ID: 1156397152

View in Genome Browser
Species Human (GRCh38)
Location 18:36708741-36708763
Sequence CACATCACTGCTGCTTGACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 165}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156397152_1156397157 30 Left 1156397152 18:36708741-36708763 CCCTGTCAAGCAGCAGTGATGTG 0: 1
1: 0
2: 1
3: 17
4: 165
Right 1156397157 18:36708794-36708816 CTTCCTTTTCTGCTGCCAATTGG 0: 1
1: 0
2: 3
3: 24
4: 252

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156397152 Original CRISPR CACATCACTGCTGCTTGACA GGG (reversed) Intronic
900287973 1:1910844-1910866 CCCATCACTGTTGCTTGCCCTGG + Intergenic
902756987 1:18555582-18555604 CTCATGACTGCTGCTTGTCTTGG - Intergenic
903730567 1:25492009-25492031 CACCACACTGCTGCTTCACTGGG - Intronic
904834882 1:33329185-33329207 TTCATCACTGCTGCTAGAGATGG - Intronic
906243608 1:44257754-44257776 GACATCACAGCTGCTGGACCTGG - Intronic
906478496 1:46185587-46185609 CCAATCACTGCTGCTTGCCAGGG - Exonic
908982915 1:69979979-69980001 CACATCCCTGTTGCTTACCATGG - Intronic
910223954 1:84917326-84917348 CACAAAACTGCTGCTGGCCAAGG + Intergenic
911085327 1:93972436-93972458 CACATCACAGCTGCCTGCCCTGG + Intergenic
911098223 1:94073178-94073200 CACATCACTGTGGCTTGTCCTGG - Intronic
912337757 1:108878228-108878250 TAGATCACTGTTGGTTGACATGG + Intronic
912659117 1:111512973-111512995 CAAACCACTGCTTCTTGGCAAGG - Intronic
913123951 1:115768140-115768162 CACATCCCAGCTGTGTGACAAGG + Intronic
914255410 1:145958073-145958095 CCCATCACTGGTGATTGGCATGG - Intergenic
916583241 1:166127135-166127157 AAAATCACTCCTGCTTTACAGGG + Intronic
922078259 1:222269009-222269031 CACCTCACTGCTGCCTGAGATGG + Intergenic
922504661 1:226119592-226119614 CGCATCCCTGCAGCTTGAGAGGG - Intergenic
1067207958 10:44235708-44235730 CACATCCTAGCTGCTAGACAAGG + Intergenic
1069765470 10:70854107-70854129 GACATCACTGCTGCTTCACTTGG - Intronic
1070709188 10:78665871-78665893 AACATCTCTGCTGCTTGCTAAGG - Intergenic
1071896815 10:90076582-90076604 CACAGCACTGATGCTTGCCCAGG + Intergenic
1075935658 10:126338979-126339001 CACATCCCTGCTGCTTCACTGGG + Intronic
1078415199 11:11159246-11159268 CACAGTATTGCTGCTTGACCAGG - Intergenic
1079217724 11:18528712-18528734 CACATCACTGCACCATGACCTGG - Intergenic
1080110227 11:28558470-28558492 CATATCATTGCTGCTTTTCAAGG - Intergenic
1081495268 11:43602853-43602875 ATGATCACTTCTGCTTGACAGGG - Intronic
1081756099 11:45545650-45545672 CAGATCTCTGCTGCTTAAGAGGG - Intergenic
1082939215 11:58686379-58686401 TACATCATAGCTGCCTGACATGG - Intronic
1085879660 11:80451340-80451362 TACATCCCTGCTGTTTGTCACGG - Intergenic
1086936367 11:92749718-92749740 CACATAACTGGTGATTTACAGGG + Intronic
1090176244 11:124652365-124652387 CACATCACTGCTGCTGGGAAAGG - Intronic
1090223965 11:125057638-125057660 CACCTCATTACTGCTTGAAAGGG + Intergenic
1090993993 11:131848559-131848581 CACTTCACTGCTTCTTGAAGAGG + Intronic
1091865595 12:3833563-3833585 CACTGCACTCCAGCTTGACACGG + Intronic
1092004306 12:5056076-5056098 CCCATCACTGATGCTGGGCATGG + Intergenic
1093490718 12:19701081-19701103 CACATCACTGCTGCTGGTGGTGG + Intronic
1093706142 12:22276633-22276655 CACTTCACTCCTGCTTGTCTGGG - Intronic
1094109488 12:26846546-26846568 CCCATCACAGCTGCTTCACACGG + Intergenic
1095905431 12:47372479-47372501 CACACCACTGCTGCTTTAACGGG + Intergenic
1096593360 12:52677150-52677172 CAGATCACTGCTGGCAGACATGG - Exonic
1097975583 12:65683161-65683183 CACATCACTGCTTAATGCCAGGG - Intergenic
1111075762 13:83232533-83232555 TATATCAAGGCTGCTTGACATGG + Intergenic
1111432959 13:88167538-88167560 CACATCTCTGCATCTTGTCATGG - Intergenic
1111697816 13:91647550-91647572 CACATCACAGATGCCCGACAGGG - Intronic
1111932628 13:94527044-94527066 CGCAACACTGCAGCTTGACTGGG + Intergenic
1112159796 13:96855344-96855366 CACACCACTGTTGAGTGACAAGG + Intergenic
1114016337 14:18433070-18433092 CACAACACTGCTGCTGGATTCGG - Intergenic
1114022572 14:18493842-18493864 CACAACACTGCTGCTGGATTCGG + Intergenic
1115003397 14:28449582-28449604 CACGTCACAGCTACTTGGCATGG - Intergenic
1116328124 14:43560008-43560030 CACATCATTGCCACTAGACAGGG - Intergenic
1116377619 14:44223894-44223916 CAAAGCATTGGTGCTTGACATGG + Intergenic
1118156156 14:63243879-63243901 CAAATGACTGCTGCTTGCCTTGG - Intronic
1121212140 14:92215205-92215227 CACCTCACTGTTGGTTGATATGG - Intergenic
1122398008 14:101448709-101448731 CACATCACGGCTGCTAAACTTGG + Intergenic
1124830532 15:33144874-33144896 CACATCATTGCTGGTTCATAGGG - Intronic
1125091379 15:35796677-35796699 TACATCACTGCAGCATGATAAGG - Intergenic
1126164156 15:45639772-45639794 CACATAAATGATGCTTGAGATGG + Intronic
1126972236 15:54128999-54129021 CACATCACTGCTGCTTCTTTTGG + Intronic
1128448926 15:67790007-67790029 AACCTCAATGTTGCTTGACAAGG - Intronic
1128697866 15:69781853-69781875 CACATAACTGCTGCAGGACTGGG + Intergenic
1130543099 15:84836077-84836099 GACAGCATTGCTGCTTTACACGG + Intronic
1134265979 16:12692895-12692917 AACATCACAACTGCCTGACATGG + Intronic
1135355069 16:21762212-21762234 AGCATCACAGCTGCTTGTCAGGG + Intergenic
1135453553 16:22578354-22578376 AGCATCACAGCTGCTTGTCAGGG + Intergenic
1135947146 16:26875204-26875226 CACATCACTGCATCTGGACAAGG + Intergenic
1136774394 16:32863917-32863939 CACATGGCTGCTTCGTGACAGGG - Intergenic
1136896217 16:33997597-33997619 CACATGGCTGCTTCGTGACAGGG + Intergenic
1137433122 16:48434319-48434341 CAGAACACTGCTGCAGGACAGGG - Intronic
1138047180 16:53737652-53737674 CATATTACTGCTGGGTGACAAGG - Intronic
1141792572 16:86246635-86246657 CACATGACTGTTGCCTGAGATGG + Intergenic
1203076821 16_KI270728v1_random:1126053-1126075 CACATGGCTGCTTCGTGACAGGG - Intergenic
1203119201 16_KI270728v1_random:1521724-1521746 AACTGCACTGCTGCTTCACAAGG + Intergenic
1143038352 17:4014408-4014430 GAAGTCACTGCTGCTGGACATGG + Exonic
1143780084 17:9224754-9224776 CACATTTCTGCTGCAAGACAAGG + Intronic
1144043170 17:11430930-11430952 CACATCAGAGCAGCTTGTCACGG + Intronic
1144100938 17:11941912-11941934 CTCATCACTTCAGCTTCACATGG + Intronic
1144909814 17:18672021-18672043 CTCATCACTGCTGCGTGACGTGG + Intronic
1147499562 17:40949647-40949669 CACATGACTGCTCCCTGAAAAGG - Intergenic
1147941898 17:44054682-44054704 CCCATCACTGCTGAGTGGCAGGG - Intronic
1148434113 17:47668216-47668238 CACACCCCTGCTGCTTTGCAGGG - Exonic
1154177056 18:12092676-12092698 CCCAGCACTGCTGATTGGCATGG - Intergenic
1156086502 18:33411619-33411641 CACATCACTGAAGCTAAACATGG - Intronic
1156397152 18:36708741-36708763 CACATCACTGCTGCTTGACAGGG - Intronic
1157574906 18:48737036-48737058 CACAGGACTGCTGGGTGACATGG - Intronic
1159304996 18:66629386-66629408 CTTATCACTGCTGATGGACATGG - Intergenic
1159827522 18:73232350-73232372 TACATCCCTGCTGCCTGTCATGG - Intronic
1160166969 18:76522341-76522363 CACCTCACTGCTGCTGTACGGGG - Intergenic
1162032268 19:7922678-7922700 CAGATCCCAGCTGCTTGCCAAGG - Exonic
1167645244 19:50702266-50702288 CACTTCACTGCCTCCTGACAGGG + Intronic
926063957 2:9822382-9822404 CACATCAGTCCTGTTTAACAAGG - Intergenic
927243079 2:20935594-20935616 CACAGCAGGGCTGATTGACACGG + Intergenic
928831805 2:35495172-35495194 CACATCACTGCTTTTTGCCATGG + Intergenic
931062220 2:58543807-58543829 TACCTCACTACTGCCTGACAAGG - Intergenic
931069033 2:58623497-58623519 CAAATCATTGATGCTGGACAAGG + Intergenic
931651863 2:64475862-64475884 CACCCCACTGCTGCTTGCTATGG + Intergenic
931652068 2:64477612-64477634 CACCCCACTACTGCTTGCCATGG - Intergenic
933652093 2:84857832-84857854 CACAGCAGTGCTGCAGGACAAGG - Intronic
937513473 2:122626116-122626138 CACTTCACTGCTGCATGAAATGG + Intergenic
938076843 2:128344256-128344278 AACATCACTGCTCCTTCACTTGG - Intergenic
938161519 2:128988678-128988700 CAAAGCACTGCTGTTTGTCAAGG + Intergenic
941336219 2:164246782-164246804 CACATGACTGCTGATTTAAAGGG + Intergenic
943526527 2:189023221-189023243 CACACCACTGCTGTTTAACCTGG + Intergenic
944105401 2:196074157-196074179 CACATTCCTCTTGCTTGACAGGG - Intergenic
1168803653 20:660411-660433 CACACCACTGCAGCCTGGCAAGG + Intronic
1171934001 20:31256530-31256552 CACATCACACCTGCCTAACAGGG + Intergenic
1174531191 20:51215618-51215640 TACATCACTGTGGCTTGTCAAGG + Intergenic
1175036461 20:56005142-56005164 CACAGCACTGGTGATTGGCAAGG + Exonic
1177723936 21:24943321-24943343 CACAGCCCTCCTGATTGACAAGG - Intergenic
1178144915 21:29728183-29728205 AACCTCAGTGCTGCTTGGCAAGG - Intronic
1180010338 21:45045619-45045641 CTCATCATTGCTGCTGGAAATGG + Intergenic
1180073406 21:45449840-45449862 GACATCTCTGCTGCTTGGCCGGG - Intronic
1180440844 22:15363943-15363965 CACAACACTGCTGCTGGATTCGG - Intergenic
1180446616 22:15420256-15420278 CACAACACTGCTGCTGGATTCGG + Intergenic
1182559468 22:31148542-31148564 CACTTCACTCCTGCTGGGCAGGG - Intergenic
1182562303 22:31170152-31170174 CACATCACTGTTACATCACAAGG - Intronic
1184569760 22:45314871-45314893 AACATCAGTGCAGCTTGAAATGG - Intronic
950226102 3:11235696-11235718 CACTTCATTACAGCTTGACAAGG + Intronic
951462890 3:22969988-22970010 TACATCACTGTTTGTTGACATGG + Intergenic
952467105 3:33600930-33600952 CACATCAGTGTTGCTTGATAAGG + Intronic
952539583 3:34353637-34353659 CACAACACTGTTTATTGACAGGG + Intergenic
953239877 3:41139282-41139304 AACATCAAAGCTGCTTAACATGG + Intergenic
955571850 3:60315599-60315621 TTCATCACTGCTGCTGCACAGGG + Intronic
957893019 3:86384116-86384138 CACAGTACTGCTACTGGACAGGG + Intergenic
960338215 3:116444636-116444658 AACACCACTGCTGCTTGACAGGG + Intronic
962487397 3:135857977-135857999 CACGCCACTGCTGGGTGACAGGG - Intergenic
962606652 3:137037755-137037777 CACAGCACTGCTGCTCCACTGGG - Intergenic
963671890 3:148261348-148261370 CCCATCACTGCTTCTTTACCTGG - Intergenic
964535076 3:157712240-157712262 AATATTACTGCTTCTTGACAAGG + Intergenic
972699526 4:41480680-41480702 CACATCTCTGCTCCTGGAAATGG + Intronic
977288997 4:95143178-95143200 CACAGCACTGCTGCCTGGTATGG - Intronic
977779862 4:100968545-100968567 CTCATCAGTGCTACTTGACAGGG - Intergenic
978560891 4:110032426-110032448 CACATCACTGGTGGGAGACAAGG - Intergenic
982874980 4:160636378-160636400 TACATCACTGCTGCTTCAACTGG + Intergenic
986017120 5:3767085-3767107 CAGATCACTGCAGCTTCCCAAGG - Intergenic
986164194 5:5259265-5259287 CCCATCAGTGATGCTGGACAAGG - Intronic
995968200 5:117935714-117935736 CATATCTCTACTGCTTTACATGG - Intergenic
996345809 5:122487156-122487178 CTCATCACCACTGCTTGTCAGGG + Intergenic
1000470762 5:161638432-161638454 CACATCACTGATACTTGGAAGGG - Intronic
1000873308 5:166604531-166604553 CACAACTCTGCTGGTTGACTTGG + Intergenic
1001304292 5:170560533-170560555 CACAACACTGCTGTGTGACAGGG - Intronic
1001756477 5:174174113-174174135 AAAATCACTGCTGCTGGCCATGG - Intronic
1010470051 6:76216930-76216952 CACATCACTGCAGCAGGAGAGGG - Intergenic
1011973858 6:93266722-93266744 CAAGTCACTGCTCCCTGACATGG + Intronic
1013283851 6:108663717-108663739 CTCATCACTGCTGCGTGACGTGG - Exonic
1015436047 6:133190129-133190151 CACCTATCTGTTGCTTGACATGG - Intergenic
1017272645 6:152526589-152526611 CACATTACTGGGGCTTAACAAGG + Intronic
1019614662 7:1953813-1953835 CCCATCACTGCTGGGTGACACGG + Intronic
1019916443 7:4135892-4135914 CACACCACTGCTGCATGCAACGG - Intronic
1024613797 7:51090170-51090192 AACATCACTTCTTCATGACAAGG - Intronic
1024633089 7:51265201-51265223 AGCCTCACTGCTGCTTTACAAGG + Intronic
1024666086 7:51548597-51548619 CACATCACTGCTGCCAGGAAAGG - Intergenic
1027689583 7:81326609-81326631 CATATGACTGCTGCTTTAAATGG + Intergenic
1029711080 7:102300351-102300373 CACATCCATGCTGCTTGGAATGG + Intronic
1029934247 7:104406710-104406732 GACATGACTGGTGATTGACAGGG + Intronic
1032920904 7:136545634-136545656 CACATAACAGCTGCTTGAGAGGG + Intergenic
1033622173 7:143071361-143071383 CCCATAACGGCTGCTTCACAGGG - Intergenic
1036690799 8:10943559-10943581 CACATGCCTGCTCCTTGACCTGG + Intronic
1038209902 8:25507110-25507132 CACAACACTGCTACTTTCCATGG - Exonic
1039745784 8:40425268-40425290 AACATCTATGCTGCTTGTCAGGG - Intergenic
1040618450 8:49063270-49063292 TACATCACTCCTGCATCACAGGG - Intronic
1042191131 8:66188368-66188390 AACATCACTGCTGCTTTGCGCGG - Intergenic
1043757894 8:84027160-84027182 CACTTGACAGCTGCTTCACATGG - Intergenic
1044769833 8:95619347-95619369 GACATTACTGCTGCTTGAATTGG + Intergenic
1047189404 8:122664237-122664259 CACCTCACTTCTCCTTTACATGG - Intergenic
1047570449 8:126093372-126093394 CAGAACACTCCTGCTTGTCAGGG - Intergenic
1048486321 8:134851053-134851075 CATCTCACTGCTGCTTGTCGTGG + Intergenic
1048499221 8:134960596-134960618 CATATCAGTGCTGCTAGACCAGG + Intergenic
1051598649 9:18850241-18850263 CACATCATTCCTGTTGGACATGG - Intronic
1052111276 9:24585786-24585808 AATATCACTGCTCATTGACAAGG - Intergenic
1052348086 9:27430118-27430140 GACATCACTACTCCTTGACCTGG + Intronic
1057448875 9:95138533-95138555 GCCAGCACTGCTGCTTGAGAAGG - Intronic
1057465466 9:95310326-95310348 CACTGCACTCCTGGTTGACAGGG + Intronic
1187637750 X:21250871-21250893 TACATTACTGCTGCCTTACAAGG + Intergenic
1188311570 X:28623520-28623542 AACATCGCTGCTGTTTGAGAAGG - Intronic
1192008294 X:67240864-67240886 CAAATCACTGCCTCTTGACCTGG - Intergenic
1192156418 X:68750159-68750181 CTCAGCACTGCTGTTTGCCAGGG - Intergenic
1195595370 X:106682950-106682972 CACAGCACTGTTGCTTGCCCAGG - Intergenic
1196322275 X:114355417-114355439 AACATCACAGCTACGTGACATGG + Intergenic
1199087150 X:143640540-143640562 CACATCAATTATGCATGACAAGG + Intergenic
1200105559 X:153710139-153710161 CACATGACTGCTTCATGACAGGG + Intronic
1200292204 X:154885298-154885320 CACTCCCCTGCTGCTGGACATGG + Exonic
1200339041 X:155381035-155381057 CACTCCCCTGCTGCTGGACATGG + Exonic
1200347428 X:155459657-155459679 CACTCCCCTGCTGCTGGACATGG - Exonic
1200750998 Y:6944006-6944028 CACATCACTCACACTTGACAGGG + Intronic