ID: 1156381437

View in Genome Browser
Species Human (GRCh38)
Location 18:36565056-36565078
Sequence CAGTTGCCCTTGGGGAAAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 262
Summary {0: 1, 1: 0, 2: 4, 3: 37, 4: 220}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156381432_1156381437 23 Left 1156381432 18:36565010-36565032 CCTTAATTTTCATGCTGTAATAG 0: 1
1: 0
2: 2
3: 14
4: 225
Right 1156381437 18:36565056-36565078 CAGTTGCCCTTGGGGAAAACTGG 0: 1
1: 0
2: 4
3: 37
4: 220

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156381437 Original CRISPR CAGTTGCCCTTGGGGAAAAC TGG Intronic
900337815 1:2173402-2173424 CTGCTGTCCTTGGGCAAAACGGG + Intronic
900833363 1:4980736-4980758 CAGTTTCCCTTGGGTAAGGCAGG + Intergenic
901936383 1:12629931-12629953 CACTTAGCCTTGGGGAAACCTGG - Intergenic
902052767 1:13577262-13577284 CAGTTTCCCTGGGTGGAAACTGG - Intergenic
902244901 1:15114468-15114490 CAGCTGCCCCTGGGGAAGATAGG + Exonic
903327567 1:22579788-22579810 CAGATACCCTTAGTGAAAACTGG + Intronic
904300654 1:29551309-29551331 CAGTGGCCTTTGGGGACAGCTGG - Intergenic
905000914 1:34668803-34668825 CAGTTACCACTGGGGGAAACTGG - Intergenic
907564706 1:55424050-55424072 CGGTTGGCTTTGGGGAAAAGGGG - Intergenic
910030524 1:82716284-82716306 CAGTTGGCTTTGGGGAAAAGGGG - Intergenic
910210358 1:84786015-84786037 CAGTGACCCTTGTGGAAAATGGG + Intergenic
912252466 1:108025769-108025791 AAGTTGCCCCTAGGGAAAGCTGG - Intergenic
913611446 1:120513389-120513411 CAATTGCCCTGGGGGAAAAAAGG - Intergenic
913983347 1:143543433-143543455 CAATTGCCCTGGGGGAAAAAAGG + Intergenic
914579746 1:149008850-149008872 CAATTGCCCTGGGGGAAAAAAGG + Intronic
916954111 1:169813833-169813855 CAGTAGCCCTTAGATAAAACTGG + Intronic
917577390 1:176338248-176338270 CCCTTGCCATGGGGGAAAACTGG + Intergenic
917922967 1:179766211-179766233 TAGTTGGCTTTGGGGAAAAGGGG - Intronic
920382191 1:205541638-205541660 GAGGTGCCCTTGGGGAAAATGGG - Intergenic
920943011 1:210501636-210501658 CAGCTGCTCCTGGGGAAAAATGG + Intronic
922557328 1:226542331-226542353 CAATTGCCAAGGGGGAAAACTGG + Intergenic
922732146 1:227954256-227954278 CGGTTACCATTGGGGAAAACCGG - Intergenic
1063008779 10:2002136-2002158 TAGTCGCCCCTGGGTAAAACTGG + Intergenic
1063103255 10:2969990-2970012 CAGTGGCTCTTGAGGAAAACAGG + Intergenic
1065718801 10:28604412-28604434 CTGTAGCCCTTGTAGAAAACAGG - Intronic
1067070285 10:43126101-43126123 CAGGGGTCCTTGGGGAAAGCTGG + Intronic
1067108360 10:43380818-43380840 AAGTTGCCACTGGGGGAAACTGG - Intergenic
1067559333 10:47293971-47293993 CACTTGCCATGGTGGAAAACCGG + Intergenic
1067762015 10:49055545-49055567 CAGCTGACCTTGGGGAGAAGGGG - Intronic
1069911788 10:71764580-71764602 CAGTTGCCCTGTGGGAAAGCTGG - Intronic
1070210121 10:74308938-74308960 CAATTGCCCTTAGGTAGAACTGG + Intronic
1071820160 10:89271722-89271744 CACTTGCCCTTGGCAAACACTGG - Intronic
1072696092 10:97603939-97603961 ATGTTGCCATTGGGGAAAACTGG - Intronic
1073980890 10:109152310-109152332 ATGTTACCATTGGGGAAAACTGG - Intergenic
1079755261 11:24251326-24251348 TAGTTGCCATTGAGGCAAACAGG + Intergenic
1081606106 11:44528063-44528085 CCTTTGCCTTTGGGGGAAACTGG - Intergenic
1081751620 11:45515254-45515276 CAGTTTGGCTTTGGGAAAACAGG + Intergenic
1082214011 11:49545019-49545041 CATTTCCACTAGGGGAAAACAGG + Intergenic
1083668185 11:64286337-64286359 CCCTTGCCCTTGGGGAACACAGG - Intronic
1083898174 11:65630699-65630721 CAGCTTCCCTTGGACAAAACAGG - Intronic
1085397292 11:76213090-76213112 CAGTGGCCCTTGAGGAGGACTGG - Intergenic
1085722493 11:78924889-78924911 CAGTTGCCCTCTCGGAAATCTGG + Intronic
1086635592 11:89079472-89079494 CATTTCCACTAGGGGAAAACAGG - Intergenic
1088221271 11:107572185-107572207 CAGTTGCCACAGGGGACAACTGG - Intergenic
1088327906 11:108619777-108619799 CATTTCCCCTTGGGGAGAAGAGG - Intergenic
1088632230 11:111784788-111784810 CAGTTACCCTTAGGGAAATAAGG + Intronic
1089571283 11:119412213-119412235 ATGTTGCCATTGGGGGAAACTGG - Intergenic
1089670970 11:120056778-120056800 CAGATGCCCATGGGGTCAACAGG + Intergenic
1089979707 11:122762192-122762214 CTGTTGTCCTTGGGTAAGACAGG + Intronic
1090121689 11:124036151-124036173 CTGTTACCATTGGGGGAAACTGG + Intergenic
1091032659 11:132204873-132204895 CAGTGGCCCTTGGGAAAAGATGG + Intronic
1093030358 12:14282977-14282999 CAGTTCCCTTTGGGAAAAAAGGG - Intergenic
1093444044 12:19234002-19234024 CAGTGACATTTGGGGAAAACTGG + Intronic
1093540507 12:20277808-20277830 CACTTGCCTTTGGGGATAAAGGG - Intergenic
1094677884 12:32638824-32638846 CAGATGCCCTTGGGGGCAAGGGG + Intronic
1095262990 12:40119399-40119421 CTGTTGCCATTGGGGATTACTGG - Intergenic
1098239887 12:68456218-68456240 CAGGAGCCCGTGGGGAAGACTGG - Intergenic
1099684565 12:85868172-85868194 AAGTTGTCCTTGAGGAAAACTGG - Intergenic
1099799748 12:87442443-87442465 CAGCTGGCTTTGGGGAAAAGGGG + Intergenic
1102223984 12:111215098-111215120 CAGTTGGCTTTGGGGAGATCTGG - Intronic
1102261965 12:111448327-111448349 CAGCTGCCCTTGAGGAGCACAGG + Exonic
1102615494 12:114150552-114150574 CAGATGCCTTTGGGGAGAATGGG - Intergenic
1102757726 12:115356809-115356831 CAGTTGCCCTCGGGCAAAGAGGG + Intergenic
1102968700 12:117148859-117148881 CAGTTTCCTTCGGGGAAAAGTGG - Intronic
1103288174 12:119820575-119820597 GAGTTAACGTTGGGGAAAACTGG + Intronic
1103363148 12:120365869-120365891 CAGCTGCCCCTGGGAAAAGCGGG - Intronic
1103773925 12:123351265-123351287 CACTTGCTCTTGTGGGAAACAGG + Intronic
1105344141 13:19558642-19558664 CAGTAGCCCTTCTGAAAAACAGG + Intergenic
1105535892 13:21262941-21262963 CAGTAGCCCTTCTGAAAAACAGG - Intergenic
1107965108 13:45590569-45590591 CAGCAGCCCTTGGAGAACACAGG - Intronic
1108750342 13:53441460-53441482 CAGTATACTTTGGGGAAAACTGG + Intergenic
1111044474 13:82796704-82796726 CAGTGGTCATTGGGGAAAAGAGG - Intergenic
1112065971 13:95793448-95793470 CATTTTCCCTTGGGGACTACAGG + Exonic
1112106388 13:96244846-96244868 AAATTTCCCTTGAGGAAAACTGG - Intronic
1112299397 13:98216509-98216531 CAGTTTCCTTTGGGGATGACTGG + Intronic
1115444893 14:33478660-33478682 AAGTTGCGTTTGGGCAAAACAGG + Intronic
1115643183 14:35348568-35348590 CAGTTGCCTGTGGGGAGAACTGG - Intergenic
1117049886 14:51849270-51849292 CATTTGCTCTGGGGGAAACCAGG - Intronic
1117735881 14:58767888-58767910 GAGTTCTCCTTGGGGCAAACAGG + Intergenic
1118596914 14:67442816-67442838 CATGTGACCTTAGGGAAAACAGG + Intergenic
1118901088 14:69986529-69986551 CCGTTACCATTGGGGGAAACTGG + Intronic
1119170870 14:72535457-72535479 ATGTTGCCATTGGGGCAAACTGG - Intronic
1120865763 14:89294081-89294103 CAGGAGCCCTTGGGAAGAACGGG - Intronic
1120965366 14:90162486-90162508 ATGTTGCCATTGAGGAAAACTGG + Intronic
1121003987 14:90475752-90475774 TAGAAGCCCTTTGGGAAAACTGG + Intergenic
1122018979 14:98820762-98820784 CTGATGCTCTTGGGGAAAATGGG - Intergenic
1123010535 14:105347535-105347557 CACTTTCCCTTGGGGAAGTCTGG - Intronic
1126022373 15:44414982-44415004 CAGTAGCCCTTCTGAAAAACAGG - Exonic
1129974252 15:79808193-79808215 CAGTTGGCTGTGGGCAAAACTGG - Intergenic
1130331391 15:82925039-82925061 CAGCTGATCTTGGGGTAAACAGG + Intronic
1130658752 15:85813115-85813137 CTATTACCCTTGGAGAAAACTGG + Intergenic
1131993711 15:98114427-98114449 TAGATGCCCCTGGGGAAACCAGG + Intergenic
1132293222 15:100717644-100717666 GAGTTGTCCATGGGGAAACCAGG + Intergenic
1133091128 16:3404450-3404472 AAGGTGCTCTTGGAGAAAACTGG + Exonic
1134182382 16:12058451-12058473 CAGTAGCCCTTGGGGCCCACTGG + Intronic
1136390819 16:29963132-29963154 CAGTTGCCCATGGGGAGCAGAGG - Exonic
1138012499 16:53396147-53396169 CAGAGGCCCTTGGCAAAAACTGG + Intergenic
1139070872 16:63381025-63381047 CTGTTGCCATTGGTGAAAAGTGG + Intergenic
1139211056 16:65076965-65076987 CAGTTGCCCCTGAGAAAAATGGG - Intronic
1143037214 17:4006275-4006297 CAAGTGCCCTTGGGGACAGCCGG - Exonic
1146516434 17:33493384-33493406 GGGATGCCCTTGGGGGAAACTGG - Intronic
1148526990 17:48348526-48348548 AAGTTGACATTGGGGGAAACTGG - Intronic
1148534959 17:48430975-48430997 ATGTTACCCTTGGGGGAAACTGG + Intergenic
1150189800 17:63226335-63226357 CGGTTGCCCTTAGGAGAAACCGG + Intronic
1150535637 17:66036665-66036687 CAGTTGCCCTACTGGTAAACTGG + Intronic
1152400438 17:80063361-80063383 CACTTGCCTTTGTGAAAAACTGG + Intronic
1152510694 17:80785573-80785595 CGGTTGCCATTAGTGAAAACTGG + Intronic
1156381437 18:36565056-36565078 CAGTTGCCCTTGGGGAAAACTGG + Intronic
1157859650 18:51129375-51129397 CAGTTGCCCTTGGGGAAGGGTGG + Intergenic
1158914674 18:62111151-62111173 CATGTGTCCTTGTGGAAAACAGG + Intronic
1160626474 18:80211311-80211333 TAGTTACCATTGGGGCAAACAGG + Intronic
1161029083 19:2049762-2049784 CTGCTGCCCTAGGGGAAAACTGG + Intronic
1161075489 19:2283184-2283206 CCGTTTCCCTTAGGGAAAATGGG + Intronic
1161428980 19:4219860-4219882 CAGTTTCCCTTCTGGAAAATGGG - Intronic
1163168607 19:15515089-15515111 CAGCTGCCTTTGGGGAAGAAGGG - Intronic
1163527956 19:17832701-17832723 AAGTTGCCCTGGGGGATAGCGGG + Exonic
1163885289 19:19959895-19959917 CGGTTGCCATGGGGGAGAACTGG - Intergenic
1163889083 19:19994949-19994971 CAGTTGCCAAGGGGGAAAACTGG + Intergenic
1165896900 19:39146983-39147005 GTGTTACCATTGGGGAAAACTGG - Intronic
1166308921 19:41951626-41951648 CAGTCTCCCCTGGGGAATACTGG + Intergenic
1167357217 19:49011323-49011345 CAGGGGCCTCTGGGGAAAACAGG + Intronic
927560016 2:24063733-24063755 CAGGTGCCCTTGGGAAAGAGTGG + Intergenic
927690644 2:25205661-25205683 ATGTTACCATTGGGGAAAACTGG - Intergenic
930157003 2:48116102-48116124 CAGTAGCCCTTGGCCAAACCAGG - Intergenic
930308896 2:49713201-49713223 CAGTTGTCCTTGAATAAAACAGG + Intergenic
933976269 2:87514630-87514652 CAGGTGCCCTCGGGGAAATGTGG - Intergenic
935260060 2:101346838-101346860 GATGTGCCATTGGGGAAAACTGG - Exonic
936317553 2:111436176-111436198 CAGGTGCCCTCGGGGAAATGTGG + Intergenic
936792270 2:116164381-116164403 CAGAGGCCCTGGGGAAAAACTGG + Intergenic
938048806 2:128148505-128148527 CAGAGACCCTTGGGGAAAACTGG - Intronic
938215946 2:129515263-129515285 CAGTTACCCTTAAGGCAAACTGG - Intergenic
939846092 2:147247587-147247609 CAGTTCCCTCTGTGGAAAACTGG - Intergenic
941036403 2:160573744-160573766 ATGTTACCATTGGGGAAAACTGG + Intergenic
941092742 2:161197080-161197102 CAGTTACCCTTGAGGAAAAATGG + Intronic
942189512 2:173456353-173456375 CCGTAGCCCTTGGGGAAGACTGG + Intergenic
942660497 2:178259199-178259221 CAGGTACACTTGGGGAAAATAGG - Intronic
944341330 2:198604430-198604452 TAGTTGCCCTTGGGGAGGAGTGG + Intergenic
944780168 2:203009492-203009514 CAGTTTCCCTTGGGCAGATCTGG - Intronic
945402428 2:209401488-209401510 CCATTGGCCTTGGGGAAAACTGG + Intergenic
948260919 2:236603952-236603974 CAGATGACCTTGGAGAAAGCAGG + Intergenic
948298533 2:236884422-236884444 GAGTTCACATTGGGGAAAACTGG - Intergenic
1170581476 20:17702672-17702694 CATTTAACCCTGGGGAAAACTGG + Intronic
1171254087 20:23673202-23673224 CAGTTGCACTTGGGGAAAGCTGG + Intergenic
1171260588 20:23728469-23728491 CAGTTGCACTTGGGGAAAGCTGG + Intergenic
1171269705 20:23804314-23804336 CAGTTGCACTTGGGGAAAGCTGG + Intergenic
1173730787 20:45327048-45327070 CAGTTGCCCTGGCAGAAAAATGG - Exonic
1175472847 20:59244938-59244960 CAATTGCTCTTTGGGAAATCAGG - Intronic
1175567672 20:59993808-59993830 GTGTTGCCCCTGGGGAAAACTGG - Intronic
1176375171 21:6083418-6083440 CAGTGGCCCTTGTGGAAAGGGGG + Intergenic
1176905317 21:14493373-14493395 CTATTGTCCTTGGGGAAAATGGG - Intronic
1177166632 21:17612163-17612185 CCCTTGAACTTGGGGAAAACCGG - Intronic
1177329963 21:19645899-19645921 CAGTAGCCCATGGTGAAACCTGG - Intergenic
1179214006 21:39350228-39350250 CGGTTGCCTCTGGGGAAAAGTGG + Intergenic
1179748303 21:43454826-43454848 CAGTGGCCCTTGTGGAAAGGGGG - Intergenic
1180151684 21:45951429-45951451 TAGGTGCCCATGGGGAAGACAGG - Intergenic
1184108025 22:42379689-42379711 CACATGCCCTTGGGGACAGCAGG + Intergenic
1184285068 22:43465875-43465897 CAGTAGCCCCTGGGGAAGCCGGG + Intronic
1184452463 22:44591256-44591278 TAGTTGACCTTGGGGAGATCTGG - Intergenic
1184624330 22:45711600-45711622 ATGTTACCATTGGGGAAAACTGG + Intronic
1184701303 22:46175211-46175233 ATGTTACCCTTGGGGAAAACTGG - Intronic
949347691 3:3091847-3091869 ATGTTACCCTTGAGGAAAACTGG + Intronic
949469975 3:4384334-4384356 ATGTTGCCATTGGGGAAAACTGG - Intronic
950413089 3:12851729-12851751 CTGTTACCATTGGGGGAAACTGG + Intronic
953227179 3:41031341-41031363 CACTTGCCCTTGTGGAAAGTGGG + Intergenic
955865387 3:63377035-63377057 CAGTTGTACTTGGGAAAAACGGG - Intronic
956412607 3:68994383-68994405 CAGTTACCCTTGGGGGAACAGGG + Intronic
958845957 3:99264151-99264173 CAGTTGCCCATGGAGGAATCAGG + Intergenic
961621889 3:128230894-128230916 CAGTTTCCCTTGGAGATCACTGG + Intronic
965297988 3:166975062-166975084 CATTTTTCATTGGGGAAAACTGG - Intergenic
968545809 4:1197409-1197431 AGGTAGCCCTTGGGTAAAACAGG + Intronic
969057715 4:4412548-4412570 CAGCTGCCCTTGGCCAAAGCTGG + Intronic
970822714 4:20237648-20237670 AAGTAACCATTGGGGAAAACTGG - Intergenic
970822922 4:20240145-20240167 AAGTAACCATTGGGGAAAACTGG - Intergenic
970993124 4:22236007-22236029 CAGAAGCCCTGGGGGAGAACTGG - Intergenic
975585261 4:75941971-75941993 CAGTTGTCTGTGGGTAAAACAGG + Intronic
976160760 4:82196152-82196174 CTGTTTCCCTTAGGGAAAGCAGG - Intergenic
983584961 4:169344603-169344625 ATGTTACCATTGGGGAAAACTGG - Intergenic
983802385 4:171949143-171949165 CTGATGGCCTTGGGGAAAGCAGG + Intronic
983928566 4:173429156-173429178 CAGCTGTCCCTGGGGAAATCAGG - Intergenic
984656718 4:182326451-182326473 CAGTTGCCACAGTGGAAAACAGG + Intronic
984965791 4:185138647-185138669 AGGTTGCCCGTGGGCAAAACTGG + Intergenic
986234910 5:5899697-5899719 CAGGTGCATTTGGGGAAAATTGG - Intergenic
986293174 5:6416622-6416644 CCCTTGACCTTGGGGAAAAGAGG + Intergenic
988860772 5:35275793-35275815 CAGTTGCCCTTGGGTAAAAGGGG - Intergenic
990109575 5:52306621-52306643 CACTTGCCAGTGGGGAAAATAGG + Intergenic
993244848 5:85437731-85437753 CAATTACCCTTTGGTAAAACTGG - Intergenic
997239505 5:132295998-132296020 CAGATGCCCATGGGGCACACTGG + Intronic
1001251928 5:170153224-170153246 GAAGGGCCCTTGGGGAAAACTGG + Intergenic
1002045428 5:176538875-176538897 CAATTGTCCTTAGGGAGAACTGG + Intergenic
1004855671 6:19746950-19746972 TAGCTACCCTTGGGGAATACTGG - Intergenic
1006139463 6:31919549-31919571 GAGTTGCCTCTGGGGAGAACTGG - Intronic
1006673170 6:35742737-35742759 CAGCTGCCCATGGGGAAGGCAGG - Intronic
1006976322 6:38105688-38105710 ATGTTACCCTTGGGGAAAACTGG + Intronic
1007101626 6:39251650-39251672 CTGTTGCCCTGGGGGAGAAGGGG + Intergenic
1009582089 6:65549301-65549323 CAAATGCCCATGGGGAGAACTGG + Intronic
1009819412 6:68780770-68780792 TAGTTACCATTGGGGGAAACTGG - Intronic
1010665902 6:78629591-78629613 CAGCTGCCCTGTGGGAAAAGCGG - Intergenic
1013610749 6:111792854-111792876 CAGTTACCCTTGATGGAAACTGG + Intronic
1014202673 6:118622950-118622972 CTGTTTCGCTTGGGGAATACTGG - Intronic
1014964090 6:127724969-127724991 CATTTGCCCTTGGGGAGAAGGGG - Intronic
1016690191 6:146929127-146929149 AAGGTGCCCTTGGGAAAAAAGGG + Intergenic
1017167754 6:151425711-151425733 CAGGTGCCCTTTGGCAAGACAGG + Intronic
1023556615 7:41430022-41430044 CAGTTCCCCCCAGGGAAAACAGG - Intergenic
1023725886 7:43142338-43142360 AAGCTGCCCTAGGGGAACACTGG - Intronic
1023963256 7:44945446-44945468 ATGTTACCCTTGGGGGAAACTGG + Intergenic
1026365020 7:69639640-69639662 TAGGTGCCCTTGGGCACAACAGG - Intronic
1027343299 7:77232754-77232776 CAGCTGCCCATGGGGAAGAAGGG + Intronic
1028669959 7:93390487-93390509 ATGTTGCCATTGGGGAAAACTGG + Intergenic
1029181412 7:98704487-98704509 CAGTTGCCCATGGGGGAGCCTGG + Intergenic
1030937698 7:115606121-115606143 CAGGTGCTCATGGGAAAAACTGG - Intergenic
1034627492 7:152504618-152504640 CCTATGGCCTTGGGGAAAACTGG + Intergenic
1034711440 7:153194898-153194920 ATGTTACCCTTGGGGGAAACTGG + Intergenic
1035189266 7:157151722-157151744 CATTTGCCCTTGGAGAGAAGAGG + Intronic
1037118252 8:15251941-15251963 CAGTTAGACTTGGGGAAAAATGG - Intergenic
1038560627 8:28576087-28576109 TAGTAACCATTGGGGAAAACTGG + Intergenic
1038756232 8:30343301-30343323 ACGTTCCCCTTGGGGGAAACTGG - Intergenic
1041025949 8:53687125-53687147 GTGTTATCCTTGGGGAAAACTGG + Intergenic
1041103428 8:54418949-54418971 GAGTTGCCCTTGTGAAAATCAGG - Intergenic
1041642840 8:60220890-60220912 CAGTTGCCCTCAGTGAAAATAGG - Intronic
1041656451 8:60355577-60355599 CAGAAACCCTTGGTGAAAACTGG + Intergenic
1043493081 8:80769341-80769363 CAGTTACCATTGGGAGAAACTGG - Intronic
1043504838 8:80892251-80892273 ATGTTACCGTTGGGGAAAACTGG + Intergenic
1043656462 8:82674096-82674118 CAGAGGCCCGTGGGGATAACAGG - Intergenic
1044985984 8:97756830-97756852 CATTTCCCCATGGGGAAAACAGG - Intergenic
1045391614 8:101720885-101720907 TAGGTGCCCTTAGGGAAAAGGGG - Intronic
1048159330 8:131999274-131999296 CAGTTGCATTTGGGGAAAAAAGG - Intronic
1048321149 8:133401128-133401150 CAGTTTCCCTGGAGGAAAAATGG - Intergenic
1049465173 8:142747955-142747977 CAGATGGCCTTGGGGAAGTCAGG + Intergenic
1049734781 8:144199214-144199236 CAGATGCCCATGGGCAAAGCTGG - Intronic
1049933448 9:477900-477922 CAGGTGCCCTGGTGGAAAACTGG + Intronic
1050847433 9:10239893-10239915 CAGCTGGCTTTGGGGAAAAAGGG - Intronic
1051162475 9:14223841-14223863 CCGTTGCCCTTGAGGAGACCAGG - Intronic
1052101183 9:24447814-24447836 TAGATGCCTTTGGGGAAAGCTGG + Intergenic
1053563073 9:39216333-39216355 CAGCTGCCCCTGTGGAAAACTGG + Intronic
1053828863 9:42054277-42054299 CAGCTGCCCCTGTGGAAAACTGG + Intronic
1054134074 9:61402722-61402744 CAGCTGCCCCTGTGGAAAACTGG - Intergenic
1054601696 9:67133175-67133197 CAGCTGCCCCTGTGGAAAACTGG - Intergenic
1055550844 9:77431112-77431134 CTGTTACCCTTGGAGAAAAAGGG - Intronic
1056217822 9:84421723-84421745 AAGTTGACCATGTGGAAAACTGG + Intergenic
1056925642 9:90832136-90832158 CAGTTGCTCCTGGGGAAATATGG - Intronic
1057754739 9:97823225-97823247 CAGTTGCCCATGGTGGAAACCGG - Intergenic
1057928190 9:99171063-99171085 CAGTTGCCCTGGGGAAAGAAGGG - Intergenic
1058571339 9:106348621-106348643 ATGTTGACATTGGGGAAAACTGG + Intergenic
1058956634 9:109954902-109954924 CAATTGCCAGTGGGGAGAACAGG - Intronic
1059519855 9:114930867-114930889 CAGGTTCCCTGGGGGAAAAAGGG + Intergenic
1061601270 9:131671742-131671764 CAGTTGAGCTGGGGGAGAACAGG + Intronic
1061715565 9:132516704-132516726 CAGTTACCATTGGGGGAAACTGG + Intronic
1062295454 9:135822921-135822943 CAGCTGTCCTTGGGGAGACCGGG + Exonic
1186292335 X:8113909-8113931 TAGGTTCCTTTGGGGAAAACGGG + Intergenic
1186319311 X:8407054-8407076 AGGTTACTCTTGGGGAAAACTGG + Intergenic
1186473071 X:9836226-9836248 CAGCTGCCCTTGGGTAAAAGTGG + Intronic
1186510175 X:10124741-10124763 GAGGTGCCCCTGAGGAAAACAGG + Intronic
1187727072 X:22214497-22214519 CAGTTGCCCATGGTGATAACTGG - Intronic
1187962857 X:24583271-24583293 CAGTTGCCACTGGGGCATACAGG - Intronic
1188351219 X:29133300-29133322 CAGTTTCCCTGGGGGAAACAAGG + Intronic
1192561859 X:72132455-72132477 CAGTAGCCCATGGGGAAACAAGG + Intergenic
1195732835 X:107982716-107982738 CAGTTGCCCTTGGAGGAAGAGGG + Intergenic
1195911446 X:109892014-109892036 ATGTTACCATTGGGGAAAACTGG - Intergenic
1196495804 X:116324110-116324132 CAGTTGGTCTGGGGGAGAACAGG - Intergenic
1199264460 X:145814608-145814630 CAGTTCCCCATGTGTAAAACTGG - Intergenic
1200151994 X:153955728-153955750 CAGTTGCCTTTGAGGCAAAGTGG - Intronic
1201426621 Y:13858502-13858524 TAGTTCTCCTTGGGGAAAAGAGG - Intergenic