - Intronic
1083814936 11:65127449-65127471 GCACAGAGCCTTTTCTAAACTGG + Exonic
1084443872 11:69192182-69192204 GCACAAATCCTTTGCAAAACAGG + Intergenic
1085715426 11:78868726-78868748 GCACACTTCCCTTCCAAAACTGG + Intronic
1087755842 11:102053996-102054018 GCAATCAGGCTCTCCTAAACTGG - Intronic
1089399719 11:118157416-118157438 GCACACACCCTCTCCAGCTCGGG - Intergenic
1089771418 11:120805890-120805912 CCACACAGCCTCGCCAAAGTAGG - Intronic
1091410759 12:237677-237699 GCACACACACTCTCTAACACGGG + Intronic
1092989341 12:13880073-13880095 GCACACACACTCCCCAACACAGG + Intronic
1095965298 12:47863470-47863492 GAAGACAGCCTCTGCAAAGCAGG - Intronic
1099178580 12:79452330-79452352 TCACACAGCTTCTCCAGAATGGG + Intergenic
1102549078 12:113677960-113677982 GCCCATAGCTTCTGCAAAACAGG + Intergenic
1105413318 13:20189720-20189742 TTACACAACCTCACCAAAACAGG + Exonic
1107098986 13:36568106-36568128 GCACACAAGCTGTGCAAAACTGG + Intergenic
1113568824 13:111339085-111339107 ACTCCCAGCCTCTCCAAGACGGG - Intronic
1119909758 14:78338886-78338908 TCACACAACCTCTCAGAAACTGG - Intronic
1121021278 14:90581610-90581632 GCCCACAGCATCTCCAGGACTGG - Intronic
1122696092 14:103553027-103553049 GCACACTGCCTCTCCATCTCTGG - Intergenic
1122863292 14:104592028-104592050 GCACACAGACTCTGCAGAATGGG + Intronic
1124252763 15:28117723-28117745 CCACTCAGCCTCCCCAACACAGG + Intronic
1124937681 15:34187684-34187706 CCACATAGCCTCTCCTAAAATGG + Intronic
1124961821 15:34403898-34403920 GGGCACAGGTTCTCCAAAACAGG - Intronic
1124978446 15:34550119-34550141 GGGCACAGGTTCTCCAAAACAGG - Intronic
1126724628 15:51619836-51619858 CCACACACCCTCTCCAGAGCAGG + Intronic
1129029715 15:72609423-72609445 CCACACAGCAGCTCCAGAACTGG + Intergenic
1130051575 15:80487908-80487930 GGACACAGCCTCCCCAGCACAGG + Intronic
1130266162 15:82405745-82405767 GGGCACAGGTTCTCCAAAACAGG + Intergenic
1130505849 15:84541130-84541152 GGGCACAGGTTCTCCAAAACAGG - Intergenic
1130569402 15:85027168-85027190 GCACACTGACTCTCCAAGTCTGG - Intronic
1131058039 15:89387737-89387759 GCACCCGGCCTCTCCAGCACTGG - Intergenic
1132604980 16:789872-789894 GGACACAGCCTCCCCACAGCAGG + Intronic
1135399919 16:22159580-22159602 GCACAGAGCCTGGCCAAAGCAGG - Intergenic
1136411643 16:30081116-30081138 GCGTACAGTCTCCCCAAAACAGG - Intronic
1138948806 16:61885482-61885504 GCTGACAGCCTCCCCAAAAAAGG + Intronic
1139651521 16:68364698-68364720 GCCCACAGCCTCCCCAGAGCTGG + Intronic
1140533745 16:75690212-75690234 CCACATAGCCTCTCCTAAAATGG - Intronic
1140959337 16:79897156-79897178 GCACACACCCTCTCCCAACAGGG + Intergenic
1142670772 17:1486446-1486468 GCCCACAGCCTCTCCCCACCCGG + Intronic
1143102404 17:4511694-4511716 TCACACAGCCTCTTCATTACGGG + Intronic
1145256559 17:21327077-21327099 ACACGCGGCCTCTCCAAAAAGGG - Intergenic
1145320049 17:21760876-21760898 ACACGCGGCCTCTCCAAAAAGGG + Intergenic
1146464337 17:33074373-33074395 GCACACAGCACCTCCAAAAAAGG - Intronic
1147161896 17:38573217-38573239 GCCCACAGCCTCTCCCCACCGGG + Intronic
1148877510 17:50699362-50699384 GCAAACAGCCTCTGCAACAGGGG - Intronic
1151666164 17:75546295-75546317 GCAAGCTGCCTCTCCAAAAATGG - Intronic
1152393594 17:80017720-80017742 GCTCACAGGCTGTACAAAACAGG + Intronic
1152600851 17:81261381-81261403 GCACACAGGCTCTGCCCAACCGG - Intronic
1153844968 18:9041446-9041468 GCACCCAGCCCCTCTATAACTGG - Intergenic
1154448804 18:14458673-14458695 GCGCACAGCCGCTGCAAACCCGG + Intergenic
1156381346 18:36564195-36564217 GCACACAGCCTCTCCAAAACAGG - Intronic
1157281454 18:46348766-46348788 GCACACCGACTCTCCAAGACTGG - Intronic
1158917620 18:62151278-62151300 TCACACTGCCTCTCTAAAAGTGG + Intronic
1161410692 19:4115562-4115584 GCAGGCAGCCTCTTCCAAACCGG - Intronic
1167271349 19:48508309-48508331 GAACACACCCTTTCCAAAACAGG + Intronic
925129381 2:1483571-1483593 GCAAACAGCCTCTCCACCTCAGG - Intronic
925989288 2:9240862-9240884 GAACACAGGCTCTGCAATACTGG + Intronic
929149818 2:38737486-38737508 CCAAACAGCCTCTTGAAAACTGG - Intronic
930242675 2:48952755-48952777 TCACACATTCTTTCCAAAACAGG + Intergenic
933900025 2:86842951-86842973 GCATCCAGCCTCCCCAAAACTGG + Intronic
935378497 2:102424510-102424532 GTATACAGCTTCTCAAAAACTGG + Intronic
935780533 2:106506274-106506296 GCATCCAGCCTCCCCAAAACTGG - Intergenic
937307163 2:120879342-120879364 GCACACAGCCCCTCCAGACCTGG - Intronic
937505620 2:122533512-122533534 CCACAGAGCCTCTGCAAACCTGG + Intergenic
940825519 2:158407453-158407475 ATACATAGCTTCTCCAAAACTGG + Intronic
945138000 2:206650465-206650487 GCTCATAGCCTGTTCAAAACAGG + Intergenic
946230339 2:218287339-218287361 GCACACACCCTCTCCCAAGGAGG + Intronic
947877715 2:233478888-233478910 GTACACAGCCTCTCCTAGATGGG - Intronic
949023307 2:241753303-241753325 GCCCAGAGCCTCGCCAACACCGG - Intronic
949023316 2:241753354-241753376 GCCCAGAGCCTCGCCAACACCGG - Intronic
949023336 2:241753466-241753488 GCCCAGAGCCTCGCCAACACCGG - Intronic
949064311 2:241980283-241980305 GCACACAGCAGCTGCAATACAGG - Intergenic
1170948159 20:20910398-20910420 GCAAACTGCCCCTCCAAATCAGG - Intergenic
1172532585 20:35643354-35643376 GCAAACAGGCTCTCAAAAGCAGG + Intronic
1174655038 20:52164479-52164501 GCTCACATCCTCTCCAGAGCTGG + Intronic
1175279100 20:57790944-57790966 ACACCCAGGCTCTCCCAAACAGG - Intergenic
1178703128 21:34851023-34851045 TGACTGAGCCTCTCCAAAACGGG - Intronic
1179444632 21:41422685-41422707 GCACACATCCTCTGCAATTCAGG + Intronic
1179450974 21:41468182-41468204 ACACACACCCTCTGAAAAACCGG - Intronic
1179517386 21:41918026-41918048 GCACACAGATTCTCCAAGAGAGG + Intronic
1182656849 22:31897530-31897552 GCAAAAGGCCCCTCCAAAACTGG - Exonic
1185184374 22:49388730-49388752 GCAAAAACCCTCGCCAAAACAGG - Intergenic
1185288714 22:50013718-50013740 GCCCACAGCCTCTCCCAGCCTGG - Intergenic
952057218 3:29462286-29462308 GAAGACAGCCTCTCCTAAAAGGG - Intronic
953252883 3:41262381-41262403 GCACGCTGCATCTCCAAATCTGG - Intronic
954676213 3:52316877-52316899 GCCCACAGCCTTCTCAAAACTGG - Intronic
956468419 3:69541687-69541709 GCACACTGCCTCTCCAACATAGG + Intronic
963878768 3:150504474-150504496 GTACACTGCCTCTCAAAAAATGG + Intergenic
967403907 3:189095216-189095238 GCAGGCAGCCTCTCCTAGACTGG - Intronic
976749819 4:88442859-88442881 GCTCACAGCCAATCCAAGACTGG - Exonic
978383295 4:108153272-108153294 GCACCCTGCCTCTGCAAAAGAGG + Intronic
979613191 4:122711399-122711421 ACACACAGGCTTTCCACAACTGG + Intergenic
982413646 4:155107802-155107824 GCACACAGTCTCTACACGACTGG + Intergenic
984565215 4:181321862-181321884 GCACACTGTCTTTCCATAACAGG + Intergenic
985490989 5:179390-179412 GCACACACCCTCTGGAAGACAGG + Intronic
988054735 5:26079977-26079999 GTAAACTGCCTCTCCAAAATAGG - Intergenic
988989662 5:36658006-36658028 GCACATTGCCTGCCCAAAACAGG - Intronic
991460076 5:66849003-66849025 GGTCAGAGCCTCTGCAAAACAGG + Intronic
994494670 5:100496267-100496289 GCACACAGCCTACCCCAAAAGGG - Intergenic
999403506 5:151285844-151285866 ACAGACAGCCTCTACAAAGCTGG + Intronic
1004325756 6:14672736-14672758 GAAGACACCCTCTCCAAACCAGG + Intergenic
1006575394 6:35041594-35041616 GAACACAGCCTTTTCAAAACAGG - Intronic
1006726833 6:36205234-36205256 GCACACAGCCTGTCCAATTGTGG + Intronic
1007262252 6:40571962-40571984 GAGCACAGGGTCTCCAAAACAGG + Intronic
1011554036 6:88556431-88556453 GCACCCAGCATCTCCAAAGCTGG + Intergenic
1011571304 6:88738862-88738884 ACACACACCCCTTCCAAAACAGG + Intronic
1013488564 6:110621316-110621338 GCCCACAGCCCCTCCACAGCAGG - Exonic
1013623990 6:111919126-111919148 GCACGCAGCCTGTGCCAAACAGG - Intergenic
1017236293 6:152120369-152120391 GCTCACAGCCTCTCCAGAAGCGG + Intronic
1017499377 6:155009487-155009509 GAACACAGTCTCTCCAAATGCGG - Intronic
1018122290 6:160647143-160647165 GTCCACAGCCACTCCAGAACTGG + Intronic
1018284104 6:162218480-162218502 GCACAGAGGCACTCCAGAACAGG - Intronic
1018695328 6:166386456-166386478 GCGCACAGCCTGTCCACAAAGGG + Intergenic
1019117453 6:169776689-169776711 CCACAGTGCCCCTCCAAAACAGG - Intronic
1019167758 6:170110301-170110323 GCCCACAGCCTCTTCAGGACGGG + Intergenic
1019273771 7:165129-165151 GGACACCGCCTCTCCAAACCTGG + Intergenic
1021781910 7:24114570-24114592 GAACCCAGCCTCTCCAAACTTGG + Intergenic
1022900969 7:34810577-34810599 GCACATAGGCTCCCTAAAACCGG + Intronic
1023426968 7:40047379-40047401 GCACCTAGCCCCTCTAAAACTGG + Intronic
1026988674 7:74570835-74570857 CCCCACAGCCCCTCCAAAACCGG - Intronic
1027757295 7:82230177-82230199 CACCACAGCCTCCCCAAAACAGG + Intronic
1028747663 7:94346363-94346385 GCACACAGTATCCCCAACACAGG + Intergenic
1033434039 7:141316124-141316146 GCACACAGCAGCTGCTAAACGGG + Intronic
1033495005 7:141885257-141885279 GAACAAAGCCCCTCCAAATCAGG - Intergenic
1040388408 8:46930012-46930034 GCACATAGACTCTCCCACACAGG - Intergenic
1041360340 8:57046352-57046374 GCACAGTGCCTTTCCAATACAGG - Intergenic
1043516095 8:80996378-80996400 GCACAGATCTTCTCCAAAATGGG - Intronic
1045116469 8:98988292-98988314 GCCCACAGCCTCTTCAACAAAGG - Intergenic
1050012692 9:1201130-1201152 ACACACAGGCTCTCCAACCCTGG - Intergenic
1055034476 9:71803531-71803553 TCAGATTGCCTCTCCAAAACTGG + Intronic
1056382174 9:86065275-86065297 GAACACAGCCTCCCCACCACTGG + Intronic
1058136125 9:101309492-101309514 ACACACATCCTATCAAAAACTGG - Intronic
1059161439 9:112039012-112039034 GCATACAGCATTTACAAAACTGG + Intergenic
1060182840 9:121545980-121546002 TCAGGCAGCCTCTCCAAAGCAGG + Intergenic
1060999526 9:127895303-127895325 GCACACGGCCTCTCCAGTAAGGG + Intronic
1061271593 9:129546860-129546882 GCTCCCAGCCTCTCCATAGCAGG + Intergenic
1061324200 9:129852890-129852912 GCACAGAGCCTCTCCAAGGCAGG + Intronic
1187063402 X:15809690-15809712 GCACACACTGTCCCCAAAACAGG + Intronic
1189945036 X:46169242-46169264 GCACACAGTGTCACCAACACAGG - Intergenic
1193239611 X:79152137-79152159 ACACAGAGGCTCTCCTAAACAGG + Intergenic
1193511979 X:82413510-82413532 GAACACAGCATGTCCAAAAATGG - Intergenic
1194326907 X:92530351-92530373 GCATACACCCCCACCAAAACAGG + Intronic
1196208427 X:112967694-112967716 ACACACATTCTCACCAAAACAGG - Intergenic
1197318148 X:124993856-124993878 ACACACAGCATCTCCATTACTGG + Intergenic
1197444511 X:126533763-126533785 GCTCAGAGCCACTCCAATACAGG - Intergenic
1198277830 X:135112997-135113019 GACCAGAGCCTCTCCAAAAGAGG + Intergenic
1200635626 Y:5649560-5649582 GCATACACCCCCACCAAAACAGG + Intronic
1201862544 Y:18615221-18615243 TCACACAGCCCCTAAAAAACTGG - Intergenic
1201870779 Y:18705159-18705181 TCACACAGCCCCTAAAAAACTGG + Intergenic
1202364112 Y:24143486-24143508 GGGCACAGGTTCTCCAAAACAGG + Intergenic
1202506668 Y:25526636-25526658 GGGCACAGGTTCTCCAAAACAGG - Intergenic