ID: 1156391029

View in Genome Browser
Species Human (GRCh38)
Location 18:36650877-36650899
Sequence GTGGAGTCAGAGACTCTTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156391029_1156391034 18 Left 1156391029 18:36650877-36650899 CCTGGAAGAGTCTCTGACTCCAC No data
Right 1156391034 18:36650918-36650940 ATCCTTTACCAGAGACCATTAGG No data
1156391029_1156391031 -6 Left 1156391029 18:36650877-36650899 CCTGGAAGAGTCTCTGACTCCAC No data
Right 1156391031 18:36650894-36650916 CTCCACAAAGTGATGCCAGAGGG No data
1156391029_1156391030 -7 Left 1156391029 18:36650877-36650899 CCTGGAAGAGTCTCTGACTCCAC No data
Right 1156391030 18:36650893-36650915 ACTCCACAAAGTGATGCCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156391029 Original CRISPR GTGGAGTCAGAGACTCTTCC AGG (reversed) Intronic