ID: 1156396950

View in Genome Browser
Species Human (GRCh38)
Location 18:36707347-36707369
Sequence CAGGTTGTGCATCTTCTACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 118}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156396950_1156396956 25 Left 1156396950 18:36707347-36707369 CCCAGTAGAAGATGCACAACCTG 0: 1
1: 0
2: 0
3: 11
4: 118
Right 1156396956 18:36707395-36707417 TCCACCCCCAAATTCCTACCTGG 0: 1
1: 0
2: 0
3: 18
4: 161
1156396950_1156396953 -8 Left 1156396950 18:36707347-36707369 CCCAGTAGAAGATGCACAACCTG 0: 1
1: 0
2: 0
3: 11
4: 118
Right 1156396953 18:36707362-36707384 ACAACCTGTAATCAAAGGAGAGG 0: 1
1: 0
2: 0
3: 8
4: 138

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156396950 Original CRISPR CAGGTTGTGCATCTTCTACT GGG (reversed) Intronic
900676361 1:3889055-3889077 CAGGATGTGTTTCCTCTACTCGG + Intergenic
911143038 1:94526069-94526091 CAGGATGTTTATCTTCTGCTAGG + Intergenic
911603991 1:99880322-99880344 CCTGTTTTTCATCTTCTACTGGG + Intronic
916283104 1:163074397-163074419 CAGGTTGAAAATCTTCTTCTGGG - Exonic
920818367 1:209356592-209356614 GAGGTTGTTCATCGTCTTCTAGG - Intergenic
920925609 1:210338658-210338680 GAGGTTGTGCACCTTGTCCTAGG + Intronic
922620737 1:226986541-226986563 CAGGTTGTGGATCTTCTCGGTGG - Exonic
1065231371 10:23601780-23601802 CAGGTGGTGCATCCTATTCTAGG + Intergenic
1065800796 10:29350085-29350107 CATTTTGTCCATTTTCTACTGGG - Intergenic
1067314857 10:45151668-45151690 CAGGATGTTCAGCTTCGACTTGG + Intergenic
1075697515 10:124447693-124447715 CGGGTTCTGCTTCTTCCACTTGG + Exonic
1076720808 10:132391990-132392012 CAGGGTTTGCATCTCCTACCTGG + Intergenic
1077199678 11:1299669-1299691 CAGTATGTGCATCTTGTACATGG - Intronic
1078744847 11:14102769-14102791 CAGGTTGTGCATCTTTGGCAGGG + Intronic
1079015942 11:16868760-16868782 AAGGAGGTGCATCTTCTCCTTGG + Intronic
1084607972 11:70183667-70183689 CAGGTTGTGCAACTTCTGCCTGG + Intronic
1085262525 11:75215678-75215700 GATGTTTTGCTTCTTCTACTTGG + Intergenic
1086163449 11:83749377-83749399 CAGGATTTGCATCTTTTTCTTGG - Intronic
1086199993 11:84190697-84190719 CAGATTGTGCATCTCCTAATAGG - Intronic
1087359552 11:97141264-97141286 ATGGTTGTGCGTCTTCTAGTTGG + Intergenic
1091016798 11:132058812-132058834 CAGGTTGTGCATCTACAACAAGG - Intronic
1092454255 12:8628211-8628233 CAGGATATGCATCATCCACTTGG + Intergenic
1092462949 12:8702156-8702178 CAGGTTATGCATTTCCCACTGGG + Intronic
1093226081 12:16485217-16485239 CAGGTTCATCATCTTCTACTTGG + Intronic
1101669503 12:106854991-106855013 CAAATTGTGTACCTTCTACTAGG + Intronic
1104259653 12:127171007-127171029 CAGGCTGAGCATCTTCTGCAAGG + Intergenic
1104942359 12:132400982-132401004 CAGGTGATGCAGCTTCTGCTTGG - Intergenic
1107894695 13:44949620-44949642 CAGGATGTGCATCCTTTATTTGG - Intronic
1117801848 14:59452384-59452406 CAGGTTGTTCATTTTCTTGTTGG - Intronic
1119449246 14:74694220-74694242 CAGGTTTTGGCTCTTGTACTTGG - Intronic
1120760881 14:88284206-88284228 CAGGTTCTGGATTTTCTTCTTGG - Intronic
1124565978 15:30814628-30814650 ATATTTGTGCATCTTCTACTTGG - Intergenic
1125458561 15:39886361-39886383 CAGGTTGTGCTGCTTCTAGGTGG - Intronic
1128705625 15:69835790-69835812 AAGGCTGGGCATCTTCTACCAGG - Intergenic
1129032698 15:72630050-72630072 CAGGTAGAGCAACTTCTTCTTGG + Intergenic
1129217196 15:74107195-74107217 CAGGTGGAGCAACTTCTCCTTGG - Intronic
1129734337 15:77951474-77951496 CAGGTGGAGCAACTTCTCCTTGG - Intergenic
1129841249 15:78744517-78744539 CAGGTGGAGCAACTTCTCCTTGG + Intergenic
1130161062 15:81400712-81400734 CAGGTTCTTCATCTTGTACGTGG + Intergenic
1130873877 15:87995252-87995274 TAGGTTGTGCAGTTTCTACTAGG - Intronic
1131304138 15:91226341-91226363 CACTCTGTGCATCTTCTTCTGGG - Exonic
1131977215 15:97959025-97959047 CAGGTTTTGCATTCTGTACTGGG - Intergenic
1133497037 16:6328560-6328582 AAGGCTGTGCATTTTCTACTGGG - Intronic
1133632107 16:7631044-7631066 CTGGTTAAGCATCTTTTACTAGG - Intronic
1139493806 16:67301630-67301652 CAGGCTGTGAATCCTCTTCTTGG + Intronic
1141505902 16:84478407-84478429 CAGGCCTTGCATTTTCTACTGGG - Exonic
1146508489 17:33425852-33425874 CAGGATGTGCATATTTTGCTAGG + Intronic
1146689338 17:34862416-34862438 GAGGATGTGCCTCTTCTTCTAGG - Intergenic
1147889358 17:43706216-43706238 CCGTTTGTGCAACTTCTACTGGG - Intergenic
1149056741 17:52375939-52375961 CAGGTTGTGCATCTGGCATTTGG - Intergenic
1151185058 17:72357812-72357834 CAGATCCTGCCTCTTCTACTTGG + Intergenic
1151890594 17:76948663-76948685 CAGGTGGTTCATCTCCGACTCGG - Exonic
1152555423 17:81050544-81050566 CAGGTTGAGCCTCTTCCACCCGG + Intronic
1156396950 18:36707347-36707369 CAGGTTGTGCATCTTCTACTGGG - Intronic
1156852332 18:41742915-41742937 GAGTTTGTGCATCTTTTAATGGG - Intergenic
1157715175 18:49880050-49880072 CAGTTTGTTCATCTACTACATGG - Intronic
1160157273 18:76443163-76443185 CAGGAGGTGCACCTTCTACATGG + Exonic
927711002 2:25325939-25325961 CAGGTCATGCTTCTTTTACTTGG - Intronic
928435783 2:31253698-31253720 CAGGGTGTGGACCCTCTACTGGG + Intronic
931714286 2:65016733-65016755 CTGGTTGTGCATCTACCACTGGG - Intronic
931785370 2:65613350-65613372 TAGATTGTGCATTTTCCACTGGG + Intergenic
935877225 2:107523114-107523136 CAGGTAGTGCCTCTTTTCCTGGG + Intergenic
937984098 2:127630860-127630882 CAGGGTGTGCAGCTTTTCCTTGG - Exonic
938403058 2:131010037-131010059 CAGGTTTTGTAGCCTCTACTAGG + Intronic
943528672 2:189051319-189051341 CAGGTTGCCCATCTTCTCCTGGG + Exonic
944135161 2:196391169-196391191 CAGGTTATTTATCTTCTACCAGG + Intronic
945441994 2:209890596-209890618 CAAGTTGTGCATCTTAAAATGGG + Intronic
948490065 2:238306941-238306963 CAGGTTGTGATTCTCCCACTGGG + Intergenic
948734585 2:239993498-239993520 CTGGTTCTGCGTCTTCTACCAGG - Intronic
1168939391 20:1695775-1695797 CAGGTGGTGCATCTCATACCTGG - Intergenic
1174084711 20:47998755-47998777 CAGGGTGTGCATGGTCTACAGGG + Intergenic
1175524282 20:59622818-59622840 CAGGATGTGCATCTCCTGGTGGG - Intronic
1179918650 21:44494905-44494927 CAGGTTTTGCATCTCCGAATCGG + Intergenic
1181022093 22:20108930-20108952 CAGGTTGGGCTTGTTCTTCTTGG - Exonic
953429980 3:42831205-42831227 GAGGTTTTGCAACTTCTCCTAGG - Intronic
953852775 3:46478684-46478706 CAGGTTCTGCTTCATCTACGAGG - Intronic
955057112 3:55464830-55464852 GAGGTTGTGCATCTTCCCCAAGG + Intergenic
957667755 3:83256319-83256341 CAGGATATTCATTTTCTACTTGG + Intergenic
962017143 3:131453367-131453389 CAGGTTATGCATTCTCAACTGGG + Intergenic
962114461 3:132487812-132487834 CAGGTAGTACATCTGCTACCAGG - Intronic
962269484 3:133967674-133967696 CAGGTTGTGCAACTCCCACTAGG + Intronic
964483417 3:157163675-157163697 CAGGTTTTGCATGGTCTCCTCGG + Intergenic
965359900 3:167726011-167726033 AAGCTTGTGGATCTTCAACTTGG + Intronic
966086063 3:176068164-176068186 CCAGTTGTGCCTCTTCTCCTCGG - Intergenic
967736393 3:192957164-192957186 GAGGTGAGGCATCTTCTACTGGG + Intergenic
968582920 4:1403211-1403233 CGGGTTCTGCTTCTTCCACTTGG + Exonic
974155910 4:58072272-58072294 CAAGATGTGCATCTCCTATTTGG + Intergenic
975739914 4:77419761-77419783 CAGTTTAAACATCTTCTACTTGG - Intronic
984473838 4:180212858-180212880 AAAGTTAAGCATCTTCTACTTGG - Intergenic
988176018 5:27726396-27726418 AAGGTTGTATATCTTCTAATAGG - Intergenic
988945403 5:36191667-36191689 TAGGCTCTGCATCTTCTCCTGGG - Intergenic
990353963 5:54946761-54946783 CAAGTTGTGCATTTCCTACCAGG - Intergenic
990382130 5:55228375-55228397 CAGTTTCTGCATCTACTCCTGGG - Intergenic
993820243 5:92605442-92605464 CAGCTTTTGCATTTTCTACCAGG - Intergenic
997939068 5:138140082-138140104 CAGGTTTTCCATCATCCACTGGG + Exonic
999784094 5:154875390-154875412 CAGGATGCTCATCTTCTCCTGGG - Exonic
1000258888 5:159567083-159567105 CAGCTTGTGTTTATTCTACTGGG - Intergenic
1002916435 6:1531732-1531754 GAGGTTGAGCATCTTTTGCTAGG + Intergenic
1006974266 6:38083189-38083211 CAGTTTGTGCTACTTCTGCTGGG - Intronic
1010739669 6:79485549-79485571 CAGGTGGTACATCTTTTAATTGG + Exonic
1012633818 6:101509612-101509634 CAGATTCTTCATCTTCTACCTGG - Intronic
1013915342 6:115330608-115330630 CAGGTTGTCTATCTTCTTCAAGG - Intergenic
1022258559 7:28682837-28682859 CAAGTTGTGCCTTTTCTATTGGG + Intronic
1025283298 7:57643577-57643599 GAGCCTGTGCATTTTCTACTAGG + Intergenic
1025818324 7:64940642-64940664 CAGGTTGAGCATATTCAACTAGG + Intergenic
1026216541 7:68354367-68354389 CAGGATGTCCATCCTCTATTGGG + Intergenic
1033030510 7:137821328-137821350 CAGGGGGTGCCTCCTCTACTTGG + Intronic
1033163628 7:139018973-139018995 CAGGTTGAGCATCCCCCACTGGG - Intergenic
1034849168 7:154477751-154477773 CAGGCTGGGCATTTTCTGCTGGG - Intronic
1035651225 8:1266886-1266908 CTGAGTGTGCATCTTCTGCTGGG - Intergenic
1036014731 8:4769788-4769810 CACGTTTAGCATTTTCTACTTGG + Intronic
1036048221 8:5167295-5167317 CAGGTTGTGCAGCTTCAAAGAGG + Intergenic
1041179982 8:55237014-55237036 CTGGTTGTGCTTCTTCTTCAAGG + Intronic
1044756483 8:95467826-95467848 TAGGTCCTGCTTCTTCTACTTGG - Intergenic
1046561085 8:115838168-115838190 CTGGTTGTGAAGCATCTACTTGG - Intergenic
1048487245 8:134859776-134859798 AAGGTTGTGCTTTTTCTATTGGG - Intergenic
1050262362 9:3854088-3854110 CAGGCTGTGCATCTACTGCCTGG + Intronic
1050317687 9:4419979-4420001 CAGGTTGAGCACCGTCTACAGGG + Intergenic
1058042641 9:100320638-100320660 CAGGTTTTACCACTTCTACTAGG + Intronic
1060134155 9:121135632-121135654 CAGGTTGTGCATATCCTGGTTGG - Intronic
1061717793 9:132531739-132531761 CAGGCTGTGCCCCTTCTGCTGGG - Intronic
1192344768 X:70292467-70292489 CAGGTTGTGTATCTTTTAGCAGG + Intronic
1192633920 X:72800923-72800945 CAGGTTTTGCAGCTGCTCCTTGG + Intronic
1192647790 X:72919878-72919900 CAGGTTTTGCAGCTGCTCCTTGG - Intronic
1193632978 X:83912305-83912327 CCTGGTGTGCATCTTCTACCTGG - Intergenic
1196296903 X:114008327-114008349 CAGGTTTTGGATATTCTTCTAGG - Intergenic
1196488361 X:116240454-116240476 CAGGTTGGGCGTATGCTACTTGG + Intergenic
1199655804 X:149994306-149994328 AAGGTTGTACATTTTCCACTTGG - Intergenic
1199892449 X:152099619-152099641 CAGGTTGTGTATCAAGTACTGGG + Intergenic
1200768390 Y:7101172-7101194 CAGCTGGTACAGCTTCTACTAGG + Intergenic