ID: 1156390638

View in Genome Browser
Species Human (GRCh38)
Location 18:36647667-36647689
Sequence CAAAATAGCCCCAAATTGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 294
Summary {0: 1, 1: 0, 2: 3, 3: 19, 4: 271}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156390636_1156390638 16 Left 1156390636 18:36647628-36647650 CCAGAAGACATGTACTACACTGT 0: 1
1: 0
2: 2
3: 17
4: 202
Right 1156390638 18:36647667-36647689 CAAAATAGCCCCAAATTGAAGGG 0: 1
1: 0
2: 3
3: 19
4: 271

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156390638 Original CRISPR CAAAATAGCCCCAAATTGAA GGG Intronic
901118554 1:6869710-6869732 CAAAATGGCTCCAAATGAAATGG - Intronic
901620669 1:10583600-10583622 TAAAATAACCCCAAATGCAATGG + Intronic
901828166 1:11876013-11876035 CAAATTAGCCCCAAATTACTTGG - Intergenic
902128797 1:14240538-14240560 CCAAATATCCCCAAATTAAGGGG + Intergenic
903027354 1:20438830-20438852 CAGATTATCCCCAAATTGAATGG - Intergenic
903568766 1:24288649-24288671 TAAAATAGCCCCTAAGTGTAGGG - Intergenic
908173030 1:61526817-61526839 AAAAGTAGCTCCATATTGAAGGG - Intergenic
908424170 1:63989448-63989470 CAGAGTAGCCCTAAATTTAATGG - Intronic
909492490 1:76240785-76240807 CAAAATGACCCCAAATTAAATGG - Intronic
909986733 1:82170400-82170422 CAAAATATACCCACATAGAATGG - Intergenic
910801484 1:91151761-91151783 CATAATAGCTCCAAATTCAGAGG + Intergenic
910818666 1:91321133-91321155 AAAAATAGCCTTAAATTAAAAGG + Intronic
911371358 1:96998489-96998511 CAAACTACCCCCAAATTCAGTGG + Intergenic
911965712 1:104367494-104367516 CAAACTATCCCCAAATTAAAGGG - Intergenic
912608888 1:111022522-111022544 CAAAAAAGCCCCATACTGGATGG + Intergenic
913152545 1:116059385-116059407 AATAATAGCCCCAAACTGGATGG + Intronic
914959541 1:152194281-152194303 CAAAATGGACCCATATTGAAGGG - Intergenic
916300749 1:163271278-163271300 CAAACTAACCCCCAATGGAATGG + Intronic
917468726 1:175307712-175307734 CACAATAGCCCCACATAGGAAGG - Intergenic
920586031 1:207161985-207162007 AAATATAGACTCAAATTGAAGGG + Intergenic
920753920 1:208709204-208709226 CAAAGAACCCCCAAATTTAATGG + Intergenic
922359232 1:224805750-224805772 CAAACTAGCCCCAGATTTAGTGG - Intergenic
922772762 1:228196821-228196843 ATAAATAACCACAAATTGAATGG + Intergenic
924037279 1:239950159-239950181 CCAAATGGCCCCAAAGTCAAAGG - Intergenic
1063444812 10:6105107-6105129 TAAAATATCCCCAAATCCAAAGG - Intronic
1064332055 10:14403118-14403140 CAAATTACCCCCAAATTGGTGGG - Intronic
1064595279 10:16938258-16938280 CAAAATAGCCAAAACTTGTAGGG + Intronic
1065116620 10:22489430-22489452 CAAAATACCCTCAAATTGTGTGG - Intergenic
1065116627 10:22489487-22489509 CAAAATACCCTCAAATTGTGCGG - Intergenic
1065295563 10:24271177-24271199 AAAATAAGTCCCAAATTGAATGG - Intronic
1066969732 10:42303312-42303334 TAAAATGGGCCCAAATGGAATGG - Intergenic
1068127333 10:52856653-52856675 GAAAATAGCAGAAAATTGAATGG - Intergenic
1068671804 10:59730607-59730629 CAAAATCTCCCCAGATTAAATGG + Intronic
1069169855 10:65213180-65213202 CAAATTACCCCCAAATTCATCGG + Intergenic
1070005343 10:72418996-72419018 CAAAAGAGCTCTAAAATGAAAGG - Intronic
1070301105 10:75204106-75204128 CAAATTGCCCCCAAATTTAATGG - Intergenic
1070845734 10:79521660-79521682 CAGATTAGCCCGAAAGTGAATGG + Intergenic
1070960449 10:80496205-80496227 CAAAATAATCCCAAGTAGAAAGG - Intronic
1071452823 10:85815000-85815022 CAAAATACCAGCAAACTGAAAGG + Intronic
1073216294 10:101838551-101838573 CAAAATAGCCCCAACGTCTAGGG - Intronic
1075804491 10:125175848-125175870 CCAAAATGCCCCAAATTCAACGG + Intergenic
1078939824 11:15989921-15989943 CAAAAAAGCACCAGATAGAATGG + Intronic
1079359302 11:19757131-19757153 TAAAATAGCCCCACATTAGATGG - Intronic
1079908940 11:26285004-26285026 CAAAATAGTTCCAAATTGGCAGG - Intergenic
1079960615 11:26918839-26918861 GAAAATATCCTCAAACTGAAGGG + Intergenic
1080935965 11:36863826-36863848 CAAAAGTGTCACAAATTGAATGG + Intergenic
1081455608 11:43219539-43219561 CATAATGGCCCCAAAGTGCAAGG - Intergenic
1085214723 11:74818842-74818864 CAAAAAAGCCCCAAAATGAAAGG - Intronic
1088074126 11:105825779-105825801 CAAAAGAGCCACAAATAGAGAGG - Intronic
1090109773 11:123894393-123894415 CAAAATAGTGAGAAATTGAAAGG + Intergenic
1090298613 11:125613331-125613353 CAAAAGATCCCAGAATTGAATGG - Intronic
1090780091 11:130000429-130000451 CAATATAATCCCAAATTGATTGG - Intronic
1094368212 12:29706753-29706775 CAAAAAATACCCACATTGAATGG - Intronic
1097685075 12:62683723-62683745 CAAACTGGCCCCAAATAGAGAGG + Intronic
1098924587 12:76335161-76335183 CAAATTATCCCCAAATTTAGTGG - Intergenic
1099418644 12:82425001-82425023 CAAAATAACCACAAACTGGATGG - Intronic
1099432962 12:82609982-82610004 TATAATATCCCCAAAATGAAAGG - Intergenic
1102606378 12:114070878-114070900 CAAAATCTCCCCAGATTAAATGG - Intergenic
1103266321 12:119633608-119633630 TAAAAGAGACCCAAATTTAAAGG + Intronic
1105611610 13:21974104-21974126 CAAATTACCCCCAAATTTAAGGG - Intergenic
1106803411 13:33280359-33280381 AAAAATAGCCTCAGATAGAATGG + Intronic
1107215726 13:37916393-37916415 CAAAGTAGCCACAATTTGATAGG - Intergenic
1107967199 13:45608001-45608023 CAAAATATGCCATAATTGAAAGG - Intronic
1108117822 13:47149429-47149451 CAAAATAGTCTCAAAATAAAGGG - Intergenic
1109012128 13:56964026-56964048 TAAAATAGCCACAAATCTAAGGG - Intergenic
1109726042 13:66343216-66343238 CAAATTACTCCCAAATTGAGTGG + Intronic
1109744599 13:66607022-66607044 CAAAATAGTCCAAAATTGACTGG + Intronic
1110644506 13:77866910-77866932 CAAGATAGCTCTAACTTGAATGG + Intergenic
1112044770 13:95585300-95585322 CCGAATAGCCCCCAACTGAAAGG + Intronic
1112534142 13:100233514-100233536 CTATATAGCTCCAAATTCAATGG - Intronic
1112970674 13:105258542-105258564 CAAAGTACCCCCAAATTTACTGG + Intergenic
1113208435 13:107945020-107945042 CAAAAAAGCCCCAAATCGGATGG + Intergenic
1114236095 14:20824975-20824997 CAAAATCTCCCCAGATTAAATGG + Intergenic
1114585816 14:23812568-23812590 CAAAATTGTCCAAAATGGAAAGG - Intergenic
1118794112 14:69124317-69124339 CAGTATATACCCAAATTGAAAGG - Intronic
1119140867 14:72266014-72266036 CAAACTATCCCCAAATCTAACGG + Intronic
1119163633 14:72473988-72474010 TAAATTAGCCCTAAATAGAAGGG + Intronic
1119206968 14:72801715-72801737 GAAAATAGCCCCATACTAAATGG + Intronic
1120750823 14:88196480-88196502 AAAAATAGCCCACAAATGAATGG - Intronic
1120873107 14:89355643-89355665 CAAACTAGAACCAAATAGAATGG + Intronic
1121787959 14:96676928-96676950 CAAACTATCCCAAAATTGCATGG - Intergenic
1123821583 15:24036014-24036036 CGCAATAGCCCCAGAATGAAGGG + Intergenic
1125926312 15:43566075-43566097 CAAGATGGACACAAATTGAAGGG + Intronic
1125939456 15:43665625-43665647 CAAGATGGACACAAATTGAAGGG + Intronic
1126650571 15:50917423-50917445 GAAAATGGCCCAAAGTTGAAGGG - Intronic
1127449182 15:59100252-59100274 CAAACCACCCCCAAATTGAGTGG + Intergenic
1127605181 15:60579679-60579701 CAAAATACCCCCAAAGTGAAAGG - Intronic
1128572606 15:68746190-68746212 CAAAATACACCCAAAGTAAATGG + Intergenic
1130363652 15:83212915-83212937 CAAAACAGCCCCAAATTTTGTGG - Intergenic
1130827451 15:87564252-87564274 CTAGTTAGCCCCAAATTGAAAGG + Intergenic
1130852847 15:87814599-87814621 CATAATAACCCCAAACTGGAAGG + Intergenic
1130884297 15:88080691-88080713 CCAAAGAGCCCCAGATTGGAAGG + Intronic
1131955346 15:97729451-97729473 CAATACAGCCCAAAGTTGAAAGG - Intergenic
1134348915 16:13418251-13418273 CAAAACAGCCCCAAACTTAGTGG + Intergenic
1136065863 16:27758082-27758104 CAGAACAGCCCCAAATTAGATGG + Intronic
1138987015 16:62341837-62341859 CAATAGAGTCCCAAAGTGAAAGG - Intergenic
1141552465 16:84815329-84815351 GAAAAAAGCCCCAAATTTAGTGG - Intergenic
1142733085 17:1875892-1875914 CCAAATACCACCAAATAGAATGG + Intronic
1148244567 17:46021950-46021972 CCAAAAATCCCCAAACTGAAAGG - Intronic
1149787128 17:59445131-59445153 CTAAATAGCCCCAAATAGAAAGG - Intergenic
1153161820 18:2214987-2215009 CAAAATAGACCCAAACTAAGTGG + Intergenic
1155746202 18:29358690-29358712 CAAAATCTCCCCAGATTAAATGG + Intergenic
1156390638 18:36647667-36647689 CAAAATAGCCCCAAATTGAAGGG + Intronic
1156541995 18:37921694-37921716 CAAAAAAAGCCCTAATTGAATGG + Intergenic
1157238199 18:45983733-45983755 CCAAATTTCCCCAAACTGAACGG - Exonic
1157699188 18:49749495-49749517 TAAAATAGACCCAAACTGGAAGG - Intergenic
1157852631 18:51070850-51070872 CATAATGGCCCCAAAGTGCAAGG + Intronic
1158467990 18:57708501-57708523 CAAATTACCACCAAATAGAATGG - Intronic
1158997681 18:62939923-62939945 CAGAATAGTCCTGAATTGAATGG + Intronic
1159084584 18:63774289-63774311 CAAAATTGCACAAAATTGAGAGG + Intronic
1159190970 18:65041569-65041591 CCAAATAGCCCCACGTTTAATGG - Intergenic
1159727776 18:71983892-71983914 TAAAAGAGACCCATATTGAATGG - Intergenic
1159855453 18:73582604-73582626 CAAATAAGCCCAAAATTCAAGGG + Intergenic
1162281892 19:9705397-9705419 CGAAATCTCCCCAAATTAAATGG - Intergenic
1164121575 19:22269992-22270014 CAAAATTTCCCCAGATTAAATGG + Intergenic
1164843042 19:31408682-31408704 CAAAATAACCCAACACTGAATGG - Intergenic
1164976500 19:32576810-32576832 CAAAATTGCCCAAAAGTTAAAGG + Intergenic
1165555719 19:36630185-36630207 GAAAATAGCCCCCAAAAGAAAGG + Intergenic
1166534186 19:43561810-43561832 TAAAAGAGCCCCAAACTGGAAGG - Intronic
926992980 2:18699789-18699811 CATGATAGCCCCAAAGTGCAAGG + Intergenic
927105640 2:19821361-19821383 CAAAAGTGTCCCAATTTGAATGG - Intergenic
927228354 2:20793828-20793850 CTAAATAGCCCTAAATTGATTGG + Intronic
927282292 2:21319823-21319845 CAGAGTAGCCCCATATTGGAGGG - Intergenic
927435431 2:23062148-23062170 CAATAAAGCACCAAATTTAAGGG - Intergenic
927625914 2:24718533-24718555 CAAAATAGCCCCAAACTGGGTGG + Intronic
927728216 2:25444939-25444961 CAAAATAAACCCAAGATGAAAGG + Intronic
928734260 2:34267374-34267396 CAAAAAAGCCCCAGATCAAATGG - Intergenic
929741306 2:44603478-44603500 CAAAATACCCCAAAATTTAGTGG + Intronic
932124355 2:69130064-69130086 AGAAATGTCCCCAAATTGAAAGG - Intronic
932142797 2:69294504-69294526 CAAAATATTCCCAATTTGATGGG - Intergenic
933939788 2:87235595-87235617 CACAATAGCCCCCAAATTAAAGG - Intergenic
935660339 2:105461269-105461291 CAAAATAGCCCCAGGCTGGAAGG - Intergenic
935721493 2:105983242-105983264 CAAAATTTCCCCAGATTAAATGG + Intergenic
936353350 2:111730178-111730200 CACAATAGCCCCCAAATTAAAGG + Intergenic
938314596 2:130317195-130317217 CAAAATAACCCCAAATGGGATGG + Intergenic
938703156 2:133897370-133897392 CAAAATCTCCCCAGATTAAATGG - Intergenic
939651576 2:144768881-144768903 AAAAATAACTCCAAATTGCAAGG + Intergenic
939699482 2:145372420-145372442 CAAATTATCCCCAAACTTAATGG + Intergenic
942148569 2:173051369-173051391 AAAAATGGCACCAAATTAAAAGG - Intronic
944082222 2:195800803-195800825 TAAAAAAGCCTCAAAATGAAAGG + Intronic
944462237 2:199962161-199962183 CAAACTACCCCCAAATTCATTGG + Intronic
944919161 2:204393069-204393091 CAAAATACAGCCAAATTGAAAGG - Intergenic
945289734 2:208115397-208115419 CAAAATTTCCCCAGATTAAATGG - Intergenic
945290948 2:208126918-208126940 CAAAATGGGCTCAAATTTAAAGG - Intergenic
945564863 2:211384826-211384848 CAAAATAGGCACTAATTGACTGG - Intronic
946435858 2:219652950-219652972 CAAACTAAACCCAAAGTGAACGG + Intergenic
947039089 2:225894684-225894706 CAAAATAATCCCAAATAAAATGG + Intergenic
947447371 2:230174367-230174389 CAAAATAAGCCCACTTTGAATGG + Intronic
948526964 2:238576799-238576821 CAAACTATCCCCAAATTTAGTGG + Intergenic
1169566557 20:6859559-6859581 AAAAATAGGCACAAAGTGAATGG + Intergenic
1169750910 20:8993738-8993760 TAAAATAGCTCCAAGTTGACTGG + Intergenic
1170418169 20:16166620-16166642 GAAAAGAGCCTCAAAGTGAAAGG + Intergenic
1170700875 20:18702339-18702361 CCAAATAGCACCCAACTGAAGGG - Intronic
1170716963 20:18840241-18840263 TAAAATTGCCCCGAATTGGAAGG + Intergenic
1174633575 20:51979543-51979565 AGAAATAGCCACAAACTGAATGG - Intergenic
1174673641 20:52332227-52332249 CAAACAAGCCCCAAATAGCAGGG + Intergenic
1176748808 21:10674609-10674631 TAAAATGGACCCAAATGGAATGG - Intergenic
1176916528 21:14632604-14632626 CAAATTACTCCCAAATTTAATGG + Intronic
1178444705 21:32628143-32628165 CTAAAGAGACCCAAATTAAAAGG - Intergenic
1178745989 21:35250767-35250789 CAACGTAACCCCACATTGAAAGG - Intronic
1179967202 21:44814144-44814166 CAAAATAACCGCGACTTGAATGG + Intronic
949172229 3:1014552-1014574 CAAAGGAGCCCCAATTAGAATGG + Intergenic
950252541 3:11478666-11478688 GAAAAAAGCCCCAAAAGGAAAGG + Intronic
951341416 3:21492331-21492353 CAAAGTGCCCACAAATTGAATGG + Intronic
952860512 3:37808567-37808589 CAAACTGCCCCCAAATTGAATGG + Intronic
953155535 3:40368863-40368885 CAAAATACCCCCAGACCGAATGG + Intergenic
957178910 3:76850803-76850825 CATAATATCCTAAAATTGAATGG - Intronic
957539881 3:81554093-81554115 CAAAATGGCCTCAAAATGACTGG - Intronic
957999928 3:87737707-87737729 CAAAATCTCCCCAGATTAAATGG + Intergenic
963267596 3:143254527-143254549 CAAACTACCCCCAAATTTAGTGG + Intergenic
963307767 3:143672952-143672974 CATAGTAACCCCAAATAGAAAGG + Intronic
964401249 3:156301554-156301576 CTAAAGAGACCCAAATAGAAAGG + Intronic
964829482 3:160867818-160867840 CAAAAAAGTTCCAAATTAAAAGG - Intronic
965332644 3:167395739-167395761 CAAAATAAGCTAAAATTGAAGGG - Intergenic
967545909 3:190727778-190727800 CTAAATATTCCCAAATTCAAGGG + Intergenic
968864331 4:3198192-3198214 CAACACATCCCCAAAGTGAAAGG - Intronic
968874752 4:3260369-3260391 CAAAACACCCCCAAAGTGGACGG - Intronic
971050283 4:22854462-22854484 CAACATAGCCCCAAATTTCTTGG + Intergenic
971129927 4:23796457-23796479 CAAATTCTCCCCAAATTGGAAGG + Intronic
971392154 4:26196151-26196173 CATAATAGCCCCAAAGTAGAGGG + Intronic
972081278 4:35153354-35153376 AAATATAGCTCCAAATTGAGAGG - Intergenic
972159791 4:36209459-36209481 CAAAACACCCCGAAATTGTATGG - Intronic
972784979 4:42318350-42318372 CAAAATCTCCCCAGATTAAATGG - Intergenic
973189240 4:47368217-47368239 ATAAATATCCTCAAATTGAAGGG + Intronic
974286574 4:59876724-59876746 AGAAGTAGCCCCAGATTGAAAGG + Intergenic
974300484 4:60059510-60059532 CAAATTACCCCAAAATTTAAAGG - Intergenic
975502731 4:75104606-75104628 CAAACTACCCCCAAATTCAGTGG - Intergenic
976020356 4:80616450-80616472 AATAATACCCCCAAACTGAAAGG + Intronic
976135382 4:81930495-81930517 CAAAAAAGCCCTAAATTAACTGG + Intronic
976388634 4:84486790-84486812 CAAATTATCCCAAAATTTAATGG + Intergenic
976904984 4:90226276-90226298 CAAAACACTCCCAAATTTAATGG - Intronic
977863786 4:101999221-101999243 CAAAATATGCCCAAACTGGAGGG - Intronic
977966266 4:103152589-103152611 CAAAATAGCCAAATACTGAACGG + Intronic
979288821 4:118957336-118957358 CAACATGGCCCCCAATTGCATGG - Intronic
979530657 4:121765971-121765993 CAAATTACCCCCAAATTTAGTGG + Intergenic
979987346 4:127331356-127331378 CAAATCACCCCAAAATTGAATGG - Intergenic
981195056 4:141909630-141909652 AAAAATTACCACAAATTGAATGG - Intergenic
982030779 4:151298495-151298517 CAAATTAGCTACAAATTTAATGG - Intronic
982385963 4:154802823-154802845 CAAAATAGCATCACACTGAAAGG - Intronic
985519513 5:366818-366840 CCAGACAGACCCAAATTGAAGGG + Intronic
987278114 5:16384021-16384043 CAAATTACCCCCAAACTTAATGG + Intergenic
987598576 5:20035197-20035219 AAAAAAATCCCCAAATTTAATGG - Intronic
988013228 5:25517804-25517826 CAAAATAGCTCCAACTCTAATGG + Intergenic
989613536 5:43317465-43317487 CAAAATCTCCCCGAATTAAATGG + Intergenic
989800853 5:45537065-45537087 AAAAAGAGCCACAAATTTAAAGG - Intronic
991307859 5:65199611-65199633 CAAAATAGCCCTGAAATTAAAGG - Intronic
993570591 5:89534069-89534091 CAAATTAACCCCAAATGTAATGG + Intergenic
993795039 5:92256520-92256542 GAAAATAGGCAGAAATTGAATGG + Intergenic
994294321 5:98071068-98071090 CAAAATAGCACGAAAGTGATGGG + Intergenic
994565236 5:101437392-101437414 CAAAATACCTCCAAATTCAATGG + Intergenic
995147384 5:108801830-108801852 AATAATAGCCCCAAACTGCAAGG - Intronic
997567847 5:134903468-134903490 CAAAGTAGCCCAAAATTCACGGG - Intergenic
999533994 5:152496793-152496815 CAAAATAGCTAGAAAGTGAAGGG - Intergenic
1000036478 5:157452329-157452351 GAAGATAGGCCCAAATGGAAAGG + Intronic
1000745261 5:165025193-165025215 CAAAATAGCCCCACACTAAATGG + Intergenic
1000996863 5:167968212-167968234 CAGAATGGCCCCAAATTGTCTGG - Intronic
1005818926 6:29580816-29580838 CAAAGTCTCCCCAAATTTAATGG - Intronic
1008137707 6:47795840-47795862 CAGATAAGCCCCAAATTGATGGG - Intronic
1008209425 6:48702645-48702667 CTAAATAGCCCCAAATGTATTGG - Intergenic
1008385401 6:50883662-50883684 CAAAATAGACCAAACCTGAAAGG + Intergenic
1009242628 6:61200086-61200108 CATAATAGCCCAATATTGGAGGG - Intergenic
1009850255 6:69187927-69187949 CAGAATGACCCCAAATTAAAGGG - Intronic
1010499891 6:76584548-76584570 CAAATTACCCCAAAATTTAATGG - Intergenic
1013700609 6:112764998-112765020 CAAGTTAGCCCCATATTGACAGG + Intergenic
1013792927 6:113856796-113856818 TTAAATCGTCCCAAATTGAAAGG - Intergenic
1014302256 6:119696343-119696365 CATGGTAGCCCTAAATTGAAAGG - Intergenic
1014363017 6:120504139-120504161 CAAAATAGGTCAAAAATGAAAGG - Intergenic
1015971622 6:138748432-138748454 CAAAATAACCACAAATTTAGTGG + Intergenic
1016405435 6:143724706-143724728 CAAAAAAGCCCCATTTTTAAAGG - Intronic
1016799089 6:148150488-148150510 GAAAATAGCCCCTTTTTGAATGG - Intergenic
1017273877 6:152542291-152542313 CAAAATTTCTCCAAATTAAAAGG - Intronic
1019234721 6:170600992-170601014 CAAAATATCCCCAAATTCCTGGG + Intergenic
1020571852 7:9873237-9873259 GAAAATAGACCCTAATAGAAAGG + Intergenic
1021706614 7:23374193-23374215 CAAAATAGCCAATAATTGAAAGG + Intronic
1021919846 7:25473935-25473957 CAAACTGGCCCCAAATTCACAGG + Intergenic
1022328440 7:29354919-29354941 AAATAAAGCCCCAAACTGAAAGG - Intronic
1024372680 7:48605096-48605118 CAAAATAGGCTCAAAATAAAGGG - Intronic
1026138397 7:67683561-67683583 CAAATTACCCCCAAATTTAGTGG - Intergenic
1026979601 7:74518581-74518603 CAAAATAGCACCAAAGTGGTCGG + Intronic
1027196777 7:76036061-76036083 CAGAATAGCACCAAATGGGATGG - Intronic
1030774927 7:113522818-113522840 CAAAATAGGACCAAATAGGAAGG + Intergenic
1031588935 7:123566386-123566408 CAAAAGTGCCACAAATTGAGTGG - Intergenic
1032170548 7:129581087-129581109 CAAAATCTCCCCAGATTAAATGG - Intergenic
1032342088 7:131083281-131083303 CAAATTATCCCCAAATTTATTGG - Intergenic
1032621907 7:133542691-133542713 GACAATACCCCCAAAATGAAGGG - Intronic
1033437974 7:141351527-141351549 CAAAATCAGCCCACATTGAAGGG + Intronic
1035513894 8:215143-215165 CAAAATATCCCCAAATTCCTGGG - Intergenic
1037604898 8:20429838-20429860 CAAATTAAACCAAAATTGAAAGG - Intergenic
1041618623 8:59937991-59938013 TAAAGGAGCCCCAAATAGAAAGG - Intergenic
1041777225 8:61536679-61536701 CAGAATAGCCCCAAATAGCCAGG - Intronic
1043118331 8:76288301-76288323 TAACATAGCCACAAAATGAAAGG + Intergenic
1043241443 8:77940087-77940109 CATAAAAGCATCAAATTGAAAGG - Intergenic
1044230139 8:89765190-89765212 TAAAATAGCACCAATTTGATAGG - Intronic
1044888834 8:96810159-96810181 CAAATGAGCCCCAATGTGAAAGG - Intronic
1045346284 8:101296795-101296817 CAAACTACCCCCAAATTTAGAGG + Intergenic
1046564102 8:115876545-115876567 GAAAATAACCCCACATTGGAAGG + Intergenic
1047724757 8:127674417-127674439 CAAACTACCCCCAAATTTAATGG + Intergenic
1047819897 8:128507317-128507339 TAAATTACCCTCAAATTGAAGGG + Intergenic
1048560784 8:135535059-135535081 CAAACTACTGCCAAATTGAATGG - Intronic
1049062513 8:140286972-140286994 CAAAAGAGACCCAAACAGAAGGG + Intronic
1050847305 9:10238145-10238167 CAAAATGACCCCAATTTGTATGG - Intronic
1051800310 9:20925293-20925315 AAAAATAACACCAAAGTGAAGGG - Intronic
1053649449 9:40149787-40149809 CATAATAGCCTCTAATGGAATGG - Intergenic
1054535132 9:66226386-66226408 CATAATAGCCTCTAATGGAATGG + Intergenic
1054853138 9:69869744-69869766 AAAAAAAACCCCAAATTGAGTGG + Intronic
1056986546 9:91368713-91368735 CAAAATAACCCCAAAATGATGGG + Intergenic
1057992963 9:99791968-99791990 CATACTAGCCTCAAACTGAAAGG - Intergenic
1058447928 9:105070190-105070212 CAAAATAGGACCAAACTGCATGG - Intergenic
1059016614 9:110523809-110523831 CAAAATAAACCCAAATTAGAGGG + Intronic
1060435066 9:123586184-123586206 CCAAATAGTCCCAAACAGAAGGG + Intronic
1061620986 9:131811172-131811194 CTAAATGGCCCCAAAATGCACGG - Intergenic
1185941220 X:4321696-4321718 GGAAATAGCACCAAATCGAAAGG - Intergenic
1186251673 X:7674163-7674185 CAAAAAAACCACAAATTGACAGG + Intergenic
1188263450 X:28042696-28042718 CGAAATAGACTCAAACTGAAAGG + Intergenic
1188713859 X:33436311-33436333 CAAAATACCCCCAAATACAAGGG + Intergenic
1189177778 X:38975254-38975276 CAAATCAACCCCAAATTTAATGG + Intergenic
1189408912 X:40752107-40752129 CACAATAGCCCCAAAAGCAAAGG - Intergenic
1189452473 X:41150121-41150143 CAAAATAACCCCAAACTTGAGGG + Intronic
1189783037 X:44534471-44534493 GAAAATTTCCCCAAACTGAAAGG + Intronic
1190527431 X:51342130-51342152 CAAAATAGGCCCACCTTGAGTGG - Intergenic
1191891644 X:65949586-65949608 CAAAAAATCCCCGAATTCAAAGG - Intergenic
1193717325 X:84948314-84948336 CAAAATTTCCCCAGATTAAATGG - Intergenic
1194146713 X:90275350-90275372 CAATTTACCCCTAAATTGAAAGG + Intergenic
1195247903 X:103012976-103012998 TAAAATAGCCCTAAAATAAAAGG + Intergenic
1196460064 X:115920401-115920423 CAAAATTTCCCCAGATTAAATGG - Intergenic
1196668564 X:118342467-118342489 AAAAATACCCTCAAATTAAATGG - Intergenic
1197422854 X:126259298-126259320 CAAACTAGCCCAAAATTTAGTGG - Intergenic
1197565883 X:128085430-128085452 CAAAATGGCCACCAATGGAAGGG - Intergenic
1198558378 X:137821184-137821206 CCAAATAGCCACAACTTGATTGG - Intergenic
1199818996 X:151425902-151425924 CAAATTAGCCCAAAACTGAGTGG - Intergenic
1201199601 Y:11527520-11527542 CTAAATGGACACAAATTGAATGG + Intergenic
1201923648 Y:19261475-19261497 CAAACAAACCCTAAATTGAAGGG - Intergenic
1202613657 Y:56701474-56701496 CAAAATAGGATCAAATGGAATGG + Intergenic
1202614910 Y:56712141-56712163 CAAAATAGGATCAAATGGAATGG + Intergenic