ID: 1156382628

View in Genome Browser
Species Human (GRCh38)
Location 18:36578028-36578050
Sequence CAACATGGTCAGATGGAGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 246
Summary {0: 1, 1: 0, 2: 4, 3: 44, 4: 197}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156382628 Original CRISPR CAACATGGTCAGATGGAGTG GGG Intronic
902367083 1:15983037-15983059 CAGCCTGGTCAGATGGAAGGAGG - Intergenic
902547989 1:17202193-17202215 CACCAGGGTCAGATGGCCTGGGG + Intergenic
904867022 1:33587483-33587505 CAGCATGGTCAGATGTTGTGAGG - Intronic
906276415 1:44519695-44519717 CTACATGGAGAGATGGAGGGAGG - Intronic
907584642 1:55606225-55606247 CCTGATGGTCAGATTGAGTGAGG + Intergenic
907898320 1:58714046-58714068 CAACAGGGTCATATGTGGTGGGG + Intergenic
908329474 1:63056481-63056503 CAAAAGGGTCACATGGGGTGGGG + Intergenic
911849450 1:102798228-102798250 CAACCCAATCAGATGGAGTGAGG + Intergenic
914313529 1:146487747-146487769 ATACATGGACAGATAGAGTGGGG + Intergenic
914405925 1:147372965-147372987 CAACCTGGTGATATGCAGTGAGG - Intergenic
914500819 1:148245634-148245656 ATACATGGACAGATAGAGTGGGG - Intergenic
917632558 1:176904457-176904479 CAGCATGGGGAGAGGGAGTGCGG + Intronic
917862917 1:179165101-179165123 CTACATGATGAGATGAAGTGAGG + Intronic
918511678 1:185319457-185319479 CTACATGATGAGATGAAGTGAGG - Intergenic
919153227 1:193726875-193726897 CAACATGAGCAGAAGGAGTGTGG + Intergenic
919603086 1:199647196-199647218 TAACATGGTCAGCTGGTGGGGGG - Intergenic
919623844 1:199891701-199891723 CAACATGGGAAGAGAGAGTGAGG + Intergenic
923029393 1:230235426-230235448 GAAGATGGGGAGATGGAGTGAGG - Intronic
1063209030 10:3862032-3862054 CACCATGCCCAGATGGAATGTGG - Intergenic
1063856447 10:10259411-10259433 CAACAGGGTTTGATGGAGAGAGG - Intergenic
1064785001 10:18884907-18884929 CAACATGGGCAGTCGGAGTGGGG + Intergenic
1065010251 10:21414712-21414734 CTACCTGGTGAGATGCAGTGAGG + Intergenic
1065521764 10:26580150-26580172 CAACAGGGAAAGAAGGAGTGGGG - Intergenic
1070194954 10:74148845-74148867 TACTATGGGCAGATGGAGTGCGG - Intronic
1070644119 10:78189594-78189616 CAACATGGAGAGAGGGAGTTGGG + Intergenic
1076257658 10:129041321-129041343 TTACATGGTTAGATGGAGGGGGG - Intergenic
1076369199 10:129940866-129940888 CAACATGGGAGGATCGAGTGTGG - Intronic
1076394785 10:130130551-130130573 TAACATGGTCATAGGGAGAGAGG + Intergenic
1077790071 11:5429617-5429639 AAACATGGGCAGATGCAGAGGGG + Intronic
1078052784 11:7981941-7981963 CAGCATGGTCAGGTTCAGTGAGG + Intronic
1080740700 11:35061978-35062000 CAACAAGTTCACATGCAGTGAGG - Intergenic
1082181034 11:49119951-49119973 AAACATAGTCAGATGGACTGAGG + Intergenic
1082284244 11:50302048-50302070 CAACTTGGTGAGAGGGAGAGTGG + Intergenic
1084950082 11:72660001-72660023 AAACCTGGGCACATGGAGTGGGG - Intronic
1086684455 11:89714922-89714944 AAACATAGTCAGATGGACTGAGG - Intronic
1088048618 11:105483131-105483153 TTACATGGTCATATGGAATGAGG - Intergenic
1089618297 11:119707536-119707558 CTACATGGGCAGTTGGAGTGGGG - Intronic
1090491923 11:127171548-127171570 CAACATGAACAGATGAAGTGAGG - Intergenic
1092570955 12:9720572-9720594 CAACGTGGTCAGATGACCTGAGG - Intronic
1095365102 12:41394076-41394098 AAACATGATCAGATTAAGTGAGG + Intronic
1095461528 12:42449409-42449431 CTGCATGGTGAGATGAAGTGAGG - Intronic
1096522989 12:52194594-52194616 GAACCTGGACAGTTGGAGTGAGG + Intergenic
1097450067 12:59727203-59727225 CTACATATTCAGATAGAGTGAGG + Intronic
1097913486 12:64995435-64995457 CCCTAGGGTCAGATGGAGTGTGG - Intergenic
1098625301 12:72658912-72658934 CATTATTGTCAGATGGGGTGGGG + Intronic
1098889573 12:75995619-75995641 CTACAGGGACAGATGGGGTGGGG - Intergenic
1102514890 12:113439805-113439827 CAGCATGCCCAGCTGGAGTGAGG - Intergenic
1102679908 12:114684394-114684416 CAACATGATCAGAGGGCGGGCGG + Intergenic
1106649294 13:31672165-31672187 CAACATGGGCAGATGACCTGAGG - Intergenic
1107041855 13:35957284-35957306 CAACATCCTCAGATAGAGTCAGG + Intronic
1107828709 13:44354415-44354437 CAACATGGTGTGATAGAGTTAGG + Intergenic
1109691138 13:65891123-65891145 CACCATGGTTATATTGAGTGGGG - Intergenic
1110479631 13:75959409-75959431 CAAAATGGCCAGTTGGTGTGAGG + Intergenic
1110526385 13:76543233-76543255 CATCATGGTGATATGGAGTGGGG - Intergenic
1111658618 13:91181437-91181459 CAACATGGTCTGCTTTAGTGAGG + Intergenic
1114401254 14:22413019-22413041 CAGCATCGCCAGATGGGGTGCGG - Intergenic
1115128654 14:30026459-30026481 TGACATGGTCAGATGTAGGGTGG - Intronic
1115801845 14:37003309-37003331 CTACATGATGAGATGAAGTGAGG + Intronic
1120894138 14:89514736-89514758 CAAGATGCACAGATGGAGTGAGG - Intronic
1121454360 14:94028810-94028832 CAATATGCTCTGAGGGAGTGGGG + Intronic
1123034014 14:105464521-105464543 CAACCCGGTTAGATGGAGAGAGG + Exonic
1125170177 15:36757820-36757842 CCACATGATGAGATGAAGTGAGG - Intronic
1125710701 15:41783452-41783474 CAGCATGGCCACATGGAGTCAGG - Intronic
1133702122 16:8318512-8318534 CAACATGGGCAGATCGCCTGAGG - Intergenic
1135177793 16:20246327-20246349 CCACATGCTCAGATGGAGCCAGG - Intergenic
1135424897 16:22327511-22327533 CAACATGGACAGAGGGGGTCCGG - Intronic
1141741337 16:85895155-85895177 CAACATGGTCAGGTTTAGGGAGG + Intergenic
1142470807 17:162297-162319 CAACATGGCCAAGTGGACTGAGG + Intronic
1143966551 17:10759676-10759698 CAATTTGGGCAGATGGAATGGGG - Intergenic
1148643345 17:49204588-49204610 CAGAATGGTGAGATGGAGTCAGG + Intronic
1148921193 17:51036382-51036404 CAGCAGGGTCAGCTGGTGTGGGG - Intronic
1149242495 17:54666552-54666574 CTATATGGTAAGATGAAGTGAGG + Intergenic
1151379587 17:73716257-73716279 CAACACTGTCAGAAGGAGTTTGG + Intergenic
1153246537 18:3077768-3077790 TCACATTGTCAGATGGAGTGTGG + Intronic
1156371887 18:36478540-36478562 CTACATTGGCAGAGGGAGTGGGG - Intronic
1156382628 18:36578028-36578050 CAACATGGTCAGATGGAGTGGGG + Intronic
1159840451 18:73393165-73393187 CAACATGTTCATATGAAGTCAGG + Intergenic
1162141804 19:8589696-8589718 CAGCTTGGGCAGAGGGAGTGGGG + Intronic
1162426149 19:10597331-10597353 CAAGATGGGCAGATCGATTGAGG + Intergenic
1167008345 19:46789449-46789471 CAACACTGTCAGGTGGAGTAAGG - Intergenic
1167127200 19:47557980-47558002 CAAAATGGGCAGGGGGAGTGGGG + Intergenic
925123829 2:1439703-1439725 CAACATGGTGAGGGGGAGAGGGG - Intronic
926910068 2:17844343-17844365 AAGCATGGTCAGATGGAGTTTGG - Intergenic
931474537 2:62573879-62573901 CTACATGATGAGATGAAGTGAGG - Intergenic
938106448 2:128534212-128534234 CTACATGATGAGATGAAGTGAGG - Intergenic
939458479 2:142468044-142468066 CTACATGATGAGATGAAGTGAGG - Intergenic
940016893 2:149116063-149116085 CTACATGATGAGATGGAATGAGG - Intronic
942182031 2:173389372-173389394 CAGCATGGTAAGATGCAGTTTGG + Intergenic
947176579 2:227373240-227373262 GTACATCATCAGATGGAGTGAGG - Intronic
948258912 2:236588840-236588862 CAACATGGTGAGAAGGATTCTGG + Intergenic
948782740 2:240333183-240333205 CACCATGATCAGAGGGTGTGAGG + Intergenic
1168832367 20:853583-853605 CACCAGGGCCAGATGGTGTGGGG + Intronic
1170072960 20:12388957-12388979 CAACATGGTCACAAAGAGTTTGG + Intergenic
1170418540 20:16169669-16169691 TTACATGGGCATATGGAGTGTGG - Intergenic
1173662314 20:44743197-44743219 CTACATGGTCCTATGGGGTGAGG + Intergenic
1177463018 21:21437562-21437584 CAAAATGGGGAGATGAAGTGGGG - Intronic
1181069510 22:20323800-20323822 CAAGATGGGCAGATGGCTTGAGG + Intergenic
1182239883 22:28907340-28907362 ATACATGGTCAAATGCAGTGTGG - Intronic
1182424483 22:30264894-30264916 CGACCTGGCCATATGGAGTGGGG + Intronic
1184334137 22:43843533-43843555 CAACACTGTCAGTCGGAGTGGGG - Intronic
950612250 3:14133998-14134020 GAACCTGGTAGGATGGAGTGGGG - Intronic
950787729 3:15450065-15450087 CAGCATTGCCAGATGGAGGGAGG - Intronic
951915481 3:27796669-27796691 CTACATGATGAGATGCAGTGAGG - Intergenic
952182317 3:30930764-30930786 CACCAGGGTCTGATGGAGGGTGG + Intergenic
957769790 3:84675862-84675884 CACCAGGGTCAGATGGGGGGTGG + Intergenic
963623830 3:147646190-147646212 GAACATGGTAAGAGGGAGTGGGG - Intergenic
963743320 3:149100964-149100986 CAAAATGGTCAGATTGCTTGAGG - Intergenic
964071867 3:152645260-152645282 CTACATGATGAGATGAAGTGAGG + Intergenic
964629378 3:158793543-158793565 CTACATGATGAGATGAAGTGAGG - Intronic
967490082 3:190080334-190080356 CAACATGATCAGATGTTGTGTGG - Intronic
970914063 4:21311784-21311806 CAAGATGAACAGATGCAGTGAGG + Intronic
976508529 4:85880268-85880290 CTACATGTTAAGATGAAGTGAGG + Intronic
976645095 4:87379182-87379204 CAACATGGTCACCTGAAGTCAGG - Intronic
978467956 4:109029400-109029422 CTACATGGTGAGAGGAAGTGAGG - Intronic
979192671 4:117881974-117881996 CAAGATGCTCAGATGGAATATGG + Intergenic
979611248 4:122691143-122691165 CAACATGGTCAGCAGGTATGGGG - Intergenic
980725284 4:136750943-136750965 CTACATGATGAGATGAAGTGAGG + Intergenic
981537288 4:145813231-145813253 CTACATGATGAGATGAAGTGAGG - Intronic
982377607 4:154710789-154710811 AAAGATGGTCCTATGGAGTGTGG - Intronic
983994679 4:174167354-174167376 CAAAATGCTCAAATTGAGTGAGG + Intergenic
984514319 4:180719605-180719627 CAACATGGTCAGACAAAGGGAGG - Intergenic
986858327 5:11898198-11898220 CAACATGCTGAGATGGGGAGTGG + Intronic
988016393 5:25565369-25565391 GCACATGGTGAGATGTAGTGAGG - Intergenic
988344251 5:30017768-30017790 CAACATGGTAAAATAGAGTTTGG + Intergenic
988479976 5:31621356-31621378 CAATATGGTTAGAAGGAGAGTGG + Intergenic
989425371 5:41290430-41290452 CAACATGGTGAGGTGGAGTGGGG + Intergenic
991025938 5:62029665-62029687 TTACATGGTGAGATGAAGTGAGG - Intergenic
992179815 5:74184913-74184935 CCACATGGCCAGATGGAGTGTGG - Intergenic
993762972 5:91819775-91819797 CAATATGGTATGATGCAGTGAGG + Intergenic
993868808 5:93225559-93225581 CAAGGTGCTCAGAAGGAGTGAGG + Intergenic
997975291 5:138438459-138438481 CAACGGGGTGAGAAGGAGTGGGG + Intergenic
998214953 5:140230623-140230645 CAATATGGCCAGCTGGAGTTTGG - Intronic
999566500 5:152868322-152868344 CAAGATGGTCATTTGGAGGGAGG - Intergenic
999645874 5:153716594-153716616 CAGCCTGCTCAGCTGGAGTGAGG + Intronic
999826248 5:155276245-155276267 CAGCCTGGTCAGATGTAGTTAGG - Intergenic
1000374704 5:160568502-160568524 CAGCGTGGTGAGATGGAGAGAGG + Intronic
1001286995 5:170431044-170431066 CAGCATCTGCAGATGGAGTGAGG - Intronic
1002464350 5:179398746-179398768 GTACATGGTCAGAAGGATTGGGG - Intergenic
1004868321 6:19876339-19876361 AAACACAGTCAGATGGAATGTGG + Intergenic
1005891392 6:30141806-30141828 CAAGATGGTGTGATGCAGTGTGG + Intronic
1005894013 6:30163054-30163076 CACCATGGGCAGATGTGGTGAGG + Intergenic
1007804123 6:44425380-44425402 CAACAAGCTCAGATGAATTGAGG + Intronic
1008157703 6:48037106-48037128 CTACATGATGAGATGAAGTGAGG - Intronic
1008555059 6:52665894-52665916 CAAAAGGTTCAGAGGGAGTGAGG + Intergenic
1009408341 6:63336059-63336081 CAAACTGGTAAGATTGAGTGGGG + Intergenic
1010715219 6:79221313-79221335 CGAGATGGGCAGAGGGAGTGTGG + Intronic
1011494551 6:87925489-87925511 CCCCATGGTCAGGTGGACTGTGG - Intergenic
1011542344 6:88445354-88445376 CCATCTGGACAGATGGAGTGTGG - Intergenic
1012712001 6:102618346-102618368 AAACATTGTGAGATGGAGTTGGG - Intergenic
1012990544 6:105921635-105921657 CTACATGATGAGATGAAGTGAGG + Intergenic
1013693507 6:112673051-112673073 CAAGATGGACAGAGGAAGTGAGG - Intergenic
1017754319 6:157516973-157516995 CAACATGGCAAGAGGGAGGGTGG + Intronic
1018217998 6:161549671-161549693 GAAAATGGTCTGATGGAGTTTGG - Intronic
1021394595 7:20131710-20131732 CTACATGATGAGATGAAGTGAGG + Intergenic
1024178308 7:46862994-46863016 AAACAGTGTGAGATGGAGTGGGG - Intergenic
1024285989 7:47758030-47758052 CAAGATGTTCTGATGCAGTGTGG - Intronic
1025187262 7:56870980-56871002 CAACTTGGTGAGAGGGAGGGTGG - Intergenic
1025684661 7:63705940-63705962 CAACTTGGTGAGAGGGAGAGTGG + Intergenic
1027212914 7:76165197-76165219 CAACTTGGTGAGAGGGAGAGTGG - Intergenic
1030172695 7:106619881-106619903 CAGCAAGATCAGTTGGAGTGTGG - Intergenic
1035324800 7:158058156-158058178 CACCGTGGGCAGATGGAGTGTGG - Intronic
1035324805 7:158058193-158058215 CACCGTGGGCAGATGGAGTGTGG - Intronic
1035324810 7:158058230-158058252 CACCGTGGGCAGATGGAGTGTGG - Intronic
1035324822 7:158058304-158058326 CACCGTGGGCAGATGGAGTGTGG - Intronic
1035324827 7:158058341-158058363 CACCGTGGGCAGATGGAGCGTGG - Intronic
1035324832 7:158058378-158058400 CACCGTGGGCAGATGGAGTGTGG - Intronic
1035324837 7:158058415-158058437 CACCGTGGGCAGATGGAGTGTGG - Intronic
1035324844 7:158058489-158058511 CACCGTGTGCAGATGGAGTGTGG - Intronic
1035324847 7:158058526-158058548 CACCGTGTGCAGATGGAGTGTGG - Intronic
1035324850 7:158058563-158058585 CACCGTGGGCAGATGGAGTGTGG - Intronic
1035324855 7:158058600-158058622 CACCGTGGGCAGATGGAGTGTGG - Intronic
1035324860 7:158058637-158058659 CACCGTGGGCAGATGGAGCGTGG - Intronic
1035324865 7:158058674-158058696 CACCGTGGGCAGATGGAGTGTGG - Intronic
1035324870 7:158058711-158058733 CACCGTGGGCAGATGGAGCGTGG - Intronic
1035324875 7:158058748-158058770 CACCGTGGGCAGATGGAGTGTGG - Intronic
1035324882 7:158058822-158058844 CACCGTGTGCAGATGGAGTGTGG - Intronic
1035324884 7:158058859-158058881 CACTGTGGGCAGATGGAGTGTGG - Intronic
1035324889 7:158058896-158058918 CACTGTGGGCAGATGGAGTGTGG - Intronic
1035324894 7:158058933-158058955 CACCGTGTGCAGATGGAGTGTGG - Intronic
1035324896 7:158058970-158058992 CACTGTGGGCAGATGGAGTGTGG - Intronic
1035324900 7:158059007-158059029 CACTGTGGGCAGATGGAGTGTGG - Intronic
1035324906 7:158059044-158059066 CACCGTGGGCAGATGGAGTGTGG - Intronic
1035324910 7:158059081-158059103 CACTGTGGGCAGATGGAGTGTGG - Intronic
1035324916 7:158059118-158059140 CACCGTGGGCAGATGGAGTGTGG - Intronic
1035324921 7:158059155-158059177 CACCGTGTGCAGATGGAGTGTGG - Intronic
1035324923 7:158059192-158059214 CACTGTGGGCAGATGGAGTGTGG - Intronic
1035324927 7:158059229-158059251 CACTGTGGGCAGATGGAGTGTGG - Intronic
1035324937 7:158059340-158059362 CACCGTGTGCAGATGGAGTGTGG - Intronic
1035324940 7:158059377-158059399 CACCGTGGGCAGATGGAGTGTGG - Intronic
1035324945 7:158059414-158059436 CACCGTGGGCAGATGGAGTGTGG - Intronic
1035324956 7:158059558-158059580 CACCGTGGGCAGATGGAGTGTGG - Intronic
1035324961 7:158059595-158059617 CACCGTGTGCAGATGGAGTGTGG - Intronic
1035324964 7:158059632-158059654 CACCGTGGGCAGATGGAGTGTGG - Intronic
1035324969 7:158059669-158059691 CACCGTGTGCAGATGGAGTGTGG - Intronic
1035324972 7:158059706-158059728 CACCGTGGGCAGATGGAGTGTGG - Intronic
1035324977 7:158059743-158059765 CACCGTGGGCAGATGGAGTGTGG - Intronic
1035324982 7:158059780-158059802 CACCGTGGGCAGATGGAGTGTGG - Intronic
1035324987 7:158059817-158059839 CACCGTGTGCAGATGGAGTGTGG - Intronic
1035324990 7:158059854-158059876 CACCGTGGGCAGATGGAGTGTGG - Intronic
1035324995 7:158059891-158059913 CACCGTGTGCAGATGGAGTGTGG - Intronic
1035324998 7:158059928-158059950 CACCGTGTGCAGATGGAGTGTGG - Intronic
1035325001 7:158059965-158059987 CACCGTGTGCAGATGGAGTGTGG - Intronic
1035325004 7:158060002-158060024 CACCGTGTGCAGATGGAGTGTGG - Intronic
1035325007 7:158060039-158060061 CACCGTGTGCAGATGGAGTGTGG - Intronic
1035325010 7:158060076-158060098 CACCGTGGGCAGATGGAGTGTGG - Intronic
1035325015 7:158060113-158060135 CACCGTGTGCAGATGGAGTGTGG - Intronic
1035325018 7:158060150-158060172 CACCATGTGCAGATGGAGTGTGG - Intronic
1035325021 7:158060187-158060209 CACCGTGTGCAGATGGAGTGTGG - Intronic
1035325024 7:158060224-158060246 CACCGTGTGCAGATGGAGTGTGG - Intronic
1035547449 8:494335-494357 CAACAGGGACAGACGGAGTGGGG + Intronic
1035816077 8:2542447-2542469 CTACATGATAAGATGGATTGGGG + Intergenic
1043470345 8:80555774-80555796 CAACATGGTCAGATGGAAGCAGG + Intergenic
1044662933 8:94609210-94609232 AAAATTGGTCAGATGTAGTGGGG + Intergenic
1045854994 8:106754694-106754716 CAAAATGGTCTACTGGAGTGGGG - Intergenic
1048797732 8:138167020-138167042 CATCCTGGTCAGAGTGAGTGTGG - Intronic
1049511851 8:143031408-143031430 CAACATAGTGAGATGGAGCAGGG + Intergenic
1050451502 9:5786412-5786434 CAACTTGGTAAGATGGAGAGGGG + Exonic
1052962712 9:34314074-34314096 CAACATTGTAAAATGGAATGTGG - Intronic
1053406992 9:37885958-37885980 CAACAGGGTCACTTGGATTGTGG + Intronic
1055378031 9:75671769-75671791 GAACCTGCTCAGATGGAATGTGG - Intergenic
1060385828 9:123227441-123227463 TAACAGGGTCAGATGAAGTAGGG + Intronic
1060825998 9:126688486-126688508 CCACTAGGTCAGGTGGAGTGTGG + Intronic
1062397971 9:136360140-136360162 CAACATGGCCAGGTGGGCTGTGG - Intronic
1203748292 Un_GL000218v1:56958-56980 CAACATATTCAGATGGATGGCGG - Intergenic
1188447356 X:30269430-30269452 CATTATGATCAGATGAAGTGTGG - Intergenic
1190812334 X:53896708-53896730 TGACATGGTGAGATGGAGTGAGG + Intergenic
1192560172 X:72123115-72123137 GAACATTGCCAGTTGGAGTGAGG + Intergenic
1195693166 X:107645965-107645987 AAGCATGGAGAGATGGAGTGGGG - Intronic
1200701043 Y:6402795-6402817 AAATAAGGTCAGATGGGGTGAGG - Intergenic
1200910276 Y:8525754-8525776 CAATAAGGTCAGATGGGGTGAGG + Intergenic
1200914967 Y:8563572-8563594 AAATAAGGTCAGATGGGGTGAGG + Intergenic
1200917524 Y:8584422-8584444 CAATAAGGTCAGATGGGGTGAGG + Intergenic
1200919232 Y:8598430-8598452 CAATAAAGTCAGATGGGGTGAGG + Intergenic
1200924953 Y:8646048-8646070 CAATAAGGTCAGATGGGGTGAGG + Intergenic
1200926131 Y:8656609-8656631 CAATAAGGTCAGATGGGGTAAGG + Intergenic
1200938291 Y:8757537-8757559 CAATAGGGTCAGATGGGGAGAGG - Intergenic
1200961770 Y:9002384-9002406 CAATAAGGTCAGATGGGGTGAGG + Intergenic
1201033069 Y:9761903-9761925 AAATAAGGTCAGATGGGGTGAGG + Intergenic
1202128277 Y:21587599-21587621 CAATAAGGTCACATGGGGTGAGG + Intergenic
1202130138 Y:21601867-21601889 CAATAAGGTCAGATGGGGTGAGG - Intergenic
1202180619 Y:22136786-22136808 CAATACAGTCAGATGGGGTGAGG - Intergenic
1202181236 Y:22141679-22141701 CAATAAGGTCAGATAGCGTGAGG - Intergenic
1202182275 Y:22149779-22149801 CAATAAGGTCAGATGGAGTGAGG - Intergenic
1202209085 Y:22436623-22436645 CAATAAGGTCAGATGGAGTGAGG + Intergenic
1202210124 Y:22444721-22444743 CAATAAGGTCAGATAGCGTGAGG + Intergenic
1202210741 Y:22449613-22449635 CAATACAGTCAGATGGGGTGAGG + Intergenic