ID: 1156385482

View in Genome Browser
Species Human (GRCh38)
Location 18:36600869-36600891
Sequence GCTCAAAGGAAGAATGTGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 215
Summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 188}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156385482_1156385488 19 Left 1156385482 18:36600869-36600891 CCCTGCACATTCTTCCTTTGAGC 0: 1
1: 0
2: 0
3: 26
4: 188
Right 1156385488 18:36600911-36600933 ACAACATGTGTTCTATGCCAAGG 0: 1
1: 0
2: 0
3: 9
4: 133

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156385482 Original CRISPR GCTCAAAGGAAGAATGTGCA GGG (reversed) Intronic
901088174 1:6624911-6624933 GCTCAAAGCAAGGAGGTGAAAGG + Exonic
901260288 1:7865981-7866003 TCTCAACGGATGAATGTGCAGGG + Intergenic
902608764 1:17584696-17584718 ACTCGAAGGAAGAACGTGCTAGG + Intronic
903929734 1:26855292-26855314 GAGAAAAGGAAGAAGGTGCAGGG + Exonic
908415431 1:63908871-63908893 ACTCAGATGAAGAATGTGCCAGG + Intronic
913173329 1:116251766-116251788 GCTCAAAGGAAGAAGGAGAGAGG + Intergenic
913673149 1:121116850-121116872 GCTCGAAGTAAGAGTGTGCAAGG - Intergenic
914024927 1:143904211-143904233 GCTCGAAGTAAGAGTGTGCAAGG - Intergenic
914663357 1:149811931-149811953 GCTCGAAGTAAGAGTGTGCAAGG - Exonic
914852641 1:151326641-151326663 GTTCAAAGTAAGAATGTAAATGG + Intronic
917431352 1:174972904-174972926 GCTCAAAGGTAGAATTTGAAAGG + Intronic
918584615 1:186171428-186171450 GCTCAAAGGCAGAAAATGCATGG + Exonic
918760950 1:188406389-188406411 GCCCAAAGGCATAATGTGGAAGG - Intergenic
922486836 1:225979898-225979920 GCTGAAGGAAAGAATGTGCATGG - Intergenic
922801623 1:228367234-228367256 GCTCAGAGGAGCCATGTGCACGG + Intronic
924605053 1:245527065-245527087 GCTAAAAGGAAGAAGCTGAATGG - Intronic
1066147796 10:32579649-32579671 GAGCAAAGGGAAAATGTGCATGG + Intronic
1068698982 10:60000152-60000174 GCTCAAAATAAGGATGTGAAGGG + Intergenic
1068924920 10:62526422-62526444 GCTGCAAGAAAGCATGTGCAGGG + Intronic
1070191731 10:74117648-74117670 TCTCAAAAAAAGAATGAGCAGGG + Intronic
1071403938 10:85309952-85309974 GCACAAAGAAAGAAAGAGCATGG - Intergenic
1071416619 10:85447610-85447632 GCTAAATGCAACAATGTGCAGGG + Intergenic
1072118114 10:92383036-92383058 ACTCTAAGAAAGAATGTGGAAGG - Intergenic
1073058907 10:100721380-100721402 GATCAAATGATGAATGTGAAAGG - Intergenic
1074684716 10:115949907-115949929 GCTGAAAAGGAGAGTGTGCAAGG - Intergenic
1078444525 11:11394289-11394311 GCTAGAAGCATGAATGTGCATGG + Intronic
1078848451 11:15142407-15142429 GCTAAAAGGAAGAGCGTGCAGGG - Intronic
1078949512 11:16113935-16113957 GCTCAAAAGAAGAAATTTCATGG + Intronic
1080491578 11:32770253-32770275 GTTCAAAGGTAGAAACTGCAAGG + Intronic
1081345317 11:41978634-41978656 ACTCAAGGGGAGATTGTGCAAGG + Intergenic
1081698099 11:45132653-45132675 GCTCAGAGGCAGATTGTGAAAGG - Intronic
1084069645 11:66726203-66726225 GCTCAAGGAAAGAATGAACACGG + Intronic
1086221679 11:84452717-84452739 GCTCAAAGGAAAGCTGTGGATGG + Intronic
1088589278 11:111388838-111388860 GCTCAAAGGAGTAAAGTGAAAGG + Intronic
1092103919 12:5907536-5907558 CCCCAAAGGGAGAAGGTGCAGGG - Intronic
1092123586 12:6060843-6060865 GATCAAGGGGAGAAAGTGCATGG + Intronic
1092947337 12:13468987-13469009 GATCAAAGCAAGAATGTGGAGGG + Intergenic
1095992040 12:48041832-48041854 CCACAAAGGAAGTATGTGTAAGG + Intergenic
1096242989 12:49969201-49969223 GCTCAAGGGATGACTGGGCATGG - Intronic
1096370282 12:51063763-51063785 GTTCTAAGGAAGAATCTTCAGGG + Exonic
1098918970 12:76285590-76285612 GCCCAAAGGCAGACTCTGCAGGG - Intergenic
1100679037 12:96898834-96898856 GTTCAAGGGAAAAATATGCAAGG + Intergenic
1101011886 12:100459216-100459238 GCTCAAAGGCAGAATAAACAGGG + Intergenic
1107256144 13:38428867-38428889 CCCCAAAGGAAGAATGTAAAAGG + Intergenic
1110951923 13:81504348-81504370 TCTCAAAAGAAAAATGTTCATGG + Intergenic
1112539321 13:100291879-100291901 ACTCTAGGGAAGAATGTGAAAGG - Intronic
1112621069 13:101054272-101054294 GTTCAAAGGAAGATTTTGCAGGG + Exonic
1113717738 13:112525225-112525247 GGACAAAGGAATAATGTGCATGG - Intronic
1114390012 14:22297468-22297490 GTTCAAAGGCAGAATGTGCCAGG - Intergenic
1117280076 14:54231283-54231305 GCTCAATGGAAAATTATGCAGGG - Intergenic
1118550384 14:66943683-66943705 GCTTAAAGGAAGATAGTGCTTGG - Intronic
1118918496 14:70128457-70128479 GGTCAAGAGAAGAAAGTGCAGGG - Intronic
1119574331 14:75704862-75704884 ACTCAAAGGATAAATGTGTATGG + Intronic
1125171995 15:36776168-36776190 GCTCATCAGAAGAATGTGAATGG - Intronic
1127903549 15:63359140-63359162 GCTCAGAGGAAAACTGGGCAGGG - Intronic
1129258508 15:74348403-74348425 GGACACAGGAAGAATGCGCAAGG - Intronic
1131510376 15:93046627-93046649 GCTCAAAGAAAGAATGAATAGGG + Intronic
1131592059 15:93760539-93760561 GCTCACAGAAATCATGTGCAGGG - Intergenic
1134250412 16:12570101-12570123 GCAAAAAGGAAGATTGTTCATGG + Exonic
1135046724 16:19162030-19162052 GTTCAAGGGAAGAAGGTGAAAGG + Intronic
1135197019 16:20403111-20403133 GCACACAGGGAGAATGTGGAGGG - Intronic
1138104635 16:54281460-54281482 GCTGAGAGGAAGCATGTCCAGGG - Intergenic
1138962705 16:62046306-62046328 TCTCAAAGGAAAAATCTGGATGG + Intergenic
1139303194 16:65962432-65962454 GCCCACAGGAAGCACGTGCACGG - Intergenic
1140297403 16:73722294-73722316 GCTCAAATGAGCAATGTTCAAGG - Intergenic
1145883411 17:28367524-28367546 TCTCAAGGGAAGAGTGGGCAGGG - Intronic
1150919490 17:69468255-69468277 GCTCAAATGAAGGATGAGAAGGG - Intronic
1153926917 18:9842587-9842609 GCTTACAGGAAGAATCTGGAGGG - Intronic
1156385482 18:36600869-36600891 GCTCAAAGGAAGAATGTGCAGGG - Intronic
1156659708 18:39332730-39332752 GCTCAAAGGTGGTATGTGCATGG + Intergenic
1157466886 18:47955083-47955105 GCTGTCAGGAAGAATGTGAAAGG - Intergenic
1157928212 18:51789709-51789731 GCTGAAAGACAGACTGTGCATGG + Intergenic
1162020345 19:7865371-7865393 GCTCAATAGACAAATGTGCAGGG + Intergenic
1162097202 19:8317274-8317296 GCTCAAAACAAGGATGGGCAGGG + Intronic
1164182876 19:22834663-22834685 TTTCAAAGGAAGAATATGCCAGG - Intergenic
1164583337 19:29448904-29448926 GTTTAAAGGAAGCATGTGCTGGG - Intergenic
1166608000 19:44162575-44162597 GAGCAAAGGGAAAATGTGCATGG + Intergenic
1167457250 19:49603175-49603197 GATCAGAGGATTAATGTGCAAGG + Intronic
1168189168 19:54725520-54725542 GCTCAAAGGAGTGGTGTGCAGGG + Intronic
925453201 2:3989762-3989784 GGCCAAAGAAAGCATGTGCAGGG + Intergenic
925662780 2:6220579-6220601 GATCAAAGCATGAAGGTGCATGG + Intergenic
926910081 2:17844414-17844436 GCTCAATGGAAGAATCTCCTGGG + Intergenic
928378615 2:30799464-30799486 CCTCAGAGGAAGACTATGCAGGG + Intronic
928537298 2:32253069-32253091 GCTCACAGGAAAAAAATGCATGG - Intronic
930407994 2:50985930-50985952 TCTCAAAGAAAAAATGAGCAGGG + Intronic
936693462 2:114920302-114920324 GTTCTAAGGAAGAATGTATAAGG + Intronic
937783537 2:125868237-125868259 GCACAGAGTAAGAATGTCCAAGG - Intergenic
938743198 2:134252283-134252305 CCTCTCAGGAAGCATGTGCAGGG + Intronic
939393785 2:141602713-141602735 GTTCAAAGGAATAATGGGCAGGG + Intronic
939466146 2:142560461-142560483 TCTCAAAGGAGAAATGTGTAAGG + Intergenic
939753981 2:146086370-146086392 GCTTATAGGAAAAATGTGAAAGG - Intergenic
940283541 2:152011283-152011305 CCTCAAAGGAAGAAGGTGGAGGG - Intronic
940911996 2:159217252-159217274 GCTCCAAGAAAGAGTGTTCAAGG + Intronic
941586599 2:167366910-167366932 GCACAAAGGCAGAAGGTGCCAGG + Intergenic
943706280 2:191038259-191038281 GCAGAGAGGAAGACTGTGCAGGG - Intronic
943775386 2:191759946-191759968 TCTAAAAGGAATAATGTGCATGG + Intergenic
943777450 2:191781895-191781917 GCTCACAGGAAGGAGGTGAAGGG + Intergenic
943838494 2:192546896-192546918 GCACTAAAGAAGAATGTGGAGGG - Intergenic
945637323 2:212371779-212371801 GCTCAAAGTAAGACTTTTCATGG - Intronic
945847106 2:214958866-214958888 GATCAAAGGAAGTTTCTGCAAGG - Intronic
946500769 2:220245069-220245091 ACTCAAAGGAAGAAAGTGACTGG + Intergenic
946787263 2:223260797-223260819 GCTCATCTGAGGAATGTGCAGGG - Intergenic
947871085 2:233438616-233438638 GCTCAAAAGATGCACGTGCATGG - Intronic
949057086 2:241933738-241933760 GCTCAAAGGAACAGCGTGAACGG + Intergenic
1168956259 20:1836536-1836558 GCTCAAAGGAAGAGGGAGCGGGG - Intergenic
1169351621 20:4872670-4872692 TTTCCAAGAAAGAATGTGCATGG - Intronic
1170805059 20:19622274-19622296 GCTCACTGGAGGAATGAGCATGG + Intronic
1170834729 20:19874458-19874480 GCTCAAAGAAAGACAGTGAAAGG + Intergenic
1171273528 20:23835127-23835149 GCTCAGAGTCAGAATGGGCAGGG + Intergenic
1173139510 20:40470032-40470054 GATGAAGGGAACAATGTGCAAGG - Intergenic
1173383420 20:42566580-42566602 GCTGAAAGAGAGAATGTGCCTGG - Intronic
1173683503 20:44905495-44905517 GGCCAAAGGAAGAATATGGAAGG - Intronic
1178156509 21:29860021-29860043 TTACAAAGGAAGAAAGTGCAGGG + Intronic
1179468097 21:41591434-41591456 GCTCATAGGAAGCAAGTGGATGG - Intergenic
1182209125 22:28659599-28659621 GCTCAAATAAAGAATATGCCTGG + Intronic
1182932380 22:34187446-34187468 GCTTAAAGGAAAAATGTAAAGGG - Intergenic
949521863 3:4863776-4863798 TTTGAAAGGAAGAATGTACAGGG - Intronic
949723163 3:7014235-7014257 GCTCAAAGCAAGAAAGTCTAGGG - Intronic
950737845 3:15025044-15025066 GCCCAAAGACAGAAGGTGCAAGG - Intronic
951003805 3:17594247-17594269 GAGGAAAGGAAGAGTGTGCATGG + Intronic
952234398 3:31463941-31463963 GCTGAAAGGTAGAAAGTGGAAGG - Intergenic
953155153 3:40363646-40363668 GTTCAAAGGAAGAATAGTCACGG - Intergenic
955556983 3:60148953-60148975 GCTCAAAGGATTACTGTTCAAGG - Intronic
956443237 3:69300685-69300707 GCACAAAAGATGAAAGTGCAAGG + Intronic
956870079 3:73408153-73408175 GCTCAGAGGTGGAGTGTGCAGGG + Intronic
957488098 3:80888854-80888876 GCTCAGAAGGGGAATGTGCAAGG - Intergenic
960503745 3:118468142-118468164 GGTCAAAGGAAATATGTGGAAGG + Intergenic
962643343 3:137411449-137411471 TCTCAAAGGGAGAATCTGTAGGG + Intergenic
963113785 3:141708486-141708508 GCTCACAGGAGGAAGGTGCCTGG + Intergenic
963214914 3:142734378-142734400 GGTTAAAGGAGGAATGTGAATGG + Intronic
964056413 3:152465585-152465607 GCTGAAAGGACAAATGTGCTTGG + Exonic
967384853 3:188901261-188901283 GCTAAAAAGAAGAGTCTGCAGGG - Intergenic
967838004 3:193980733-193980755 TGTCAAAGGAAGATTCTGCAGGG - Intergenic
967998889 3:195187620-195187642 GCTTAAAGGAATAATGTCCAGGG - Intronic
968748090 4:2371268-2371290 GTACAAAAGAAGAATGTGCCAGG - Intronic
970906019 4:21217413-21217435 GCACAAAAGAAGAATTTTCAAGG + Intronic
970917183 4:21349702-21349724 TCTTAAAGGTAGAGTGTGCAGGG + Intronic
971324265 4:25631306-25631328 ACTCAAAGAAAGAAGGAGCATGG + Intergenic
971598218 4:28559182-28559204 ACTCAAAGAAAGAATGTGCCAGG - Intergenic
971684862 4:29751184-29751206 ACTCAAAGGAGAAATGTGCAAGG + Intergenic
972233918 4:37107150-37107172 GCTTAAAGGAATAATATGGAAGG - Intergenic
973698769 4:53516603-53516625 GCTCCAAGGATGCAGGTGCATGG + Intronic
973943186 4:55931233-55931255 TTACAAAGGAAGAATGGGCAGGG - Intergenic
973959157 4:56092232-56092254 ACTCAAGGAAAGAAGGTGCATGG + Intergenic
974862202 4:67535979-67536001 GCTCAAAGGCATTATGTACATGG - Intronic
976113209 4:81699039-81699061 GCTATGAGGAAGAATATGCAGGG - Intronic
980967596 4:139537517-139537539 GCTCTGATGAATAATGTGCATGG - Intronic
981342687 4:143640132-143640154 GCAAAAAGGAAGTATGTGCAAGG - Intronic
983112114 4:163764427-163764449 GCACAGAGGAAAAATGTGTAAGG + Intronic
984893400 4:184513761-184513783 GTTCAAAGGAGGAGAGTGCATGG - Intergenic
987033157 5:13994215-13994237 GGTCAAAGGCAGAGTGAGCATGG - Intergenic
987618489 5:20307126-20307148 GATCTAAGGCAGTATGTGCATGG + Intronic
987743023 5:21934772-21934794 GAGAAAAGGAAGAATGTGGAGGG - Intronic
988638818 5:33018177-33018199 GTTCAAAAGAAGAATATGGAAGG + Intergenic
989974394 5:50566190-50566212 GCGAAAAGGAAGAAAGTGAAAGG + Intergenic
990731408 5:58812854-58812876 GATCAAATGAAAAATGTTCATGG - Intronic
992562381 5:77965481-77965503 GCTCAAAAGTAGATTGTGCCAGG - Intergenic
992750089 5:79853706-79853728 GCTGAAAGGAAGACTTGGCAGGG - Intergenic
993139645 5:84015297-84015319 GTTCAAAGGAAGAATGAGAAAGG + Intronic
995490277 5:112683917-112683939 GCTCAAAGGAAGAAAGCTCAGGG - Intergenic
995528536 5:113070052-113070074 GCTCAAAGGCAGATTGTGGGTGG + Intronic
997641263 5:135450353-135450375 GCTCAAAGGAGGATTCAGCAAGG - Intronic
999145279 5:149388871-149388893 GCTCAAAGGAAATATGTGGCTGG - Intronic
1000101780 5:158023612-158023634 GCTGAGATGAAGAATGAGCAGGG + Intergenic
1000620723 5:163482767-163482789 GCTCAAATCAAGAATATGTAAGG + Exonic
1003268225 6:4585146-4585168 GCACACAGGAAGAATGAGAAAGG + Intergenic
1004249862 6:14014974-14014996 GTCCAAAGGAAGAATGGACAGGG - Intergenic
1004766705 6:18737054-18737076 GCTGATAGGCTGAATGTGCAGGG + Intergenic
1006850368 6:37093592-37093614 CCTCCAAGAATGAATGTGCACGG - Intergenic
1007167531 6:39839548-39839570 GCCAAAAGGAAGAATGAGAAGGG + Intronic
1007362437 6:41368628-41368650 GCTCAAATGGAGAATGAGAAAGG + Intergenic
1014139336 6:117922255-117922277 GCTCAAAGTAAGCATGGGGAAGG + Intronic
1014269597 6:119321916-119321938 GCTCAAAGTAAACATTTGCAGGG - Intronic
1014648505 6:124005990-124006012 GCTGTAAGGATGAATGAGCAGGG - Intronic
1017763154 6:157586469-157586491 GCTCCATGGAAGATCGTGCAAGG + Intronic
1019628359 7:2032898-2032920 GCACACAGGGAGAGTGTGCATGG + Intronic
1019771528 7:2886520-2886542 GCGGGAGGGAAGAATGTGCAAGG + Intergenic
1019791969 7:3020242-3020264 GCTCTAAGGAGGAATATACAGGG + Intronic
1020796532 7:12684365-12684387 GCTCCAGGGAAGACTGTGCAAGG + Intergenic
1021514344 7:21466465-21466487 CCTCAAAGGAAGAAACTGCAGGG + Intronic
1026451943 7:70537078-70537100 GCTAAAATGATGAATGTGCATGG - Intronic
1027264575 7:76487327-76487349 GCTCAAAAGAAGAAGAGGCAGGG - Intronic
1027315945 7:76985429-76985451 GCTCAAAAGAAGAAGAGGCAGGG - Intergenic
1027488293 7:78789022-78789044 GTTGAGAAGAAGAATGTGCAGGG - Intronic
1027708209 7:81562677-81562699 TCTCCTGGGAAGAATGTGCAGGG + Intergenic
1028039764 7:86036923-86036945 GCTTGAAGAAAGAATGTGGAAGG - Intergenic
1029973191 7:104809435-104809457 CCTCAAAGGCAGAACGTGGATGG - Intronic
1031479519 7:122261372-122261394 GCTCAAAAGAAAAATTTCCAAGG - Intergenic
1032908961 7:136407207-136407229 GCTCACAGGAATTGTGTGCAAGG - Intergenic
1033444686 7:141410053-141410075 GCACAGAGCAAGGATGTGCAAGG - Intronic
1034565283 7:151909448-151909470 GCTCGGAGGAAGAGTGTGTAAGG + Intergenic
1035481771 7:159192617-159192639 GGGCAAAGGAAGAATCTGCCTGG + Intergenic
1035814519 8:2524939-2524961 GATCATATGAAGAATGTGTAAGG - Intergenic
1036646541 8:10614362-10614384 GCTCTAAGAAAGAATGAGCCAGG + Intronic
1037086362 8:14855745-14855767 GCTCAAAGGCAGAACATGCCCGG + Intronic
1037684504 8:21127198-21127220 GCTCAAAGGGAGATTAAGCAGGG + Intergenic
1045337978 8:101225249-101225271 GTTGAAAGGAAGAGTGTGCCAGG + Intergenic
1045641574 8:104257293-104257315 TCTCAGAGGAAAAATGTGGATGG - Intergenic
1047349619 8:124061367-124061389 CTACAATGGAAGAATGTGCATGG + Intronic
1048230801 8:132639197-132639219 GCTCATAGAAAGAAACTGCAAGG - Intronic
1048646098 8:136421489-136421511 GTTCAAGGGAAGACTGTGGAAGG + Intergenic
1050811520 9:9753867-9753889 TCTTAAGGGAAGAATTTGCATGG - Intronic
1051399832 9:16668705-16668727 TTTCAAAGGAAGAATTGGCAGGG + Intronic
1052315663 9:27114046-27114068 GCTCAAAGACACAATCTGCATGG - Intronic
1053390308 9:37730180-37730202 GCTCAAAGGCAGCAGGTGCAAGG - Intronic
1062669436 9:137698531-137698553 GTTCAAAGGTAGAGTGGGCAGGG + Intronic
1185801394 X:3014551-3014573 GATAAAAGCATGAATGTGCAAGG + Intronic
1187410236 X:19044797-19044819 TCTCAAAGAGAGAATGTACATGG + Intronic
1188580032 X:31700355-31700377 GCTCAAAGTCACAATGTGTATGG + Intronic
1189105108 X:38227401-38227423 GGTTAAAGTAAGAATGTTCAAGG + Intronic
1189438959 X:41017480-41017502 AATCAAAGGAAGAATGTGGGAGG - Intergenic
1191615917 X:63168974-63168996 GGACAAAGGAAGTATGGGCATGG + Intergenic
1191620381 X:63209949-63209971 GGACAAAGGAAGTATGGGCATGG - Intergenic
1192493651 X:71598433-71598455 GCTGGAAGGAAGAATGAGCCAGG - Intronic
1195539593 X:106047522-106047544 GCTAAAGGCAAAAATGTGCAAGG - Intergenic