ID: 1156392025

View in Genome Browser
Species Human (GRCh38)
Location 18:36659793-36659815
Sequence GGGGCTTCCCTTTCAGAACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 137}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156392025_1156392037 25 Left 1156392025 18:36659793-36659815 CCAGGTTCTGAAAGGGAAGCCCC 0: 1
1: 0
2: 1
3: 9
4: 137
Right 1156392037 18:36659841-36659863 GGAATCCCAGGTCCAGGTTTGGG 0: 1
1: 0
2: 0
3: 19
4: 194
1156392025_1156392036 24 Left 1156392025 18:36659793-36659815 CCAGGTTCTGAAAGGGAAGCCCC 0: 1
1: 0
2: 1
3: 9
4: 137
Right 1156392036 18:36659840-36659862 TGGAATCCCAGGTCCAGGTTTGG 0: 1
1: 0
2: 2
3: 22
4: 196
1156392025_1156392030 4 Left 1156392025 18:36659793-36659815 CCAGGTTCTGAAAGGGAAGCCCC 0: 1
1: 0
2: 1
3: 9
4: 137
Right 1156392030 18:36659820-36659842 TCTGCCCGCTTTTCTGCCACTGG 0: 1
1: 0
2: 1
3: 15
4: 117
1156392025_1156392034 19 Left 1156392025 18:36659793-36659815 CCAGGTTCTGAAAGGGAAGCCCC 0: 1
1: 0
2: 1
3: 9
4: 137
Right 1156392034 18:36659835-36659857 GCCACTGGAATCCCAGGTCCAGG 0: 1
1: 0
2: 1
3: 23
4: 382
1156392025_1156392033 13 Left 1156392025 18:36659793-36659815 CCAGGTTCTGAAAGGGAAGCCCC 0: 1
1: 0
2: 1
3: 9
4: 137
Right 1156392033 18:36659829-36659851 TTTTCTGCCACTGGAATCCCAGG 0: 1
1: 0
2: 2
3: 15
4: 227

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156392025 Original CRISPR GGGGCTTCCCTTTCAGAACC TGG (reversed) Intronic
900528167 1:3139340-3139362 GGGGCTGCCCTTTGGGACCCTGG + Intronic
900869824 1:5293952-5293974 CGGGCTTCTATTTAAGAACCAGG - Intergenic
901226346 1:7614914-7614936 GGGGTCTCCTGTTCAGAACCAGG + Intronic
901556222 1:10033147-10033169 GGGGCTTCCCTTACAGTGCTGGG + Intronic
902766627 1:18620708-18620730 GGCCCTACCCTTTCAGAACATGG + Intergenic
904471607 1:30739931-30739953 TGGGCCTACCTTTCAGAACCGGG - Exonic
905583387 1:39099025-39099047 GGGGCTGCCCCTTCAGTGCCTGG + Intronic
905658714 1:39703313-39703335 GGGGCTAGCCTTTCAGATCTTGG + Intronic
908478949 1:64518028-64518050 CAGGCTTCCCTTACTGAACCAGG + Intronic
911145121 1:94544123-94544145 GGGGCTTTCCTTCCATCACCAGG + Intergenic
915736850 1:158090534-158090556 GGGGCTTTCCTTGCAGATCTAGG + Intronic
915737085 1:158091790-158091812 GGGGCCTTCCCTCCAGAACCTGG + Intronic
917595018 1:176520400-176520422 GTGGCTTAACTGTCAGAACCTGG - Intronic
917967151 1:180186122-180186144 GGCGCTGCCCTTCCAGGACCGGG - Exonic
918968629 1:191383020-191383042 GGGGCTTCCAGTTCACAAGCAGG - Intergenic
920631793 1:207659732-207659754 GGGACTTCCCTTTCCTAGCCAGG + Intronic
921209647 1:212883186-212883208 TGTCATTCCCTTTCAGAACCTGG - Intronic
923008077 1:230067593-230067615 GGGGCCGCCCTTTCGGAGCCCGG - Intronic
924810723 1:247399418-247399440 GGAGCTTCTCTTTCAGAGCTGGG - Intergenic
1065300334 10:24315330-24315352 AGGGTTTCCCTTTCTGAAGCGGG - Intronic
1070161519 10:73869471-73869493 GGGTCCTCCCTTTCTGATCCAGG - Intronic
1077492964 11:2870545-2870567 TCTGCTTCCCTTTCAGAGCCGGG + Intergenic
1077523729 11:3051382-3051404 GGGGCTTCCCTCTGAGAAGAAGG + Intronic
1077638401 11:3859394-3859416 GGGGCTTGCGTTTCTGAAGCTGG + Intronic
1078208695 11:9252686-9252708 GAGGCTTGCCTTTCAGAAGCTGG - Intronic
1078926778 11:15882191-15882213 GGGGGTGCCCTCTCTGAACCTGG + Intergenic
1081167428 11:39823040-39823062 GGGTCTTCCCTGTCAGCCCCAGG + Intergenic
1084661587 11:70549577-70549599 GTGGCTCCCCTCTCAGAAGCTGG + Intronic
1085040236 11:73322594-73322616 GGGGCTTCCCTTTCCTGCCCTGG - Intronic
1085518597 11:77125415-77125437 GGGACTTCCCCTCAAGAACCTGG + Exonic
1088549031 11:110991677-110991699 AAGGCTTCCCTTTGAGAACTTGG + Intergenic
1101310636 12:103575521-103575543 CGGGCTTCCCTCAGAGAACCAGG - Intergenic
1108227327 13:48303435-48303457 GAGTCTTCCCTATCAGACCCCGG + Intergenic
1109030745 13:57184488-57184510 GTTGCTTCCCTTTCATAAGCAGG + Intergenic
1109982876 13:69933598-69933620 GTAGCTGCCCTTTCAGAATCTGG - Intronic
1110433981 13:75458879-75458901 TGGCCTTCCCTTTCAGACCTAGG + Intronic
1113663796 13:112126579-112126601 GAGGCTTCACTTTCATGACCTGG - Intergenic
1113778523 13:112962711-112962733 GGGCCTTCCCTCCCAGAGCCTGG - Intronic
1114657324 14:24323989-24324011 AGGGGTTCCCTTTCAGTCCCTGG + Intronic
1115057891 14:29152959-29152981 CAAGCTTCCATTTCAGAACCAGG + Intergenic
1119777712 14:77258872-77258894 GGGGCTTCTCCCTCTGAACCTGG + Exonic
1122780704 14:104142277-104142299 GGGGCTTCCCCTCCACACCCAGG - Intronic
1125331555 15:38587595-38587617 GGGCCTTCCCTTTAAGAAATGGG + Intergenic
1127973455 15:63979966-63979988 AGGTCCTCCCTCTCAGAACCTGG + Intronic
1131820214 15:96264838-96264860 GGGGCTTGCCTTTTAGATCTGGG + Intergenic
1131876969 15:96818416-96818438 GGGGCTTTGCTTTCAGAATTAGG + Intergenic
1140829475 16:78738000-78738022 GGGGTTTCCCTGTCAGAGCCCGG + Intronic
1140876699 16:79159420-79159442 GGAGCTTCCCTTTCTGACCCTGG - Intronic
1141543103 16:84742026-84742048 GTGGCTTCCCTTTTAGATCTCGG + Intronic
1143183334 17:4997338-4997360 GGAGCTGCCCTCTCAGACCCGGG - Intronic
1143720678 17:8806921-8806943 TGTGCTTTCCTCTCAGAACCAGG - Intronic
1144670617 17:17130694-17130716 AGGGCTGCCCTTGCACAACCAGG + Intronic
1147599863 17:41738912-41738934 AGGCCTTCCCCTCCAGAACCAGG + Intergenic
1149524182 17:57341127-57341149 GGGGCTCCCCAGTCAGAACCAGG + Intronic
1150002157 17:61447759-61447781 GTGTCTTCCCATTCAAAACCAGG - Intergenic
1151877609 17:76876154-76876176 GGGGCTTCTCTTGCAGGATCAGG - Intronic
1152036446 17:77876047-77876069 GGGCCCTCCCTCTCAGACCCAGG + Intergenic
1152678115 17:81651852-81651874 GAGGCTTCCCTCACAGACCCAGG + Intronic
1152735031 17:81993007-81993029 GGGGCATCCCTTTCCCACCCAGG - Intronic
1152930109 17:83105000-83105022 GGGGCTCACCTTCCAGACCCGGG + Intergenic
1153407796 18:4759816-4759838 GGTGCTTACCTATCAGAATCTGG + Intergenic
1155368203 18:25070562-25070584 GGGGCTTGCCTTACACAAGCAGG + Intronic
1156392025 18:36659793-36659815 GGGGCTTCCCTTTCAGAACCTGG - Intronic
1160102419 18:75935430-75935452 GTGACTTCCCATTCAGGACCTGG - Intergenic
1160951041 19:1667567-1667589 GGGGCTCCCCTTACAGAGCCAGG - Intergenic
1160990285 19:1857614-1857636 GAGGCTTCCCTGTCGGAACCAGG - Intronic
1161367390 19:3888206-3888228 CCCTCTTCCCTTTCAGAACCAGG + Intronic
1163185044 19:15631917-15631939 GGGCCGCCCCTTTCAGCACCAGG + Intronic
1165601425 19:37058256-37058278 GGAGCTTCCCTGTCTGAAACAGG - Intronic
1167341172 19:48917347-48917369 GGGGCTTCCCTTTGTCACCCAGG + Intronic
925241084 2:2329057-2329079 CTGCCTTCCCTTTCAGCACCAGG - Intronic
925289577 2:2738467-2738489 GGGGCCTCTCGTTCAGAACAGGG + Intergenic
927784910 2:25967046-25967068 GGTGCTTTCCTGTCTGAACCTGG - Intronic
933865127 2:86509192-86509214 AAGGCTTCCCTCTCAGATCCTGG + Intronic
935375718 2:102394874-102394896 GGCATTTCCTTTTCAGAACCGGG + Intronic
935380893 2:102449939-102449961 GGAGCTTCCCTTTTGGTACCTGG + Intronic
938178896 2:129162263-129162285 GCTGCTTCCCTTTCAGACACTGG - Intergenic
938651568 2:133388944-133388966 GGGAATTCCCTTTCATAGCCAGG - Intronic
942152572 2:173091760-173091782 GGGTCTTGGCTTTCAGAGCCTGG + Intronic
942218083 2:173742007-173742029 CAGGCTGCCCTCTCAGAACCAGG - Intergenic
948629704 2:239294244-239294266 GGGGCAGCCCCTTCTGAACCTGG + Intronic
1169752176 20:9005523-9005545 GAGGCTTCCTTTTCTGAACTTGG + Intergenic
1169907983 20:10622851-10622873 GGGGCTTCCTGTTCAAAAGCTGG + Exonic
1170921534 20:20684118-20684140 AGGTCTCCTCTTTCAGAACCTGG + Intronic
1171457163 20:25278614-25278636 GGGCCCTCCCTTCCAGAACAAGG + Intronic
1173790377 20:45824241-45824263 GGGGCTTAGCAGTCAGAACCCGG - Intronic
1175547524 20:59788321-59788343 GGCGCTTCCCTTTCAGACTGAGG + Intronic
1175910138 20:62401346-62401368 GGTGCTTCCCTTCCAGAACCAGG + Intronic
1176088972 20:63310533-63310555 GGGGCCTCCCACCCAGAACCTGG - Intronic
1176307838 21:5133494-5133516 GGAGTCTCCCTTTCAGAGCCGGG - Exonic
1177589557 21:23145009-23145031 GGGGCTTCACTTACATAACAAGG - Intergenic
1179849223 21:44128536-44128558 GGAGTCTCCCTTTCAGAGCCGGG + Exonic
1180054696 21:45351769-45351791 GGGGCTCCCCACTCAGACCCCGG - Intergenic
1182090930 22:27594390-27594412 GGGGCTTTCCTTCCAGATCTTGG - Intergenic
1184645655 22:45893295-45893317 GGGGCCTACCTCTCAGACCCTGG + Intergenic
1184792679 22:46709508-46709530 GGGGTCTCCCTGTCAGCACCTGG + Intronic
1185094375 22:48798398-48798420 GGGGCCTCCCCTTCAGCCCCGGG - Intronic
950510142 3:13420740-13420762 GTGGCTTCCCTTTGCGAGCCCGG - Intergenic
966820189 3:183917910-183917932 GGAGCTCCCCTTTGAGAACAGGG + Intergenic
968605961 4:1535856-1535878 GGGGCCTCCGTTTGAGAACTGGG - Intergenic
969696155 4:8735990-8736012 GGGGCTGCTCTTTCTGAAGCTGG + Intergenic
969883940 4:10198521-10198543 GGGGCTTACCTTTCAGTGCTGGG + Intergenic
970597358 4:17612689-17612711 GGAGCTTCCCTTTGCCAACCAGG - Intergenic
971417890 4:26450422-26450444 TGGGCTTCCCTTGCAAAAGCAGG - Intergenic
972474625 4:39438722-39438744 GGTGCTTATCTTTTAGAACCAGG + Intronic
974074349 4:57155078-57155100 GGGGTTTCCCTCTCAGTAGCTGG + Intergenic
985943222 5:3155630-3155652 GGGGCTGCTCTGTCAGACCCTGG + Intergenic
993692372 5:91018119-91018141 TTTCCTTCCCTTTCAGAACCAGG - Intronic
995714861 5:115072458-115072480 AGGGCTACCCATTCAGAAGCTGG + Intergenic
995797916 5:115961709-115961731 GGGGTTTCCCTTCCTGAAGCCGG - Intergenic
1001125505 5:169015322-169015344 GGAGCTTCCCTGCCAGATCCAGG - Intronic
1002660991 5:180791136-180791158 GGGGCTTCCTTGTCAGGGCCTGG - Exonic
1002859658 6:1069785-1069807 GGGCCTTCCCTTTGAGAAATGGG - Intergenic
1003769623 6:9284723-9284745 GGGGCATTCCTTTCAAAAACAGG + Intergenic
1005320043 6:24644250-24644272 GGGGGTTCCCACTCTGAACCAGG + Intronic
1011651365 6:89509228-89509250 GGGGTTCACCTTTCTGAACCAGG + Intronic
1011945049 6:92890570-92890592 GGGGCTACCCCTGCAGAACCAGG - Intergenic
1013298539 6:108781432-108781454 TGGGTGTCCTTTTCAGAACCAGG + Intergenic
1017906186 6:158758830-158758852 GTGGCCTCCCTTCCAGGACCCGG + Intronic
1018702306 6:166436751-166436773 GGGACTTCCCTTCCAGGACGGGG - Intronic
1019530858 7:1502677-1502699 GTGGCTGCCCTTTGAGAACCGGG - Intronic
1020119530 7:5495325-5495347 GGGCCATCCTTTTCAGAGCCAGG - Intronic
1020272353 7:6604802-6604824 GGCTCCTCCCTTGCAGAACCTGG - Intronic
1021991096 7:26142386-26142408 AGGGCTTCCCTTTCCCCACCAGG - Intergenic
1024504021 7:50146030-50146052 GGGGCTTCCCTGTCAGTCGCTGG + Intronic
1027217342 7:76192559-76192581 GGGACAGCCCTCTCAGAACCAGG - Intergenic
1027712790 7:81628211-81628233 GTGGCTTCCCTTTCAAGACAAGG - Intergenic
1035061335 7:156071737-156071759 GTGGTTTGCCTTTCAGACCCTGG + Intergenic
1037493854 8:19420419-19420441 GTTGCTTCCCTTCCAGAAGCGGG + Exonic
1038617950 8:29112724-29112746 GGGGCATCCCTTGCAGGGCCAGG - Intronic
1041871743 8:62642483-62642505 GAGGCTGTCCTTTGAGAACCTGG - Intronic
1044226973 8:89730286-89730308 TGGAATTCCCTATCAGAACCTGG + Intergenic
1048391152 8:133966036-133966058 GGGGCTCCTCTTTCACAGCCAGG + Intergenic
1050363272 9:4851348-4851370 GAGGCTTCCCTTTCCCACCCTGG - Intronic
1051124440 9:13788217-13788239 GAAGCTTCACTTTCAGGACCAGG + Intergenic
1053296424 9:36917451-36917473 GGGGATTCCCTTACAAAAACTGG - Intronic
1053432268 9:38050464-38050486 AGGGCTTCCCTTGCAGAAGGAGG - Intronic
1059973274 9:119689595-119689617 TGGGATTCCCTTTCATGACCAGG + Intergenic
1060098185 9:120812712-120812734 GGGGCCTCCTTTTCAGAAGATGG + Intergenic
1061054532 9:128215423-128215445 AGGGCCTCACTTTGAGAACCTGG + Intronic
1061858065 9:133454040-133454062 CGGCCTTCCCTTGCAGAACGTGG + Intronic
1061985403 9:134127508-134127530 TGGCCTTCCATTCCAGAACCTGG + Intergenic
1062318343 9:135978773-135978795 GGGGCTCTCCTCTCAGACCCAGG + Intergenic
1186610290 X:11132089-11132111 GGGGCTTCCTGTTCTGAAACTGG + Intergenic
1187287422 X:17918787-17918809 GGGGCTTCTCTTTCGACACCAGG + Intergenic
1196032384 X:111104454-111104476 GGAGCTTCCCTTTCATAAGAAGG - Intronic
1200071186 X:153530280-153530302 AGAGCTTCCCATTCAGAAGCGGG - Intronic
1202101041 Y:21307696-21307718 GTGGCTCCTCTTTCAGAACAGGG - Intergenic